Binding protein specifically binding to mycoplasma pneumoniae P1 protein, and preparation method and application thereof

Abstract

The invention provides a binding protein specifically binding to mycoplasma pneumoniae P1 protein as well as a preparation method and application thereof, and relates to the technical field of biology. The binding protein contains a heavy chain variable region and a light chain variable region, wherein a complementary determining region of the heavy chain variable region comprises amino acid sequences consistent with VH-CDR1, VH-CDR2 and VH-CDR3 of the heavy chain variable region shown as SEQ ID NO.1; the complementarity determining region of the light chain variable region comprises amino acid sequences consistent with VL-CDR1, VL-CDR2 and VL-CDR3 of the light chain variable region as shown in SEQ ID NO.2 or 3. The binding protein has good specific binding capacity with the mycoplasma pneumoniae P1 protein, can be combined with mycoplasma pneumoniae whole bacteria, and can be used for detection of mycoplasma pneumoniae or mycoplasma pneumoniae P1 protein and detection and diagnosis of mycoplasma pneumoniae or mycoplasma pneumoniae infection.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to a binding protein specifically binding to Mycoplasma pneumoniae P1 protein, a preparation method and an application thereof. Background Art

[0002] The following statements merely provide background information related to the present disclosure and do not necessarily constitute prior art.

[0003] Mycoplasma pneumoniae (MPP) is one of the important pathogens of human respiratory tract infection. The lung inflammation caused by its infection is called mycoplasma pneumoniae pneumonia (MPP), which can affect the bronchi, bronchioles, alveoli and lung interstitium. Mycoplasma pneumoniae pneumonia (MPP) is the most common community-acquired pneumonia in children aged 5 years and above in my country. Acquired pneumonia (CAP). The current diagnosis mainly combines clinical manifestations, imaging, and etiology, among which etiology includes isolation culture, serum detection, and nucleic acid detection. Due to the slow growth of Mycoplasma pneumoniae, the culture method cannot meet the needs of rapid clinical diagnosis. Although the nucleic acid detection method improves the sensitivity of the detection, it requires standardized operation and strict quality control, otherwise non-specific reactions are prone to occur. Therefore, the commonly used clinical methods are still mostly serological diagnosis. In the detection of serum antibodies, especially in semi-quantitative or quantitative detection, positive quality control is indispensable, and the source of positive serum is difficult, and the batch-to-batch difference is large. Therefore, it is of great significance to develop a recombinant monoclonal antibody against Mycoplasma pneumoniae with high affinity that is easy to obtain, can be mass-produced, and can be widely used in the direction of clinical diagnosis, which is of great significance for the diagnosis and treatment of Mycoplasma pneumoniae infection.

[0004] In view of this, the present invention is proposed. Summary of the invention

[0005] The object of the present invention is to provide a binding protein that specifically recognizes the P1 protein of Mycoplasma pneumoniae, and it has been verified that it has the same recognition and binding activity as the whole bacteria of Mycoplasma pneumoniae. Based on the binding protein provided by the present invention, the object of the present invention is also to provide its application. Another object of the present invention is to develop a binding protein of the P1 protein of Mycoplasma pneumoniae with good binding activity by a simpler method, which can be used for the identification of Mycoplasma pneumoniae antigens and assist in the diagnosis and detection of Mycoplasma pneumoniae infection.

[0006] In order to solve the above technical problems, the present invention particularly adopts the following technical solutions:

[0007] Mycoplasma pneumoniae P1 protein is a major protein on the surface of Mycoplasma pneumoniae, also known as Mycoplasma pneumoniae P1 protein or MpP1, about 170kD. P1 protein is mainly concentrated at the top of the adhesion organelles and contains multiple antigenic determinants. P1 protein plays an adhesion role in the binding of Mycoplasma pneumoniae to host receptors. It contains multiple antigenic determinants and has strong immunogenicity. When Mycoplasma pneumoniae whole bacteria are used as targets for antibody screening, the screening is difficult due to its complex components. The application of P1 protein as an antigen component in clinical serum antibody detection is also being developed. Therefore, P1 protein is used as a target for the screening of binding proteins.

[0008] The binding protein provided by the present invention can specifically bind to the Mycoplasma pneumoniae P1 protein, and is hereinafter referred to as the MpP1 binding protein. The MpP1 bound by the MpP1 binding protein includes proteins having a natural MpP1 sequence and variants thereof, wherein the variants include but are not limited to at least one subunit that has been mutated, truncated, or fused with other domains, and the variants retain the necessary antigenic epitopes that bind to the binding protein provided by the present invention.

[0009] The technical term "binding protein" herein refers to a protein that binds to a specific antigen, and generally refers to all proteins and protein fragments that contain a complementary determining region (CDR region). The binding protein can be an antibody, and the terms "antibody" and "full-length antibody" include polyclonal antibodies and monoclonal antibodies. In addition, the term "antibody" includes naturally occurring antibodies as well as non-naturally occurring antibodies, including, for example, chimeric, bifunctional and humanized antibodies, and related synthetic isoforms. Non-naturally occurring antibodies are also referred to herein as "recombinant antibodies", and the term "antibody" can be used interchangeably with "immunoglobulin".

[0010] The binding protein may also be an antigen-binding fragment comprising part or all of the antibody CDR, which lacks at least some of the amino acids present in the full-length chain of the antibody but is still able to specifically bind to the antigen. Such fragments are biologically active because they bind to the target antigen and can compete with other antigen-binding molecules (including intact antibodies) for binding to a given epitope. Such fragments are selected from, but not limited to, F(ab')2, Fab', Fab, Fv (composed of VH and VL), ScFv (single-chain antibody, VH and VL are connected by a connecting peptide), dsFv (disulfide stabilized Fv fragments, dsFv), bispecific antibodies, nanobodies, and any one of the minimum recognition units of antibodies. In addition to the above functional fragments, any fragments with increased half-life are also included.

[0011] The term "variable region" or "variable domain" refers to the domain of the amino terminus of the heavy chain or light chain of an antibody that recognizes and binds to an antigen. The composition and arrangement of the amino acids in this segment determine the specificity of the antibody in recognizing an antigen. The heavy chain variable domain may be referred to as "VH". The light chain variable domain may be referred to as "VL". The variable domain contains an antigen binding site. The variable regions of the heavy and light chains are each composed of three complementarity-determining regions (CDRs) (also known as hypervariable regions) connected by four framework regions (FRs). The extent of the framework region and CDR has been precisely defined, for example, in Kabat (see Sequences of Proteins of Immunological Interest, E. Kabat et al.) and Chothia. Any CDR determination method well known in the art, including a combination of methods, can identify the CDRs of the variable domain. The CDRs in each chain are held together closely by FRs to form the variable region. Generally, the variable regions VL / VH of the heavy and light chains can be obtained by arranging and connecting the following numbered CDRs and FRs in the following combinations: FR1-CDR1-FR2-CDR2-FR3-CDR3-FR4.

[0012] The term "constant region" or "constant domain" refers to the constant region of an antibody light chain or the constant region of an antibody heavy chain, either alone or in combination. The heavy chain of an antibody has one variable domain (VH), followed by a number of constant domains or regions, such as one or more of hinge, CH1, CH2, CH3 and CH4, the CH1 domain being adjacent to the VH domain and at the amino terminus of the hinge region of the antibody heavy chain, and not forming part of the Fc region of the antibody; the hinge region includes the portion of the heavy chain molecule that connects the CH1 domain to the CH2 domain; the N-terminus of CH2 is usually the CH3 domain, which usually forms the C-terminal portion of the antibody, and in some antibody types, such as IgM and IgE, the constant region also includes the CH4 domain. The constant region of an antibody can be derived from IgG1, IgG2, IgG3, IgG4, IgA, IgM, IgE and IgD, as well as subclasses and mutant forms of the constant regions thereof.

