Probe and primer for detecting expression quantity of sex determining gene amhr2 of silurus meridionalis and application of probe and primer

Abstract

The invention discloses a probe and a primer for detecting the expression quantity of sex determining gene amhr2 of silurus meridionalis, the probe comprises an amhr2T probe and an amhr2G probe, and the primer comprises an upstream primer F1 and a downstream primer R1, the invention also discloses a kit comprising the probe and the primer, a method for detecting the expression quantity of the sex determining gene amhr2 of the catfish by using the probe and the primer, application of the probe and the primer in preparation of the kit for detecting the expression quantity of the sex determining gene amhr2 of the catfish, and the probe and the primer. The kit or the method is applied to the detection of the expression quantity of the sex determining gene amhr2 of the silurus meridionalis. The probe and the primer provided by the invention can accurately detect the expression quantity of the ovary or testis amhr2 gene in silurus asotus, and are low in cost, high in efficiency and high in accuracy.

Description

Technical Field

[0001] The invention belongs to the technical field of gene detection of catfish, and particularly relates to a probe and a primer for detecting the expression amount of the sex determination gene amhr2 of catfish and an application thereof. Background Art

[0002] Clarias fuscus, also known as catfish, belongs to the order Siluriformes, family Clarias, and genus Clarias. This species has tender meat, delicious taste, and high economic value. It is a freshwater fish that is farmed on a large scale in southern my country. Clarias fuscus has special auxiliary respiratory organs that can adapt to extremely low dissolved oxygen environments. It is a wide-temperature Clarias fish with strong disease resistance, simple breeding, short cycle, high yield, low cost, and easy transportation. It has become a freshwater aquaculture species with good development prospects.

[0003] The bearded catfish belongs to the male heterogametic XX / XY sex determination type with obvious sexual dimorphism. Under the same breeding conditions, the growth rate of male fish is much higher than that of female fish of the same age. When the farmed bearded catfish reaches the market specifications, the female bearded catfish is in the stage of gonad development, with an enlarged abdomen and a gonad index much higher than that of males, resulting in the price of female fish being about 4 yuan / kg lower than that of male fish of the same specifications. Therefore, researching and breeding all-male bearded catfish varieties can greatly save breeding costs and improve the quality and economic benefits of commercial fish. Research on the sex determination mechanism of bearded catfish is a key way to promote its single-sex breeding. In the bearded catfish, its sex determination gene was found to be the amhr2 gene. A single nucleotide mutation (T / G) in the kinase domain of this gene leads to a single amino acid change (Leu / Arg), which appears as a heterozygous type (amhr2) in XY male fish. T / amhr2 G ), in XX female fish it is homozygous (amhr2 G / amhr2 G ), amhr2 T Determines male differentiation. The sex-determining gene amhr2 plays a key role in sex differentiation and sex phenotype maintenance. Gene expression analysis is an important method to reveal its genetic sex determination mechanism. During gonadal development, the expression level of amhr2 can reflect its role in maintaining sex phenotype. In addition, in the study of gene editing and sex reversal, changes in amhr2 expression can help reveal potential regulatory mechanisms. However, amhr2 T and amhr2 GThe alleles only differ by a single base (T / G), and traditional fluorescence quantitative PCR is difficult to accurately distinguish and quantitatively detect the expression of the two alleles. Although transcriptome sequencing can achieve accurate expression measurement, its high cost limits its application in large-scale sample analysis. Therefore, it is urgent to establish a rapid, economical and accurate detection method for quantitative analysis of the expression of the sex-determining gene amhr2 in catfish, providing basic support for further research on its sex determination mechanism.

[0004] In previous studies, the inventors of this application conducted research on primer design, detection methods and applications of sex-specific SNP molecular markers for catfish from different sources (application number 202410716189.8), which achieved qualitative detection of the sex of catfish. However, this method can only distinguish sex and cannot meet the needs of quantitative analysis. Therefore, the present invention focuses on the research on probes and primers for detecting the expression of the sex-determining gene amhr2 in catfish and their applications. Summary of the invention

[0005] The purpose of the present invention is to provide a probe, a primer and a kit for detecting the expression level of the sex determination gene amhr2 of catfish.

