Endophytic muzabingffia and application thereof in prevention and treatment of rice sheath blight disease and rice blast

Abstract

The invention belongs to the field of biological prevention and control, and particularly discloses endophytic muzabingia LZ-441 and application of the endophytic muzabingia LZ-441 in prevention and control of rice sheath blight disease and rice blast, the endophytic muzabingia LZ-441 is preserved in China General Microbiological Culture Collection Center on October 9th, 2024, the preservation number is CGMCC NO: 32155, and the preservation number is CGMCC NO: 32155. The preservation address is No.3, Yard 1, Beichen West Road, Chaoyang District, Beijing. The endophytic Umezabingia endophytic LZ-441 has a relatively good inhibition effect on both rhizoctonia solani and magnaporthe oryzae, the inhibition rate of the endophytic Umezabingia endophytic LZ-441 on the rhizoctonia solani reaches 98.85%, the inhibition rate of the endophytic Umezabingia endophytic LZ-441 on the magnaporthe oryzae is 68.02%, and in a field test, the prevention and treatment effects of the endophytic Umezabingia endophytic LZ-441 on the rhizoctonia solani and the magnaporthe oryzae are 74.28% and 70.38% respectively. Therefore, the compound can be used for preventing and treating rice sheath blight disease and rice blast, and has good development and application prospects.

Description

Technical Field

[0001] The invention relates to the field of biological control, in particular to an endophytic bacterium and application of the bacterium in controlling rice sheath blight and rice blast. Background Art

[0002] Rice sheath blight (Rhizoctonia solani) and rice blast (Pyricularia oryzae) are the two most harmful diseases in my country's rice-growing areas. Rice sheath blight is caused by the asexual soil-borne pathogenic fungus Rhizoctonia solani. The disease is most serious from the peak tillering stage to the heading stage of rice, and mainly affects the leaf sheaths and leaves. In the early stage of the disease, oval dark green water-soaked spots first appear on the leaf sheaths near the water surface, and then gradually expand into a cloud-like pattern, with gray-green to gray-white in the middle and dark brown edges. The vegetative hyphae of Rhizoctonia solani are well developed, but under adverse conditions, the hyphae will entangle and aggregate to form sclerotia, which are hard in texture and black or gray-brown in color. As the initial source of infection in the second year, the sclerotia have strong stress resistance, resulting in serious damage and difficulty in prevention and control. Rice sheath blight can cause rice grains to be incomplete, resulting in reduced yield and quality. In severe cases, it can even cause the entire rice plant to fall over. In my country, it can lead to a 10% to 50% reduction in rice production each year.

[0003] Rice blast is caused by Pyricularia oryzae, which can occur throughout the entire growth period of rice. According to the different periods and sites of onset, rice blast can be divided into seedling blast, leaf blast, leaf pillow blast, node blast, ear neck blast, stalk blast, grain blast, etc. Among them, leaf blast and ear neck blast are the most common and cause greater harm. When leaf blast is serious, the whole field looks like it is burned, the plants are stunted, new leaves are difficult to grow, and heading is difficult. When ear neck blast occurs seriously during the heading period, a large number of white ears or shrunken grains will be caused. Under suitable conditions for the disease, rice blast can be widespread in a short period of time, causing serious impact on rice production, generally reducing production by 10%-20%, and in severe cases, losses of more than 50% or even no harvest.

[0004] At present, in actual production, people mainly use Jinggangmycin to prevent and control rice sheath blight, and no other ideal alternative antibiotics have been found so far. The prevention and control of rice blast mainly uses tricyclazole drugs. Since tricyclazole drugs are chemical synthetic drugs, although they have good effects in the short term, if similar chemical agents are used continuously over a large area for a long time, they will seriously pollute the environment and cause a significant increase in the resistance and drug resistance of pathogens. In the long run, it will pose a serious threat to the stability of the entire agriculture and human health. Therefore, it is particularly urgent and important to explore and discover antibacterial substances that have good prevention and control effects on the above pathogens, can be degraded in the natural environment, and are harmless to the human body. Summary of the invention

[0005] In order to solve the above technical problems, the present invention provides an endophytic bacterium Messergillus and its application in preventing and controlling rice sheath blight and rice blast.