[0013] The present invention does not limit the method of obtaining the MpP1 binding protein. In some optional embodiments, the corresponding antibody can be obtained by connecting the polynucleotide encoding the binding protein to a vector and expressing it in a cell. The above-mentioned vector can be introduced into eukaryotic cells, especially mammalian cells, to construct a protein capable of expressing the binding protein. In other optional embodiments, the binding protein can also be obtained by recombinant genetic techniques known to those skilled in the art or by peptide synthesis, such as an automatic peptide synthesizer (for example, an automatic peptide synthesizer sold by Applied BioSystems, etc.); the antigen-binding fragment can also be optionally produced by enzymatic cleavage of the antigen-binding molecule (including intact antibodies), such as pepsin or papain cleavage; or chemical cleavage, such as obtaining the above-mentioned antigen-binding fragment by chemical reduction splitting disulfide bonds.

[0014] The terms "specific recognition", "selective binding", "selectively binds" and "specifically binds" or similar expressions refer to the binding of a binding protein to an epitope on a predetermined antigen. Typically, the binding protein is expressed in an amount of less than about 10 -5 M, for example, less than about 10 -5 M, 10 -6 M, 10 -7 M, 10 -8 M, 10 -9 M or 10 -10 M or smaller K D The K value of an antibody can be determined using methods well established in the art. D Other standard assays for evaluating the binding ability of a ligand, such as an antibody, to a target are known in the art and include, for example, ELISA, Western blot, RIA, and flow cytometry analysis.

[0015] The term "signal substance" herein refers to a substance that can provide a detectable signal, which can be directly observed by the naked eye or detected by conventional instruments acceptable in the art; the signal substance can directly provide a signal, such as color (such as colloidal gold, colored microspheres), fluorescence (fluorescent molecules), magnetism, radiation or luminescence; it can also provide a signal indirectly through a subsequent reaction in which the signal substance participates, such as catalyzing a specific substrate reaction to produce any of the above signals.

[0016] The term "polynucleotide" herein refers to a polymer form of nucleotides of any length, including ribonucleotides and / or deoxyribonucleotides. Examples of polynucleotides include, but are not limited to, single-stranded, double-stranded or multi-stranded DNA or RNA, genomic DNA, cDNA, DNA-RNA hybrids, or polymers containing purine and pyrimidine bases or other natural, chemically or biochemically modified, non-natural or derived nucleotide bases. The polynucleotide encodes the above-mentioned binding protein, and the encoding is optionally encoding a sense strand or an antisense strand. The polynucleotide can be naturally occurring, synthetic, recombinant, or any combination thereof. The terms "polynucleotide" and "nucleic acid" are used interchangeably herein.

[0017] The term "vector" as used herein refers to a nucleic acid delivery vehicle into which a polynucleotide can be inserted. When a vector can express a protein encoded by the inserted polynucleotide, the vector is called an expression vector. A vector can be introduced into a cell by transformation, transduction or transfection so that the genetic material elements it carries are expressed in the cell.

[0018] The vector is well known to those skilled in the art, including but not limited to: plasmid, episomal plasmid, minicircle DNA, phagemid, cosmid; artificial chromosome, such as yeast artificial chromosome (YAC), bacterial artificial chromosome (BAC) or P1-derived artificial chromosome (PAC); bacteriophage such as λ phage or M13 phage and animal virus, etc. Animal viruses that can be used as vectors include but are not limited to retrovirus (including lentivirus), adenovirus, adeno-associated virus, herpes virus (such as herpes simplex virus), poxvirus, baculovirus, papillomavirus, papillomavirus. In some embodiments, the vector of the present invention contains regulatory elements commonly used in genetic engineering, such as enhancers, promoters, internal ribosome entry sites (IRES) and other expression control elements (such as transcription termination signals, or polyadenylation signals and poly-U sequences, etc.).

[0019] As used herein, the expressions "cell", "cell line" and "cell culture" are used interchangeably, and all such names include progeny. Progeny may not necessarily be identical to the primary cell due to natural, accidental or deliberate mutations, and may differ from the primary cell in morphology and / or in genomic DNA. "Transformants" and "transformed cells" include primary test cells and cultures derived therefrom. Cells may be prokaryotic or eukaryotic cells, such as but not limited to Escherichia coli, Bacillus or Staphylococcus. Eukaryotic cells include but are not limited to mammalian cells, insect cell lines, plant cells and fungal cells. Mammalian host cells include humans, mice, rats, dogs, monkeys, pigs, goats, cattle, horses and hamster cells, including but not limited to Chinese hamster ovary (CHO) cells, NSO, HeLa cells, baby hamster kidney (BHK) cells, monkey kidney cells (COS), human hepatocellular carcinoma cells (e.g., Hep G2), A549 cells, 3T3 cells and HEK-293 cells.

[0020] As used herein, the term "purified" or "isolated" in connection with a polypeptide or nucleic acid means that the polypeptide or nucleic acid is not in its natural medium or natural form. Thus, the term "isolated" includes a polypeptide or nucleic acid removed from its original environment, such as if it is naturally present, from its natural environment. For example, an isolated polypeptide is generally free of at least some proteins or other cellular components that are normally associated with it or are normally mixed with it or in solution. Isolated polypeptides include naturally produced polypeptides contained in cell lysates, polypeptides in purified or partially purified form, recombinant polypeptides, polypeptides expressed or secreted by cells, and polypeptides in heterologous cells or cultures. In connection with nucleic acids, the term isolated or purified indicates, for example, that the nucleic acid is not in its natural genomic context (e.g., in a vector, as an expression cassette, connected to a promoter, or artificially introduced into a heterologous cell).

[0021] In this document, unless otherwise stated, arbitrary numbering is used to distinguish one entity or behavior from another entity or behavior, and does not necessarily require or imply any actual relationship, order, or importance between these entities or behaviors, such as numbers (I), (II)...(VII).

[0022] As used herein, unless otherwise stated, "optionally", "optional", "optional" or "optional" means that the subsequently described event or circumstance may but need not occur, and that the description includes instances where the event or circumstance occurs or does not occur.

[0023] Herein, the terms "comprise" or "comprising" are intended to include stated elements, integers or steps, but not to exclude any other elements, integers or steps.

[0024] In a first aspect, a binding protein that specifically binds to the Mycoplasma pneumoniae P1 protein (MpP1 binding protein) is provided, comprising a heavy chain variable region and a light chain variable region;

[0025] The heavy chain variable region includes complementary determining regions VH-CDR1, VH-CDR2 and VH-CDR3; the light chain variable region includes complementary determining regions VL-CDR1, VL-CDR2 and VL-CDR3.

[0026] The VH-CDR1 includes an amino acid sequence consistent with the VH-CDR1 of the heavy chain variable region shown in SEQ ID NO.1, the VH-CDR2 includes an amino acid sequence consistent with the VH-CDR2 of the heavy chain variable region shown in SEQ ID NO.1, and the VH-CDR3 includes an amino acid sequence consistent with the VH-CDR3 of the heavy chain variable region shown in SEQ ID NO.1; and the VL-CDR1 includes an amino acid sequence consistent with the VL-CDR1 of the light chain variable region shown in SEQ ID NO.2, the VL-CDR2 includes an amino acid sequence consistent with the VL-CDR2 of the light chain variable region shown in SEQ ID NO.2, and the VL-CDR3 includes an amino acid sequence consistent with the VL-CDR3 of the light chain variable region shown in SEQ ID NO.2;

[0027] Or, the VH-CDR1 includes an amino acid sequence consistent with VH-CDR1 of the heavy chain variable region shown in SEQ ID NO.1, the VH-CDR2 includes an amino acid sequence consistent with VH-CDR2 of the heavy chain variable region shown in SEQ ID NO.1, and the VH-CDR3 includes an amino acid sequence consistent with VH-CDR3 of the heavy chain variable region shown in SEQ ID NO.1; and the VL-CDR1 includes an amino acid sequence consistent with VL-CDR1 of the light chain variable region shown in SEQ ID NO.3, the VL-CDR2 includes an amino acid sequence consistent with VL-CDR2 of the light chain variable region shown in SEQ ID NO.3, and the VL-CDR3 includes an amino acid sequence consistent with VL-CDR3 of the light chain variable region shown in SEQ ID NO.3.