[0006] The present invention also aims to provide a method for detecting the expression level of the sex determination gene amhr2 of catfish.

[0007] The last object of the present invention is to provide the use of the above-mentioned probe and primer in preparing a kit for detecting the expression level of the sex-determining gene amhr2 of the bearded catfish, and the use of the above-mentioned probe and primer, the above-mentioned kit or the above-mentioned method in detecting the expression level of the sex-determining gene amhr2 of the bearded catfish.

[0008] The first object of the present invention can be achieved by the following technical scheme: a probe and primers for detecting the expression of the sex determination gene amhr2 of catfish, the probe comprising amhr2 T Probe and amhr2 G Probe, the amhr2 T The sequence of the probe is shown in SEQ ID NO.1, and the amhr2 G The sequence of the probe is shown in SEQ ID NO.2, the primers include an upstream primer F1 and a downstream primer R1, the sequence of the upstream primer F1 is shown in SEQ ID NO.3, and the sequence of the downstream primer R1 is shown in SEQ ID NO.4.

[0009] The sex determination gene amhr2 of the catfish of the present invention has a base sequence as shown in SEQ ID NO: 5. The SNP mutation site associated with sex in the kinase domain of the gene is located at position 86 of the sequence shown in SEQ ID NO: 5, resulting in a change in a single amino acid Leu / Arg, and the XY male fish exhibits a heterozygous amhr2 T / amhr2 G In XX female fish, the homozygous amhr2 G / amhr2 G ,amhr2 T Determines male differentiation.

[0010] The invention also provides a kit for detecting the expression amount of the sex determination gene amhr2 of the catfish, comprising the probe and primers.

[0011] Furthermore, the kit also includes Probe qPCR PreMix and ddH 2 O.

[0012] The above second object of the present invention can be achieved by the following technical scheme: A method for detecting the expression level of the sex determination gene amhr2 of catfish, comprising the following steps:

[0013] (1) Using the gonad cDNA of the tested catfish sample as a template;

[0014] (2) With the amhr2 T Probe and primers or the amhr2 G The probes and primers were used for qRT-PCR amplification;

[0015] The amhr2 T The probe and primers were used to detect the expression of amhr2 gene in the testis samples of Silurus catfish;

[0016] The amhr2 G The probe and primers were used to detect the expression level of amhr2 gene in the testis and ovary samples of Silurus catfish.

[0017] In the above method for detecting the expression level of the sex determination gene amhr2 of catfish:

[0018] Preferably, in step (2), amhr2 T The probe and primers showed specific amplification in the testis sample of the catfish, and the linear equation of the copy number (x) and the Ct value (y) was y=-3.1101×log(x)+40.56; amhr2 in step (2) GThe probe and primers were amplified in the testis and ovary samples of Silurus fuliginosa. The linear equation of copy number (x) and Ct value (y) was y=-3.3334×㏒(x)+42.75.

[0019] As a preferred embodiment of the present invention, in step (2), amhr2 T The probe and primers showed specific amplification in the testis samples of 50-day-old, 120-day-old and 12-month-old catfish, with average Ct values ​​of 23.27, 23.90 and 24.63, respectively. The linear equation of the copy number (x) and the Ct value (y) was y = -3.1101 × log (x) + 40.56; amhr2 in step (2) G The probe and primers were amplified in the testis and ovary samples of 50-day-old, 120-day-old and 12-month-old catfish. The average Ct values ​​in the testis were 23.51, 24.61 and 25.23, respectively, while the average Ct values ​​in the ovary were 24, 27.68 and 25.65, respectively. The linear equation of copy number (x) and Ct value (y) was y = -3.3334 × ㏒ (x) + 42.75.