[0006] To achieve the above object, the present invention is implemented according to the following technical solutions:

[0007] One of the purposes of the present invention is to provide an endophytic Umezawaea, which is an endophytic Umezawaea (Umezawaea endophytic) LZ-441, which was deposited in the General Microbiological Center of China National Microbiological Culture Collection on October 9, 2024, with a deposit number of CGMCC NO: 32155, and a deposit address of No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing.

[0008] The second object of the present invention is to provide an application of endophytic Bacillus meseleri in preventing and controlling rice sheath blight and rice blast.

[0009] Compared with the prior art, the endophytic Umezawaea LZ-441 of the present invention has a good inhibitory effect on rice sheath blight and rice blast, the inhibition rate of rice sheath blight reaches 98.85%, and the inhibition rate of rice blast is 68.02%. In the field test, the control effect of LZ-441 on rice sheath blight and rice blast is 74.28% and 70.38% respectively. Therefore, it can be used for the control of rice sheath blight and rice blast, and has a good development and application prospect. BRIEF DESCRIPTION OF THE DRAWINGS

[0010] Figure 1 This is the antibacterial effect of strain LZ-441 on rice sheath blight.

[0011] Figure 2 This is the antibacterial effect of strain LZ-441 on rice blast fungus.

[0012] Figure 3 The colony morphology characteristics of strain LZ-441.

[0013] Figure 4 Phylogenetic tree of strain LZ-441 based on 16S and gyrB sequences.

[0014] Figure 5 The field control effect of strain LZ-441 on rice sheath blight: A, control group inoculated with rice sheath blight 24 hours after spraying ISP2 culture medium; B, protection treatment group inoculated with rice sheath blight 24 hours after spraying LZ-441 fermentation liquid; C, treatment treatment group inoculated with rice sheath blight 24 hours after spraying LZ-441 fermentation liquid; D, drug control group inoculated with rice sheath blight 24 hours after spraying Jinggangmycin.

[0015] Figure 6 The field control effect of strain LZ-441 on rice blast: A, control group inoculated with rice blast fungus 24 hours after spraying ISP2 culture medium; B, protection treatment group inoculated with rice blast fungus 24 hours after spraying LZ-441 fermentation liquid; C, treatment treatment group sprayed with LZ-441 fermentation liquid 24 hours after inoculation with rice blast fungus; D, drug control group inoculated with rice blast fungus 24 hours after spraying Jinggangmycin. DETAILED DESCRIPTION

[0016] In order to make the purpose, technical solution and advantages of the present invention more clearly understood, the present invention is further described in detail below in conjunction with embodiments. The specific embodiments described herein are only used to explain the present invention and are not used to limit the invention.

[0017] Example 1. Isolation, screening and identification of strain LZ-441

[0018] Soil samples were collected from paddy fields in Zhuanghe City, Dalian City, where the disease was serious. 2 g of soil sample was prepared into 5 ml of stock solution. 10 -4 , 10 -5 , 10 -6 100 μL of the dilution was spread on the fermentation medium plate, with sterile water as the control, and each treatment was repeated 3 times, and the plate was cultured at 28°C for 4-8 weeks. Single colonies with different culture characteristics such as colony morphology, color, and size were selected for purification and preservation; Fermentation medium: distilled water 1000mL, glucose 5g, malt extract 10g, cottonseed cake powder 10g, soluble starch 20g, yeast extract 5g, potassium dihydrogen phosphate 0.5g, ammonium sulfate 5g, calcium carbonate 3g, sodium chloride 1g, agar 15g, pH = 7.2.

[0019] A total of 40 strains were isolated, including 1 fungus, 32 bacteria and 7 actinomycetes.

[0020] The isolated strains were fermented with ISP2 liquid medium containing 4% XAD-16 macroporous adsorption resin, 300 mL for each strain. The resin of each strain was collected, washed, dried, and then the macroporous adsorption resin was completely soaked in methanol for 4 times, each time for 4 hours, one of which was soaked overnight. The methanol soaking liquid was collected, and the methanol soaking liquid was extracted with methanol: water: dichloromethane = 1:1:2, and the dichloromethane phase was collected. The dichloromethane phase was concentrated using a rotary evaporator to obtain a dichloromethane extract, which was the crude extract of the strain fermentation.