[0028] It is understood that the amino acid sequences of other regions in the variable region shown in SEQ ID NO.1 to 3 except the CDR region are not used to limit the MpP1 binding protein provided by the present invention. For example, if the MpP1 binding protein provided in the present application contains a framework region, it may be different from the framework region in the variable region shown in SEQ ID NO.1 to 3. The CDR region in the variable region shown in SEQ ID NO.1 to 3 can be divided according to an optional method known in the art. Optionally, VH-CDR1, VH-CDR2, VH-CDR3, VL-CDR1, VL-CDR2 and VL-CDR3 of the variable region are defined by any one of the systems of Kabat, Chothia, IMGT, ABM or Contact or a combination of multiple definition systems. Taking the definition methods of Kabat, Chothia, IMGT, ABM or Contact as examples, the amino acid sequences of the CDR region are shown in Tables 1 to 3:

[0029] Table 1 Heavy chain CDR of VH shown in SEQ ID NO.1

[0030]

[0031] Table 2 Light chain CDR of VL shown in SEQ ID NO.2 Table 3 Light chain CDR of VL shown in SEQ ID NO.3

[0032]

[0033] In an optional embodiment, the MpP1 binding protein has VH-CDR1, VH-CDR2 and VH-CDR3 of the heavy chain variable region defined in Table 1, and VL-CDR1, VL-CDR2 and VL-CDR3 of the light chain variable region defined in Table 2. Taking the IMGT definition as an example: the amino acid sequence of the VH-CDR1 is shown in SEQ ID NO.12, the amino acid sequence of the VH-CDR2 is shown in SEQ ID NO.17, and the amino acid sequence of the VH-CDR3 is shown in SEQ ID NO.20; the amino acid sequence of the VL-CDR1 is shown in SEQ ID NO.23, the amino acid sequence of the VL-CDR2 is SGS, and the amino acid sequence of the VL-CDR3 is shown in SEQ ID NO.26.

[0034] In an optional embodiment, the MpP1 binding protein has VH-CDR1, VH-CDR2 and VH-CDR3 of the heavy chain variable region defined in Table 1, and VL-CDR1, VL-CDR2 and VL-CDR3 of the light chain variable region defined in Table 3. Taking the IMGT definition as an example: the amino acid sequence of the VH-CDR1 is shown in SEQ ID NO.12, the amino acid sequence of the VH-CDR2 is shown in SEQ ID NO.17, and the amino acid sequence of the VH-CDR3 is shown in SEQ ID NO.20; the amino acid sequence of the VL-CDR1 is shown in SEQ ID NO.30, the amino acid sequence of the VL-CDR2 is KVS, and the amino acid sequence of the VL-CDR3 is shown in SEQ ID NO.33.

[0035] In an optional embodiment, the species from which the remaining sequence of the antibody minus the CDR region originates include one or more of rabbits, cows, horses, dairy cows, pigs, sheep, goats, rats, mice, dogs, cats, camels, donkeys, deer, minks, chickens, ducks, geese, turkeys, fighting cocks, humans, and their mutants.

[0036] In an optional embodiment, the heavy chain variable region further contains at least one framework region, such as one framework region, two framework regions, three framework regions or four framework regions.

[0037] In an alternative embodiment, the light chain variable region further comprises at least one framework region, such as one framework region, two framework regions, three framework regions or four framework regions.

[0038] In an optional embodiment, the framework region VH-FR1 of the heavy chain variable region includes an amino acid sequence consistent with VH-FR1 of the heavy chain variable region shown in SEQ ID NO.1; and / or, the framework region VH-FR2 includes an amino acid sequence consistent with VH-FR2 of the heavy chain variable region shown in SEQ ID NO.1; and / or, the framework region VH-FR3 includes an amino acid sequence consistent with VH-FR3 of the heavy chain variable region shown in SEQ ID NO.1; and / or, the framework region VH-FR4 includes an amino acid sequence consistent with VH-FR4 of the heavy chain variable region shown in SEQ ID NO.1.

[0039] In an optional embodiment, the framework region VL-FR1 of the light chain variable region includes an amino acid sequence consistent with VL-FR1 of the light chain variable region shown in SEQ ID NO.2 or 3; and / or, the framework region VL-FR2 includes an amino acid sequence consistent with VL-FR2 of the light chain variable region shown in SEQ ID NO.2 or 3; and / or, the framework region VL-FR3 includes an amino acid sequence consistent with VL-FR3 of the light chain variable region shown in SEQ ID NO.2 or 3; and / or, the framework region VL-FR4 includes an amino acid sequence consistent with VL-FR4 of the light chain variable region shown in SEQ ID NO.2 or 3.

[0040] In an optional embodiment, the amino acid sequence of the heavy chain variable region of the MpP1 binding protein is shown as SEQ ID NO.1, and the amino acid sequence of the light chain variable region is shown as SEQ ID NO.2.

[0041] In an optional embodiment, the amino acid sequence of the heavy chain variable region of the MpP1 binding protein is shown as SEQ ID NO.1, and the amino acid sequence of the light chain variable region is shown as SEQ ID NO.3.

[0042] In an alternative embodiment, the MpP1 binding protein is an antibody or antigen binding fragment comprising a constant region.

[0043] In an alternative embodiment, at least a portion of the constant region sequence of the MpP1 binding protein is a human constant region sequence.

[0044] In an optional embodiment, the constant region sequence of the MpP1 binding protein is selected from the sequence of a partial or complete constant region of any one of IgG1, IgG2, IgG3, IgG4, IgA, IgM, IgE or IgD, including their subclasses and mutant forms.

[0045] In an alternative embodiment, the MpP1 binding protein contains a heavy chain constant region.

[0046] In an optional embodiment, the heavy chain constant region sequence of the MpP1 binding protein is selected from a portion or all of the constant region sequence of human IgG1, preferably including at least one of CH1, CH2 and CH3 of the constant region of human IgG1.

[0047] In an optional embodiment, the amino acid sequence of the heavy chain constant region is shown in SEQ ID NO.4.

[0048] In an alternative embodiment, the MpP1 binding protein contains a light chain constant region.

[0049] In an optional embodiment, the light chain constant region sequence is selected from the light chain constant region of a mouse.

[0050] In an optional embodiment, the amino acid sequence of the light chain constant region is as shown in SEQ ID NO.5.

[0051] In an optional embodiment, the MpP1 binding protein is Fab, the amino acid sequence of the heavy chain variable region of the Fab is shown as SEQ ID NO.1, and the amino acid sequence of the light chain variable region is shown as SEQ ID NO.2.

[0052] In an optional embodiment, the MpP1 binding protein is Fab, the amino acid sequence of the heavy chain variable region of the Fab is shown as SEQ ID NO.1, and the amino acid sequence of the light chain variable region is shown as SEQ ID NO.3.

[0053] In an optional embodiment, the MpP1 binding protein is a human-mouse chimeric antibody, the heavy chain amino acid sequence of the MpP1 binding protein is shown in SEQ ID NO.6, and the light chain amino acid sequence is shown in SEQ ID NO.7.