[0020] Preferably, during the qRT-PCR amplification in step (2), the reaction system is 20 μL, including: BioSmart U+All-Powerful Multiple Probe qPCR PreMix 10 μL, cDNA 1 μL, upstream primer F1 0.2 μL with a concentration of 10 μM, downstream primer R1 0.2 μL with a concentration of 10 μM, amhr2 T probe or amhr2 G Probe 0.6 μL, ddHO 2 O 8.0 μL.

[0021] The third object of the present invention can be achieved by the following technical solution: use of the above-mentioned probe and primer in the preparation of a kit for detecting the expression level of the sex determination gene amhr2 of Silurus catfish.

[0022] The present invention also provides the use of the above-mentioned probe and primer, the above-mentioned kit or the above-mentioned method in detecting the expression level of the sex determination gene amhr2 of the catfish.

[0023] The present invention has the following advantages:

[0024] (1) amhr2 in the present invention T Probes and primers were at the same concentration as amhr2 T The expression of amhr2 was found in both T samples and T / G mixed samples, and the Ct values ​​had no significant difference (p>0.05). It was not expressed in G samples. G Probes and primers were at the same concentration as amhr2G The G sample and T / G mixed sample were expressed, and the Ct values ​​were not significantly different (p>0.05), and there was no expression in the T sample;

[0025] (2) amhr2 provided by the present invention T The standard curve of probe and primer was 1×10 3 copies / μL~1×10 8 The linear equation in the concentration range of copies / μL is y=-3.1101×log(x)+40.56, where x represents the copy number and y represents the Ct value. T The average slope of the standard curve was -3.1101, the average P intercept was 40.56, and the correlation coefficient was 1. The amplification efficiency of the qPCR reaction system was close to the ideal level;

[0026] (3) amhr2 provided by the present invention G The standard curve of probe and primer was 1×10 3 copies / μL~1×10 8 In the concentration range of 100 copies / μL, the linear equation of the obtained copy number (x) and Ct value (y) is y = -3.3334 × ㏒ (x) + 42.75, amhr2 G The average slope of the standard curve was -3.3334, the average P intercept was 42.75, and the correlation coefficient was 1. The amplification efficiency of the qPCR reaction system was close to the ideal level;

[0027] (4) The probe and primers provided by the present invention can accurately detect the expression level of the amhr2 gene in the ovary or testis of the catfish, and have low cost, high efficiency and high accuracy. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 is amhr2 in Example 1 of the present invention T Probe primer standard curve;

[0029] Figure 2 is amhr2 in Example 1 of the present invention G Probe primer standard curve;

[0030] Figure 3 is amhr2 in Example 1 of the present invention T Probe primer qRT-PCR amplification results;

[0031] Figure 4 is amhr2 in Example 1 of the present invention G Probe primer qRT-PCR amplification results;

[0032] Figure 5is amhr2 in Example 2 of the present invention T Probe primer and amhr2 G The results of the probe primers detecting the expression of amhr2 in 12-month-old catfish; in the figure, A is amhr2 T The probe primers were used to identify amhr2 in the testis samples of 12-month-old catfish. T Gene expression detection results; B is amhr2 G The probe primers were used to detect amhr2 in the testes and ovaries of 12-month-old catfish. G Gene expression detection results;

[0033] Figure 6 is amhr2 in Example 2 of the present invention T Probe primer and amhr2 G The expression level of amhr2 in catfish of 50 and 120 days old was detected by using probe primers; in the figure, A is amhr2 T The probe primers were used to detect amhr2 in the testis samples of 50-day-old and 120-day-old catfish. T Gene expression detection results; B is amhr2 G The probe primers were used to detect amhr2 in the testes and ovaries of 50-day-old and 120-day-old catfish. G Gene expression detection results. DETAILED DESCRIPTION

[0034] The specific embodiments of the present invention are described in detail below, but it should be understood that the protection scope of the present invention is not limited by the specific embodiments. Based on the embodiments in the present invention, all other embodiments obtained by ordinary technicians in this field without creative work belong to the scope of protection of the present invention. The experimental methods described in the embodiments of the present invention are conventional methods unless otherwise specified, and the materials, reagents, etc. used in the following embodiments can be obtained from commercial channels unless otherwise specified.