[0021] The mycelium growth rate method was used to screen the biocontrol strains of rice blast and rice sheath blight. The crude extracts of each strain were dissolved in 0.5% (v / v) DMSO, fixed to volume with sterile water containing 0.25% (v / v) Tween-80, and mixed according to V agent: V culture medium = 1:9 to make a final concentration of 100μg / mL, and the corresponding solvent was used as a control. Use a puncher to punch out 5mm activated rice blast and rice sheath blight fungus cakes and place them in the center of the plate at 28℃. After 2-7 days, the colony diameter was measured and the inhibition rate was calculated. Each treatment was repeated 3 times.

[0022]

[0023] Finally, a strain was selected whose fermentation crude extract had good inhibitory effect on both pathogens. The inhibition rate on rice sheath blight reached 98.85% (see Figure 1 ), the inhibition rate against rice blast fungus was 68.02% (see Figure 2 ). The strain was identified by morphology: Figure 3 As shown, its single colony is orange-yellow aerial hyphae; further, the strain was subjected to molecular biological identification: the 16S rDNA sequencing results of the strain are as follows:

[0024]

[0025] The gyrB sequence is as follows:

[0026] CCAATCCGGAACTTCGTTACGGCGGTCTCGGTGGTCTGCACGGCGTCGGCATCTCGGTCGTCAAC

[0027] GCGCTGTCCACCGCGGTCGACGTGGAGGTGAAGCGCCAAGGTTTCACGTGGAACCAGCGCTACGAG

[0028] GGCACGAAGCCCGCGCACCCGTTGACCAAGGGCGCCCCGGCGACGGACACCGGCACCGTCATCACG

[0029] TTCTGGGCGGACCCGACGATCTTCGAGACCACCACCTACAACCTGGAGACGATCTCCCGTCGCCTCC

[0030] AGGAGATGGCCTTCCTCAACAAGGGCCTCACGATCGTCCTGCGCGACGAGCGGGTCGTGGAGGTGG

[0031] ACACCGAGGCCGACGCCGAGGGTCACGTCGCGCGCGTCAAGGAGCGCACGTTCCACTACCCGAACG

[0032] GGCTCGAGGACTTCGTCAAGCACATCAACCACACGCGCGAAGAGGTCCACAAGAAGGTCATCGCGT

[0033] TCGAGGCCAAGGGCGACGGCATCGACGTCGAGGTCGCGATGCAGTGGAACACCGGCTACACGGCTT

[0034] CGGTGTACACGTTCGCCAACACGATCAACACCCACGAGGGTGGCACGCACGAGGAGGGCTTCCGCG

[0035] CCGCGTTGACCAGGGTGGTCAACGAGTACGCGCGCGACAAGAAGCTGCTCAAGGAGAAGGACACCA

[0036] ACCTCACCGGTGACGACATCCGCGAGGGTCTCGCCGCGATCATCTCGGTGAAGTTGAAGGAGCCCCA

[0037] GTTCGAGGGGCAGACGAAGACCAAGCTGGGCAACAGCGAGGCGAAGTCGTTCGTGCAGAAGTCGA

[0038] CCAACGAGCACCTGGCCGACTGGTTCGAGCGCCACCCCAACGAGGCGCACGATCGTGACGAAGG

[0039] CGGTCTCGTCGGCGCAGGCCCGGATGCGGCCCGCAAGGCGCGCGAACTGGTCCGCCGCAAGGGTG

[0040] CGCTGGACATCGGCGGCCTGCCCGGCAAGCTGAAGGACTGCCGCTCCACCAACCCGGAGGAGTGCG

[0041] AGCTCTACATCGTGGAGGGCGACTCCGCGGGCGGTTCGGCCAAGGAGGGCCGGGACTCCATGTTCCA

[0042] GGCGATCCTGCCGATCCGCGGCAAGATCATCAACGTGGAGAAGGCCCGCATCGACCGGGTCCTCAAG

[0043] AACAACGAGGTGCAGAGCCTCATCACGGCGCTCGGCACCGGCATCCACGACGAGTTCGACCTGACG

[0044] AAGCTGCGCTACCACCAGACACCCGTACACAACGG.

[0045] The 16S rDNA and gyrB sequences of the strain were compared by BLAST on NCBI, and the 16S similar strains were used as the tree building group to download the 16S and gyrB gene sequences (see Table 1).