[0054] In the second aspect, a biological material is also provided, including a polynucleotide, a vector or a cell; wherein the polynucleotide encodes the above-mentioned MpP1 binding protein; the vector carries the polynucleotide; the cell carries the polynucleotide, or contains the vector or is capable of expressing the MpP1 binding protein.

[0055] After the polynucleotide encoding the MpP1 binding protein is connected to a vector, the vector can be introduced into eukaryotic cells, especially mammalian cells, to construct a cell line capable of expressing the MpP1 binding protein, and the corresponding protein can be obtained by cell expression.

[0056] In an alternative embodiment, the cells used to express the MpP1 binding protein are 293 cells (human kidney epithelial cell line), preferably 293F cells.

[0057] In an alternative embodiment, the cells used to express the MpP1 binding protein are CHO cells (Chinese Hamster Ovary cells).

[0058] In a third aspect, a method for preparing the MpP1 binding protein of the first aspect is provided, comprising culturing the cells of the second aspect capable of expressing the MpP1 binding protein.

[0059] In an optional embodiment, the preparation method further comprises transforming the polynucleotide encoding the MpP1 binding protein into cells and expressing the polynucleotide, and obtaining the MpP1 binding protein by purification.

[0060] In an optional embodiment, the preparation method further comprises synthesizing a polynucleotide containing the MpP1 binding protein encoding gene as required, and / or preparing a suitable expression vector as required, transforming the expression vector into the desired cells and expressing the expression vector, and obtaining the MpP1 binding protein by purification.

[0061] In an optional embodiment, the cell is obtained by transforming a polynucleotide encoding the MpP1 binding protein as described in the first aspect into the cell, the polynucleotide comprises a heavy chain expression plasmid and a light chain expression plasmid, and the transformation comprises co-transforming the heavy chain expression plasmid and the light chain expression plasmid into the cell.

[0062] In an optional embodiment, the constant region fragment is fused to the C-terminus of the heavy chain variable region to construct a complete heavy chain expression plasmid.

[0063] In an optional embodiment, the constant region fragment includes one or more of CH1, CH2 and CH3, preferably includes CH1, CH2 and CH3.

[0064] In an optional embodiment, the cell is a eukaryotic cell, preferably a mammalian cell.

[0065] In an optional embodiment, the mammalian cells include 293 cells or CHO cells, preferably 293F cells.

[0066] In a fourth aspect, there is also provided a use of the MpP1 binding protein of the first aspect or the biomaterial of the second aspect in any one of the following (I) to (VII):

[0067] (I) Detection of anti-Mycoplasma pneumoniae antibodies for non-diagnostic and treatment purposes;

[0068] (II) Preparation of products for detecting anti-Mycoplasma pneumoniae antibodies;

[0069] (III) Preparation of products for diagnosis and / or auxiliary diagnosis of Mycoplasma pneumoniae infection;

[0070] (IV) Testing for Mycoplasma pneumoniae or Mycoplasma pneumoniae P1 protein for non-diagnostic and therapeutic purposes;

[0071] (V) preparing products for detecting Mycoplasma pneumoniae or Mycoplasma pneumoniae P1 protein;

[0072] (VI) for separating, enriching and / or purifying Mycoplasma pneumoniae or Mycoplasma pneumoniae P1 protein;

[0073] (VII) Preparing a product for isolating, enriching and / or purifying Mycoplasma pneumoniae or Mycoplasma pneumoniae P1 protein.

[0074] In the applications of aspects (I) to (III) above, the MpP1 binding protein can be used as a standard and / or quality control product during detection to provide a reliable reference for the detection results, and can also be used to construct a standard curve.

[0075] In an optional embodiment, the anti-Mycoplasma pneumoniae antibody comprises an anti-Mycoplasma pneumoniae P1 protein antibody.

[0076] In an optional embodiment, the Mycoplasma pneumoniae infection includes Mycoplasma pneumoniae pneumonia.

[0077] The applications of aspects (IV) to (VII) above can utilize the ability of MpP1 binding protein to specifically target and bind to MpP1 to achieve detection, separation, enrichment and / or purification of Mycoplasma pneumoniae or MpP1. In an optional embodiment, when the MpP1 binding protein is an immunoconjugate, for example, connected to a signal substance, the positioning or real-time detection of Mycoplasma pneumoniae or MpP1 can be achieved by detecting the signal substance. In an optional embodiment, the detection, separation, enrichment and / or purification of Mycoplasma pneumoniae or MpP1 is achieved by separating the MpP1 binding protein-MpP1 immune complex.

[0078] In an optional embodiment, in the above aspects (II), (III), (V) or (VII), a person skilled in the art can prepare a corresponding product (such as the above-mentioned immunoconjugate) according to actual use, and select other reagents in the product, including but not limited to one or more of a signal substance, a solid phase carrier, a buffer reagent, a salt, a secondary antibody, a chromogenic substrate, a blocking solution, a washing solution, a solvent, an eluent, a coupling agent, a negative control, a positive control, a standard, a quality control product and a marker.

[0079] In a fifth aspect, a reagent or a kit is also provided, wherein the reagent or the kit comprises the MpP1 binding protein of the first aspect or the biological material of the second aspect.

[0080] In an optional embodiment, the kit is used to detect anti-Mycoplasma pneumoniae antibodies or Mycoplasma pneumoniae infection; the kit includes a standard substance and / or a quality control substance, and the standard substance and / or the quality control substance contain the MpP1 binding protein.

[0081] In an optional embodiment, the kit is used to detect anti-Mycoplasma pneumoniae, and the binding protein is used to capture Mycoplasma pneumoniae or MpP1.

[0082] In an optional embodiment, the kit further comprises a solid phase carrier.

[0083] In an optional embodiment, the MpP1 binding protein in the reagent or kit is coupled to a solid phase carrier; or the MpP1 binding protein in the reagent or kit and the solid phase carrier are packaged separately. By coupling the MpP1 binding protein to a solid phase carrier, it can be used to capture Mycoplasma pneumoniae or MpP1 in a sample to be tested. Alternatively, by coupling the MpP1 binding protein to a solid phase carrier, it can be used to purify Mycoplasma pneumoniae or MpP1.

[0084] In an optional embodiment, the kit further comprises a signal substance.

[0085] In an optional embodiment, the MpP1 binding protein in the reagent or kit is coupled with a signal substance; or the MpP1 binding protein and the signal substance in the reagent or kit are packaged separately. By coupling the MpP1 binding protein with a signal substance, it can be used to locate and detect Mycoplasma pneumoniae or MpP1, or detect MpP1 in a sample by Western blotting.

[0086] The above reagents or kits may also optionally include reagents and / or consumables used in the art for detection reactions or protein purification, which are well known to those skilled in the art, including but not limited to one or more of buffer reagents, salts, secondary antibodies, chromogenic substrates, blocking solutions, washing solutions, solvents, eluents, coupling agents, negative controls, positive controls, standards, quality control products and markers.

[0087] The above reagents or kits can be used in general immunoassay methods acceptable in the art, including but not limited to immunofluorescence staining, flow sorting, immunoblotting, immunohistochemistry, ELISA, immunochromatography or immunomagnetic beads. Those skilled in the art can prepare reagents or other reagents in the kit according to the corresponding detection means, and the present invention is not limited to this.

[0088] The signal substance in any of the above embodiments includes, but is not limited to, one or more of enzymes, luminescent labels, fluorescent microspheres, colored microspheres, latex microspheres, colloidal gold, quantum dots, biotin, streptavidin, radionuclides, radiocontrast agents, paramagnetic ions, metals and photosensitizers.