[0035] Example 1 Design of probes and primers for detecting the expression level of the sex-determining gene amhr2 in catfish

[0036] 1. Experimental Materials

[0037] 1. Reagents used in the experiment

[0038] (1) RNA extraction: Trizol reagent (RNAiso plus), chloroform, isopropanol, anhydrous ethanol, DEPC water, ddH 2 O;

[0039] (2) One-Step gDNA Removaland cDNASynthesis SuperMix: AT311, TRANS;

[0040] (3) PCR SuperMix(+dye): AS111-13, TRANS;

[0041] (4) Ordinary agarose gel DNA recovery kit: DP209, TIANGEN;

[0042] (5) -T3Cloning Kit: CT-301, TRANS;

[0043] (6)DH 5αChemically Competent Cell: KTSM101L, KT HEALTH;

[0044] (7) Endotoxin-free plasmid mini-preparation kit: DP118, TIANGEN;

[0045] (8) DNA diluent: B639270, Sangon Biotech;

[0046] (9) BioSmart U+All-Powerful Multiple Probe qPCR PreMix (ONE TUBE): QN222-02, Nanjing Vazyme Biotech Co., Ltd.

[0047] 2. Experimental Methods

[0048] 1. Construction of the sex-determining gene amhr2 in Silurus catfish

[0049] This example locates the sex determination interval and the sex determination candidate gene amhr2 of Silurus fulvidraco. The CDS sequence of the gene amhr2 is shown in SEQ ID NO:5.

[0050] Specifically, the CDS sequence of the gene amhr2 is shown below.

[0051] TCAGACTTCATTTGTTAGAAAGAAACATCGGGGAGGTAAAGAAGCTA GCCT GTTGGCCACACACTCT GCTGT GAGTCTTGCATCC[T / G]CATCGTGATC CCAGCAATCTTCAAGGAGCTCGTGG AGAAGCAGTCCCTGAGA GACCC

[0052] Note: The horizontal lines represent the forward primer and the reverse primer (the forward sequence, the base sequence of the reverse primer R after reverse complementation), and the square brackets and bold slashes represent the two alleles, T and G.

[0053] The molecular marker is located at the 86th position of the gene (as shown in SEQ ID NO: 5), the female fish has a GG genotype, and the male fish has a T / G genotype.

[0054] The gene associated with the sex of the catfish was constructed by the following method:

[0055] First, a high-quality female catfish reference genome was constructed. Genomic DNA was extracted from the muscle genome, and CCS sequencing was performed using the PacBio sequencing platform. After obtaining contigs, HiFiasm was preliminarily assembled. Single-base correction was performed using the PacBio sequencing data and Illumina sequencing data of the assembled original genome, and the Hi-C data was aligned to the preliminarily assembled genome. The interaction map was constructed using the Juicer software, and manual error correction was performed using JuiceBox. Finally, a female fish reference genome at the 28 chromosome level was obtained.

[0056] Next, the structure of coding genes was predicted, including homolog prediction and denovo prediction, and the gonad transcriptome data of catfish published by the research group (sra database: SRR1382323-SRR13823244, SRR13823246-SRR13823249; GSA database: CRA008348) were used for comparison and Cufflinks assembly to obtain transcripts. Then, MAKER software was used to integrate non-redundant coding gene sets, and functional annotations were performed through the exogenous protein database.

[0057] Based on the sex-related QTL interval located by the high-density genetic linkage map of Clarias fuscus published by the research team earlier (Linet al., A high-density genetic linkage map and QTL mapping for sex in Clarias fuscus. Aquaculture 561, 2022), the sex-linked SNP markers in the QTL positioning interval were aligned to the reference genome of Clarias fuscus using BLASTN, and the genes in the interval were screened according to the genome annotation results. Near the LOD peak on chr13, an unpublished gene amhr2 with the function of determining male sex was retrieved, and the CDS sequence of the gene was cloned and verified (its base is shown in SEQ ID NO: 5).