[0046] Table 1 16S and gyrB gene sequence numbers of strains used for strain construction

[0047]

[0048]

[0049] After linear splicing of the 16S sequence and the gyrB sequence, the phylogenetic tree was constructed using MEGA7 software (see Figure 4 ), combined with morphological characteristics analysis, the strain was finally identified as Umezawaeaendophytic LZ-441, and was deposited in the General Microbiology Center of China Culture Collection Administration on October 9, 2024, with the deposit number CGMCCNO: 32155, and the deposit address: No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing.

[0050] Example 2: Field test on the efficacy of Umezawaea endophytic LZ-441 against rice sheath blight and rice blast

[0051] The strain LZ-441 was fermented with 300 mL of ISP2 liquid medium containing 4% XAD-16 macroporous adsorption resin. The resins of each strain were collected, washed, dried, and then completely soaked in methanol for 4 times, each time for 4 hours, one of which was soaked overnight. The methanol soaking liquid was collected, and the methanol soaking liquid was extracted with methanol: water: dichloromethane = 1:1:2, and the dichloromethane phase was collected. The dichloromethane phase was concentrated using a rotary evaporator to obtain a dichloromethane extract, which was the crude extract of the fermentation of strain LZ-441.

[0052] 5 mm activated rice sheath blight fungus Y-36 cake and sterilized toothpicks (1 cm) were taken and cultured together on PDA medium at 28℃ for 3 days. The toothpicks were inoculated into the leaf sheath of the third leaf at the end of rice tillering. Spraying the LZ-441 fermentation liquid 24 hours after inoculation with the toothpicks was used as a protective treatment. Spraying the LZ-441 fermentation liquid 24 hours after inoculation with the toothpicks was used as a therapeutic treatment. Spraying ISP2 medium and 15% Jinggangmycin soluble powder was used as a control. The experiment was carried out in the rice experimental field of Shenyang Agricultural University, with 3 replicates for each treatment and 15 rice holes in each plot. When the disease was stable about 30 days after heading. The incidence of rice sheath blight was investigated.

[0053] Take a 5 mm activated rice blast fungus cake and culture it on TOA medium for 3 days, then culture it under black light for 5-7 days. Add 5 mL of sterilized water to each dish, wash and collect the conidia on the surface of the medium, mix well and adjust the concentration of the spore suspension to 105 cfu / mL. Inject the above spore suspension into the central part of the rice stem at the rice heading stage until the heart leaf exudes the spore suspension. Spray the spore suspension 24 hours after spraying the LZ-441 fermentation liquid as a protective treatment. Spray the LZ-441 fermentation liquid 24 hours after injection of the spore suspension as a therapeutic treatment. Spraying ISP2 medium and 4% kasugamycin aqueous solution was used as a control. The experiment was carried out in the rice experimental field of Shenyang Agricultural University, with 3 replicates for each treatment and 15 rice holes in each plot. When the disease was stable about 30 days after heading, the incidence of rice blast was investigated.

[0054] The survey results were processed according to the following formula:

[0055]

[0056] The test results are shown in Table 2, Table 3, Figure 5 and Figure 6 shown.

[0057] Table 2 Field control effect of strain LZ-441 on rice sheath blight

[0058]

[0059] Table 3 Field control effect of strain LZ-441 on rice blast

[0060]

[0061] From Table 2, Table 3, Figure 5 and Figure 6 It can be seen that the protection treatment of strain LZ-441 has an effect on rice sheath blight (Table 2, Figure 5 ), rice blast control effect (Table 3, Figure 6 ) were 74.28% and 70.38% respectively, both of which had good disease prevention effects.

[0062] The technical solution of the present invention is not limited to the above-mentioned specific embodiments. All technical variations made according to the technical solution of the present invention fall within the protection scope of the present invention.

Claims

1. An endophytic bacterium, characterized in that This strain is an endophytic bacterium Umezawaea endophytic ) LZ-441, deposited in the General Microbiology Center of China Microorganism Culture Collection Administration on October 9, 2024, with the deposit number CGMCC NO: 32155, and the deposit address: No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing.

2. Use of the endophytic bacterium Mezebinia bisporus as claimed in claim 1 in preventing and controlling rice sheath blight and rice blast.

Images