[0089] Examples of enzymes include, but are not limited to, alkaline phosphatase or horseradish peroxidase. Examples of luminescent labels include, but are not limited to, fluorescent proteins, synthetic small molecules or polymer dyes, and specific examples include, but are not limited to, Alexa350, Alexa 405, Alexa430, Alexa 488, Alexa 555, Alexa 647, AMCA, aminoacridine, BODIPY630 / 650, BODIPY650 / 665, BODIPY-FL, BODIPY-R6G, BODIPY-TMR, BODIPY-TRX, 5-carboxy-4′,5′-dichloro-2′,7′-dimethoxyfluorescein, 5-carboxy-2′,4′,5′,7′-tetrachlorofluorescein, 5-carboxyfluorescein, 5-carboxyrhodamine, 6-carboxyrhodamine, 6-carboxytetramethylrhodamine, Cascade Blue, Cy2, Cy3, Cy5, Cy7, 6-FAM, dansyl chloride, fluorescein, HEX, 6-JOE, NBD (7-nitrobenzo-2-oxa-1,3-oxadiazole), Oregon Green 488, Oregon Green 500, Oregon Green 514, Pacific Blue, phthalic acid, terephthalic acid, isophthalic acid, cresol fast violet, cresol blue violet, brilliant cresol blue, p-aminobenzoic acid, erythrosine, phthalocyanine, azomethine, cyanine, xanthine, succinylfluorescein, rare earth metal cryptates, trisbipyridyl diamine europium, europium cryptates or chelates, diamines, bicyanines, LaJolla blue dye, allophycocyanin, allococyanin One or more of B, phycocyanin C, phycocyanin R, thiamine, phycoerythrin, phycoerythrin R, REG, rhodamine green, rhodamine isothiocyanate, rhodamine red, ROX, TAMRA, TET, TRIT (tetramethylrhodamine isothiol), tetramethylrhodamine and Texas Red. Fluorescent microspheres, colored microspheres and latex microspheres are independently selected from products acceptable in the art, such as commercially available products. Radionuclides include but are not limited to 110 In, 111 In, 177 Lu, 18 F. 52 Fe, 62 Cu, 64 Cu, 67 Cu, 67 Ga, 68 Ga, 86 Y. 90 Y. 89 Zr, 94 mTc, 94 Tc, 99 mTc, 120 I.123 I. 124 I. 125 I. 131 I. 154-158 Gd, 32 P. 11 C. 13 N. 15 O. 186 Re, 188 Re, 51 Mn, 52 mMn, 55 Co. 72 As, 75 Br, 76 Br, 82 mRb and 83 Paramagnetic ions include, but are not limited to, one or more of chromium (III), manganese (II), iron (III), iron (II), cobalt (II), nickel (II), copper (II), neodymium (III), samarium (III), ytterbium (III), gadolinium (III), vanadium (II), terbium (III), dysprosium (III), holmium (III) and erbium (III).

[0090] The solid phase carrier in any of the above embodiments includes but is not limited to microtubes, columns, microparticles, nitrocellulose membranes, chromatography matrices or lateral flow devices; more specifically, for example, but not limited to, enzyme-labeled wells, immunochromatographic test strips or magnetic beads. The chromatography matrix can be any known chromatography matrix acceptable in the art, including but not limited to polystyrene, polysaccharide polymers or silica gel. In an optional embodiment, the chromatography matrix includes gel particles.

[0091] The present invention discloses an MpP1 binding protein, and further prepares a human-mouse chimeric recombinant monoclonal antibody. The present invention has the following beneficial effects:

[0092] (1) The present invention discloses an MpP1 binding protein with a known sequence and a preparation method thereof, which can be recombinantly expressed in vitro, is simple to operate, takes a short time, has controllable production process, has small product batch-to-batch variation, and has good stability, and has good application prospects.

[0093] (2) The prepared MpP1 binding protein of the present invention can effectively bind to Mycoplasma pneumoniae or MpP1, with an optimal EC50 of 2.5 nM and good affinity. It can be used for the detection of natural Mycoplasma pneumoniae or MpP1, including but not limited to the use of chemiluminescence, liquid phase chip, immunofluorescence staining, flow sorting, fluorescent microspheres and other technologies to identify natural Mycoplasma pneumoniae or MpP1; the MpP1 binding protein can also be coupled to a chromatographic matrix for immunoaffinity chromatography purification of Mycoplasma pneumoniae or MpP1 to improve the purity of the antigen.

[0094] (3) The MpP1 binding protein can be used as a quality control product and / or standard for anti-Mycoplasma pneumoniae antibody (such as anti-MpP1 antibody detection) detection products; when the MpP1 binding protein is used as a quality control product in the test kit, it can alleviate the problems of cumbersome immune polyclonal antibody operation and low subsequent coupling efficiency; it can reduce production costs, stabilize product quality, and significantly improve reaction values; on the other hand, compared with the direct use of human serum, it can also avoid the problem of difficult sample sources and high costs. BRIEF DESCRIPTION OF THE DRAWINGS

[0095] In order to more clearly illustrate the specific implementation methods of the present invention or the technical solutions in the prior art, the drawings required for use in the specific implementation methods or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are some implementation methods of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0096] Figure 1 The nucleic acid electrophoresis diagram of the heavy chain (Fd) and light chain (L) used to construct the library in Example 1;

[0097] Figure 2 This is the nucleic acid electrophoresis diagram of the Fab gene fragment used to construct the library in Example 1;

[0098] Figure 3 This is the SDS-PAGE protein electrophoresis diagram of the anti-Mp P1 recombinant Fab monoclonal antibody in Example 2, the heavy chain and light chain are about 25 kDa;

[0099] Figure 4 This is the analysis of the binding between the recombinant Fab monoclonal antibody and the Mp P1 protein determined by ELISA in Example 3, Ab01-MpP1 is the binding activity of the recombinant Fab monoclonal antibody to the Mp P1 antigen, and Ab01-BSA is the non-specific binding activity of the recombinant Fab monoclonal antibody to the control protein BSA;

[0100] Figure 5 This is an analysis of the binding between the recombinant Fab monoclonal antibody and the Mp P1 protein after the ELISA assay optimization in Example 4, Ab02-Mp P1 is the binding activity of the recombinant monoclonal antibody to the Mp P1 antigen, and Ab02-BSA is the non-specific binding activity of the recombinant monoclonal antibody to the control protein BSA;

[0101] Figure 6 The SDS-PAGE protein electrophoresis diagram of the anti-Mp P1 recombinant IgG monoclonal antibody in Example 5, Mp P1-Ab-non-reduced is the non-reduced SDS-PAGE electrophoresis result: the size is about 150 kDa; Mp P1-Ab-reduced is the reduced SDS-PAGE electrophoresis result: the heavy chain and light chain are 50 kDa and 25 kDa respectively;

[0102] Figure 7 This is an analysis of the binding of the recombinant IgG monoclonal antibody to the Mp P1 protein determined by ELISA in Example 6. Ab03-MpP1 is the binding activity of the recombinant monoclonal antibody to the Mp P1 antigen, and Ab03-BSA is the non-specific binding activity of the recombinant monoclonal antibody to the control protein BSA. DETAILED DESCRIPTION

[0103] The technical solution of the present invention will be clearly and completely described below in conjunction with the embodiments. Obviously, the described embodiments are part of the embodiments of the present invention, rather than all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0104] Example 1 Screening of Mp P1 binding proteins

[0105] (I) Preparation of phage display library

[0106] 1) After immunization with Mp P1 antigen (purchased from Maiyue Biotechnology Co., Ltd., catalog number MR220102), spleens were obtained from mice, and lymphocytes were separated using mouse lymphocyte separation medium.

[0107] 2) Extract RNA: Take 1×10 6 The total RNA of lymphocytes was extracted using RNAsimple total RNA extraction kit.

[0108] 3) Reverse transcription: The extracted total RNA is reverse transcribed to synthesize cDNA.

[0109] 4) Antibody gene fragment amplification: Using cDNA as a template, specific amplification primers are used to amplify the antibody's κ, λ light chains and the VH-CH1 (Fd) region of the heavy chain.

[0110] 20 μL reaction system: 1 μL cDNA, 0.8 μL Prime F, 0.8 μL Prime R, 10 μL 2× phanta max master mix, 7.4 μL Nuclease-Free Water;

[0111] Reaction program: melting at 95°C for 30 s, annealing at 55°C for 30 s, extension at 72°C for 45 s, for 30 cycles.

[0112] After the reaction, loading buffer was added to the system and 1% agarose gel electrophoresis was performed. The electrophoresis pattern was as follows: Figure 1 As shown, the target band is about 750 bp.

[0113] The target bands were cut out and the antibody heavy chain (Fd) gene fragment and light chain gene fragment (L) were recovered separately.

[0114] 5) The antibody light chain and heavy chain gene fragments are combined into a complete Fab gene fragment through overlapping PCR.

[0115] 25μL reaction system and procedure: 30ng light chain, 4.3ng linker, 30ng heavy chain, 0.5μL sfiⅠF (upstream primer), 0.5μL sfiⅠR (downstream primer), 12.5μL 2×phantamax master mix, and Nuclease-Free Water to make up the total system to 25μL.

[0116] Reaction procedure: melting at 95℃ for 30s, annealing at 55℃ for 30sec, extension at 72℃ for 90s, 30 cycles. After the reaction, loading buffer was added to the system and identified by 1% agarose gel electrophoresis. The electrophoresis pattern is shown below. Figure 2 As shown, the target band is about 1500 bp. The target band is cut out and the antibody Fab fragment is recovered.

[0117] Upstream primer sfiIF: 5'>GAGCAGGAGCATAGGAGGATCGGGCGGCGGCC<3' (SEQ ID NO. 35);

[0118] Downstream primer sfiI R: 5'>CCATGGCAATGGTGATTCTGCTGCGCGGCCTGGCC<3' (SEQ ID NO. 36).

[0119] 6) Plasmid construction: The antibody Fab fragment and pComb3xSS plasmid were digested with sfiⅠ enzyme, respectively, and the digested fragments were mixed at a molar ratio of 3:1 to plasmid. T4 DNA ligase was added and ligated at 16°C overnight.

[0120] 7) Library construction: Recover the ligation product in the previous step. Take 1.5 μl of the recovered product, add TG1 competent medium, mix well and transfer to the electroporation cup for electroporation, parameter selection: Bac-Ec1. After electroporation, activate and culture at 37°C for 1 hour, transfer the activated bacterial solution to 200 mL 2×YT medium, add 1 / 1000 ampicillin antibiotics and a final concentration of 2% glucose solution, and culture at 37°C and 220rpm until OD600 = 0.6. Add 20 times the number of bacteria of the helper phage M13K07. After mixing, place it in a 37°C shaker for static infection for 45 minutes. Centrifuge for 15 minutes to collect the bacteria, resuspend the precipitate with 200 mL of new 2×YT+Amp+Kana medium, and shake the bacteria at 30°C and 220rpm for 14 hours for phage amplification. Centrifuge and collect the supernatant the next day, add 1 / 4 volume of 20% PEG6000 to precipitate the phage, and resuspend it with PBS to obtain a phage display library.

[0121] (II) Selection of anti-Mp P1 antibodies using phage display library

[0122] 1) The biotin-coupled Mp P1 protein was used as the target antigen. After incubation with SA magnetic beads for 1 h, 1×10 12 The obtained phages were incubated for 1 hour, and the specific phages were captured by the antigen and washed with PBST (PBS+0.05% Tween-20).

[0123] 2) Add the antigen-bound magnetic beads to the TG1 bacterial solution, incubate at 37°C for 45 minutes, and then activate and culture at 37°C, 220 rpm for 1 hour. Take an appropriate amount of the bacterial solution after static infection and apply gradient dilutions to the ampicillin plate. Add glucose (final concentration of 2%) and 1 / 1000 ampicillin antibiotic to the remaining bacterial solution and shake at 37°C, 220 rpm for 3 hours.

[0124] 3) Add 10 μL M13K07 to the bacterial solution and incubate at 37°C for 45 min for infection.

[0125] 4) Centrifuge at 6000×g for 10 min, resuspend in 10 mL 2×YT+Amp+kana medium, and shake at 30°C, 220 rpm for 14 h to amplify phages. Centrifuge the next day, collect the supernatant, add 1 / 4 volume of 20% PEG6000 to precipitate the phages, and resuspend in PBS to obtain the phages for the first round of screening.

[0126] 5) Using the phages obtained in the first round of screening, repeat steps 1 to 4 to perform the second round of screening.

[0127] 6) Identification of single clones: Single clones were selected from the second round of screening on the coated plates and placed in 96-well deep-well plates, and phages were amplified overnight by shaking.

[0128] Coating: ELISA plate was coated with Mp P1 antigen and BSA was used as control protein at 4℃ overnight.

[0129] Blocking: The next day, discard the coating solution, wash the plate with PBST, pat dry, add 3% milk, and block at 37°C for 2 h.

[0130] Primary antibody preparation: Centrifuge the 96-well deep-well plate, take the supernatant and dilute it in milk with a final concentration of 1%, mix well and use as the primary antibody.

[0131] Primary antibody incubation: discard the blocking solution, wash the plate with PBST, pat dry, add primary antibody, and incubate at 37°C for 2 h.

[0132] Secondary antibody incubation: discard the primary antibody, wash the plate with PBST, pat dry, add 1:5000 diluted Anti-M13 Antibody (HRP) secondary antibody, and incubate at 37℃ for 1h. Discard the secondary antibody, wash the plate with PBST, pat dry, add the color substrate for color development, add the stop solution after 15min to stop the reaction, and read the results with an ELISA reader.

[0133] 7) Select clones with high read values ​​(OD value of Mp P1 antigen well>1) and low non-specific binding (OD value of BSA control protein well<0.5) for sequencing.

[0134] Light chain sequencing primer: Bomp: 5'>GTGTGGAATTGTGAGCGG<3' (SEQ ID NO. 37);

[0135] Heavy chain sequencing primer: PELB: 5'>ACCTATTGCCTACGGCAGCCG<3' (SEQ ID NO. 38).

[0136] A total of 20 monoclones were selected for sequencing, and the sequencing results were analyzed to obtain an MpP1 binding protein sequence including an antigen binding domain.

[0137] The heavy chain variable region sequence is shown in SEQ ID NO.1, and the light chain variable region sequence is shown in SEQ ID NO.2. Further analysis revealed that the antigen binding domain comprises the following light chain and heavy chain CDRs:

[0138] Table 1 Heavy chain CDR of VH shown in SEQ ID NO.1

[0139]

[0140]

[0141] Table 2 Light chain CDR of VL shown in SEQ ID NO.2

[0142]

[0143] Example 2 Prokaryotic expression and purification of anti-Mp P1 recombinant monoclonal antibody

[0144] 1) According to the sequencing results, single clones with corresponding sequences were selected from the deep-well plate and transferred into 2 ml 2×YT+Amp medium, shaken for 12 hours, and plasmids were extracted;

[0145] 2) Transform the plasmid into HB2151 competent cells, select a single spot from the overnight cultured Amp-resistant plate and inoculate it into 2 ml 2×YT+Amp medium, shake at 37°C for 3-4 hours, transfer to 200 ml 2×YT+Amp medium, shake at 37°C for 3-4 hours, add IPTG to induce expression overnight;

[0146] 3) Collect the bacteria, resuspend them in 20 ml PBS, add 200 μl PB to lyse them, incubate at room temperature with shaking for 1 hour, and centrifuge to collect the supernatant.

[0147] 4) Protein affinity chromatography purification: Ni filler was added to the supernatant to purify the Fab monoclonal antibody. The eluate was replaced with PBS buffer using an ultrafiltration centrifuge tube and concentrated. The protein concentration was determined and 3 μg was taken for electrophoresis identification. Figure 3 .

[0148] Example 3 ELISA determination of the binding activity of Fab monoclonal antibody to Mp P1 antigen

[0149] 1) Mp P1 protein (2 μg / mL) was coated on an ELISA plate, and BSA was also coated as a non-specific binding control, and incubated at 4°C overnight.

[0150] 2) Discard the coating solution, wash the plate with PBST, pat dry, add 3% milk, and block at 37°C for 2 h.

[0151] 3) Discard the blocking solution, wash the plate with PBST, pat dry, add 1000 nM of the antibody in a 2-fold serial dilution, and incubate at 37°C for 1.5 h.

[0152] 4) Discard the primary antibody, wash the plate with PBST, pat dry, add horseradish peroxidase (HRP)-labeled anti-his secondary antibody, and incubate at 37°C for 1 h.

[0153] 5) Discard the secondary antibody, wash the plate with PBST, pat dry, add the color substrate for color development, add the stop solution after 15 minutes to stop the reaction, and measure the OD value with an enzyme reader.

[0154] The OD value is taken as the ordinate and the logarithm of the antibody molar concentration is taken as the abscissa to perform nonlinear fitting. Figure 4 , the EC50 value of the antibody was approximately 53nM.

[0155] Example 4 Antibody Optimization

[0156] 1) Replace the light chain of the original clone: ​​Take the plasmid in Example 2, add Sac1 and Not1 for double enzyme digestion, and after the vector is recovered, connect it with the light chain mix (derived from multiple immunized mice) that has also been double-digested. According to the steps of Example 1, the connection product is recovered and transferred to the competent state to construct a phage display library with light chain replacement.

[0157] 2) Perform panning according to the steps of Example 1 (ii); this screening is aimed at selecting antibodies with high binding activity, and the amount of antigen used in the screening is halved.

[0158] 3) According to the monoclonal results, positive clones with higher reads than the original clones were selected for sequencing analysis to obtain an antibody sequence whose light chain was different from the original clone. The light chain variable region sequence is shown in SEQ ID NO.3; further analysis revealed that the antigen binding domain contained the following light chain CDRs:

[0159] Table 3 Light chain CDR of VL shown in SEQ ID NO.3

[0160]

[0161] 4) Determine the binding activity of the optimized clones according to the steps of Examples 2 and 3. The results are as follows: Figure 5 The EC50 value of the optimized Fab monoclonal antibody was approximately 8nM, which was approximately 6.6 times higher than that of the original clone.

[0162] Example 5 Expression and purification of anti-Mp P1 recombinant IgG monoclonal antibody

[0163] Gene synthesis is performed after obtaining the optimized antibody Fab region sequence based on sequencing:

[0164] The vector selected was the PTT5 plasmid, with EcoRI+BamHI as the cloning site, and the light chain gene fragment was inserted. The light chain constant region sequence is shown in SEQ ID NO.5, which is a mouse sequence; the light chain complete sequence is shown in SEQ ID NO.7.

[0165] The CH1 of the heavy chain was replaced with the CH1 of human IgG1, and the Fc of human IgG1 was fused at the C-terminus. The complete heavy chain fragment was inserted into the pTT5 plasmid using EcoRI+BamHI as cloning sites. The heavy chain constant region sequence is shown in SEQ ID NO.4, which is a human sequence, and the complete heavy chain sequence is shown in SEQ ID NO.6.

[0166] The gene was expressed using the mammalian cell 293F expression system.

[0167] 1) Plasmid extraction: The gene-synthesized plasmids were transformed into TOP10 competent cells, activated for 1 hour, transferred to LB medium, cultured at 37°C overnight, and extracted using an endotoxin-free plasmid extraction kit the next day to obtain the corresponding heavy chain plasmid and light chain plasmid.

[0168] 2) One day before transfection, 293F cells were inoculated into a suspension cell culture flask and the cell density was controlled to be 1×10 6 Pieces / mL.

[0169] 3) The next day, dilute 40 μg of heavy chain plasmid and 80 μg of light chain plasmid in 6 mL of transfection buffer and mix gently, add 480 μL of PEI and mix gently, incubate at room temperature for 20 minutes, add dropwise to the cells, place the cells in an incubator, and culture them in suspension at 98 rpm, 37°C, and 5% CO2.

[0170] 4) After 6 days, the culture supernatant was collected, IgG was purified using rProteinA filler, eluted with 0.1M Glycine (pH 3.0), and neutralized by adding 1M Tris (PH 8.0). After elution, the supernatant was replaced with PBS buffer using an ultrafiltration centrifuge tube and concentrated, the protein concentration was determined, and its purity was verified by SDS-PAGE. Figure 6 .

[0171] Example 6 ELISA determination of the binding activity of the recombinant monoclonal antibody to the Mp P1 antigen

[0172] The binding activity of the optimized recombinant antibody obtained by screening to Mp P1 protein was further tested:

[0173] 1) Mp P1 protein (2 μg / mL) was coated on an ELISA plate, and BSA was also coated as a non-specific binding control, and incubated at 4°C overnight.

[0174] 2) Discard the coating solution, wash the plate with PBST, pat dry, add 3% milk, and block at 37°C for 2 h.

[0175] 3) The blocking solution was discarded, the plate was washed with PBST, patted dry, and the antibody (prepared in Example 5) with a starting point of 1000 nM and a 5-fold serial dilution was added, and incubated at 37° C. for 1.5 h.

[0176] 4) Discard the primary antibody, wash the plate with PBST, pat dry, add horseradish peroxidase (HRP)-labeled mouse anti-human IgG secondary antibody, and incubate at 37°C for 1 h.

[0177] 5) Discard the secondary antibody, wash the plate with PBST, pat dry, add the color substrate for color development, add the stop solution after 15 minutes to stop the reaction, and measure the OD value with an enzyme reader.

[0178] 6) Take the OD value as the ordinate and the logarithm of the antibody molar concentration as the abscissa to perform nonlinear fitting. Figure 7 , the EC50 value of the antibody in Example 5 is approximately 2.5 nM.

[0179] Example 7 Chemiluminescence assay for detection performance of recombinant monoclonal antibodies

[0180] Here’s how:

[0181] 1) The initial concentration of the antibody was 1 mg / ml. The antibody was diluted 15 times, and then diluted in a 2-fold gradient.

[0182] 2) First incubation: The antibody to be tested (prepared in Example 5) was incubated with magnetic beads coated with Mp natural antigen (purchased from Saitukang Biotechnology, catalog number CTA-4010) at 37° C. for 15 min, and unbound substances were washed to remove.

[0183] 3) Second incubation: Add alkaline phosphatase-labeled mouse anti-human IgG antibody, incubate at 37°C for 15 min, and then wash to remove unbound substances.

[0184] 4) Interpretation of results: The instrument detects the luminescence intensity of the corresponding complex.

[0185] Table 4 Chemiluminescence determination of the reactivity of recombinant monoclonal antibodies to Mp whole bacterial antigens

[0186] Dilution multiple RLU COI 15 92,850 3.10 30 93,871 3.13 60 87,569 2.92 120 80,665 2.69 240 66,716 2.22 480 47,668 1.59 960 29,264 0.98 1920 16,864 0.56 3840 9,307 0.31 7680 4,691 0.16

[0187] The test results are shown in Table 4. The tested antibodies have good reactivity with the natural antigen of Mp. The critical value of the reference positive serum is RLU=30000. When the recombinant antibody is diluted to 240 times, COI>2, and the titer is qualified, so it can be used as a raw material for calibration and quality control products.

[0188] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or replace some or all of the technical features therein with equivalents. However, these modifications or replacements do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. A binding protein that specifically binds to Mycoplasma pneumoniae P1 protein, characterized in that: comprising a heavy chain variable region and a light chain variable region; The heavy chain variable region includes complementary determining regions VH-CDR1, VH-CDR2 and VH-CDR3; the light chain variable region includes complementary determining regions VL-CDR1, VL-CDR2 and VL-CDR3; The VH-CDR1, VH-CDR2 and VH-CDR3 include amino acid sequences consistent with VH-CDR1, VH-CDR2 and VH-CDR3 of the heavy chain variable region shown in SEQ ID NO.1; The VL-CDR1, VL-CDR2 and VL-CDR3 include amino acid sequences consistent with VL-CDR1, VL-CDR2 and VL-CDR3 of the light chain variable region shown in SEQ ID NO.2; or, include amino acid sequences consistent with VL-CDR1, VL-CDR2 and VL-CDR3 of the light chain variable region shown in SEQ ID NO.

3.

2. The binding protein according to claim 1, characterized in that The VH-CDR1, VH-CDR2, VH-CDR3, VL-CDR1, VL-CDR2 and VL-CDR3 of the binding protein are defined by any one system or a combination of multiple definition systems of Kabat, Chothia, IMGT, ABM or Contact; Optionally, according to the IMGT definition: the amino acid sequence of the VH-CDR1 is shown in SEQ ID NO.12, the amino acid sequence of the VH-CDR2 is shown in SEQ ID NO.17, and the amino acid sequence of the VH-CDR3 is shown in SEQ ID NO.20; Optionally, the amino acid sequence of the VL-CDR1 is as shown in SEQ ID NO.23, the amino acid sequence of the VL-CDR2 is SGS, and the amino acid sequence of the VL-CDR3 is as shown in SEQ ID NO.26; Optionally, the amino acid sequence of the VL-CDR1 is as shown in SEQ ID NO.30, the amino acid sequence of the VL-CDR2 is KVS, and the amino acid sequence of the VL-CDR3 is as shown in SEQ ID NO.

33.

3. The binding protein according to claim 1, characterized in that The remaining sequence of the binding protein except the CDR region is derived from one or more species of rabbit, cattle, horse, dairy cow, pig, sheep, goat, rat, mouse, dog, cat, camel, donkey, deer, mink, chicken, duck, goose, turkey, fighting cock, human and their mutants; Optionally, the heavy chain variable region further comprises a framework region, and / or the light chain variable region further comprises a framework region; Optionally, at least one framework region of the heavy chain variable region comprises an amino acid sequence consistent with the framework region of the heavy chain variable region shown in SEQ ID NO.1; Optionally, at least one framework region of the light chain variable region comprises an amino acid sequence consistent with the framework region of the light chain variable region shown in SEQ ID NO.2; Optionally, at least one framework region of the light chain variable region comprises an amino acid sequence consistent with the framework region of the light chain variable region shown in SEQ ID NO.3; Optionally, the amino acid sequence of the heavy chain variable region of the binding protein is as shown in SEQ ID NO.1, and the amino acid sequence of the light chain variable region is as shown in SEQ ID NO.2; or, the amino acid sequence of the heavy chain variable region of the binding protein is as shown in SEQ ID NO.1, and the amino acid sequence of the light chain variable region is as shown in SEQ ID NO.

3.

4. The binding protein according to any one of claims 1 to 3, characterized in that The binding protein is a complete antibody, F(ab')2, Fab', Fab, Fv, scFv, dsFv, bispecific antibody or the minimum recognition unit of an antibody; Optionally, the binding protein is Fab, the amino acid sequence of the heavy chain variable region of the Fab is shown as SEQ ID NO.1, and the amino acid sequence of the light chain variable region is shown as SEQ ID NO.

2. Optionally, the binding protein is Fab, the amino acid sequence of the heavy chain variable region of the Fab is shown as SEQ ID NO.1, and the amino acid sequence of the light chain variable region is shown as SEQ ID NO.

3.

5. The binding protein according to any one of claims 1 to 3, characterized in that It also contains a constant region; Optionally, at least a portion of the constant region sequence is a human constant region sequence; Optionally, the constant region sequence is selected from a sequence of a partial or complete constant region of any one of IgG1, IgG2, IgG3, IgG4, IgA, IgM, IgE or IgD; Optionally, the binding protein contains a heavy chain constant region, and the heavy chain constant region sequence is selected from a human heavy chain constant region; Optionally, the amino acid sequence of the heavy chain constant region is shown in SEQ ID NO.4; Optionally, the binding protein contains a light chain constant region; Optionally, the light chain constant region sequence is selected from a mouse light chain constant region, and the amino acid sequence of the light chain constant region is shown in SEQ ID NO.5; Optionally, the binding protein is a complete antibody, the heavy chain amino acid sequence is shown in SEQ ID NO.6, and the light chain amino acid sequence is shown in SEQ ID NO.

7.

6. Biomaterial, characterized in that including a polynucleotide, a vector or a cell; The polynucleotide encodes the binding protein according to any one of claims 1 to 5; The vector carries the polynucleotide; The cell carries the polynucleotide, or contains the vector, or is capable of expressing the binding protein according to any one of claims 1 to 5.

7. The method for preparing the binding protein according to any one of claims 1 to 5, characterized in that: Comprising culturing the cell as claimed in claim 6; Optionally, the cell is obtained by transforming a polynucleotide encoding the binding protein according to any one of claims 1 to 5 into a cell, wherein the polynucleotide comprises a heavy chain expression plasmid and a light chain expression plasmid, and the transformation comprises co-transforming the heavy chain expression plasmid and the light chain expression plasmid into the cell; Optionally, the cell is a eukaryotic cell, preferably a mammalian cell; Optionally, the mammalian cells include 293 cells or CHO cells, preferably 293F cells.

8. Use of the binding protein according to any one of claims 1 to 5, or the biomaterial according to claim 6 in any one of the following (I) to (VII): (I) Detection of anti-Mycoplasma pneumoniae antibodies for non-diagnostic and treatment purposes; (II) Preparation of products for detecting anti-Mycoplasma pneumoniae antibodies; (III) Preparation of products for diagnosis and / or auxiliary diagnosis of Mycoplasma pneumoniae infection; (IV) Testing for Mycoplasma pneumoniae or Mycoplasma pneumoniae P1 protein for non-diagnostic and therapeutic purposes; (V) preparing products for detecting Mycoplasma pneumoniae or Mycoplasma pneumoniae P1 protein; (VI) for separating, enriching and / or purifying Mycoplasma pneumoniae or Mycoplasma pneumoniae P1 protein; (VII) preparing a product for isolating, enriching and / or purifying Mycoplasma pneumoniae or Mycoplasma pneumoniae P1 protein; Optionally, the anti-Mycoplasma pneumoniae antibody comprises an anti-Mycoplasma pneumoniae P1 protein antibody; Optionally, the Mycoplasma pneumoniae infection includes Mycoplasma pneumoniae pneumonia; Optionally, in any one of (I) to (III), the binding protein is used as a standard or quality control product.

9. A reagent or a kit, characterized in that The reagent or kit comprises the binding protein according to any one of claims 1 to 5, or the biomaterial according to claim 6.

10. The reagent or kit according to claim 9, characterized in that The kit is used for detecting anti-Mycoplasma pneumoniae antibodies or Mycoplasma pneumoniae infection; the kit comprises a standard substance and / or a quality control substance, and the standard substance and / or the quality control substance contain the binding protein; Or, the kit is used to detect anti-Mycoplasma pneumoniae, and the binding protein is used to capture Mycoplasma pneumoniae or Mycoplasma pneumoniae P1 protein; Optionally, the binding protein is coupled to a signaling substance.

Images