[0058] 2. Construction of amhr2 standard plasmid

[0059] 2.1amhr2 T / amhr2 G Standard plasmid construction

[0060] (1) Take male catfish (X G Y T ) The gonadal tissue (sample) was stored in a -80°C refrigerator, and the total gonadal RNA was extracted using the Trizol method. The specific extraction steps are as follows:

[0061] a. Weigh 50 mg of gonad sample, transfer to a 2 mL enzyme-free centrifuge tube, add sterilized steel beads, add 1 mL of Trizol, and crush with a crusher for 30 seconds, and place at room temperature for 5 minutes;

[0062] b. Add 200 μL chloroform, shake for 3 minutes until pink turbidity occurs, and let stand at room temperature for 12 minutes;

[0063] c. Centrifuge at 4°C, 12,000 rpm for 15 min, and transfer the supernatant to a new 1.5 mL enzyme-free centrifuge tube;

[0064] d. Add 500 μL of isopropanol, gently invert and mix for 10 seconds, and let stand at room temperature for 5-10 minutes;

[0065] e. Centrifuge at 4°C, 12,000 rpm for 15 min, discard the supernatant, and dry the remaining liquid;

[0066] f. Add 1 mL of 70% ethanol and invert to rinse the white precipitate;

[0067] g.4℃, 12000rpm, centrifuge for 5min, discard the supernatant and dry the remaining liquid;

[0068] h. Add 1 mL of anhydrous ethanol and invert to rinse the white precipitate;

[0069] i. Centrifuge at 4°C, 12,000 rpm for 5 min, discard the supernatant, and dry the remaining liquid;

[0070] j. Open the centrifuge tube cover and let it stand for 5-10 minutes to dry the anhydrous ethanol;

[0071] k. Add 20 μL of DEPC to dissolve the RNA and gently tap the tube to mix.

[0072] RNA was stored at -80°C until use.

[0073] Nano Drop 2000 ultra-micro spectrophotometer was used to measure the DNA concentration and OD260 / OD280 ratio, and 1.0% agarose gel electrophoresis was used to detect the integrity of the DNA.

[0074] (2) Reverse transcription and PCR amplification

[0075] Prepare 20 μL reverse transcription system as follows: Total RNA 1 μg; Oligo (dT) 1 μL; 2xTS Reaction Mix 10 μL; RT / RI Enzyme Mix 1μL; gDNA Remover 1μL; RNase-free Water to make up to 20μL.

[0076] Mix gently and incubate at 42°C for 15 min.

[0077] Heat at 85℃ for 5 seconds to inactivate RT / RI and gDNA Remover were used for reverse transcription into the first-strand cDNA, which was then stored in a -20°C refrigerator for later use.

[0078] According to the SNP site of the sex determination gene amhr2 of the catfish, an upstream primer F1 with a sequence as shown in SEQ ID NO.3 and a downstream primer R1 with a sequence as shown in SEQ ID NO.4 were designed about 50 bp upstream and downstream thereof, and PCR amplification was performed using the reverse transcribed cDNA as a template;

[0079] Upstream primer F1: 5'-GGGTCTCTCAGGGACTGCTTCT-3' (as shown in SEQ ID NO. 3);

[0080] Downstream primer R1: 5'-GTTGGCCACACACTCTGCTGT-3' (as shown in SEQ ID NO. 4).

[0081] PCR reaction system (50 μL): 2×EasyPCR Super Mix 25 μL; cDNA 2 μL; upstream primer F1 (10 μM) 1.5 μL; downstream primer R1 (10 μM) 1.5 μL; ddH 2 20 μL of HO.

[0082] PCR reaction conditions: 94°C for 5 min, 94°C for 30 s, 60°C for 30 s, 72°C for 20 s, and after 35 cycles, extension at 72°C for 10 min.

[0083] The PCR products were run on 1.2% agarose gel electrophoresis. After confirming the presence of specific amplification bands, three 50 μL PCR systems were amplified and the PCR products were recovered.

[0084] PCR product gel recovery

[0085] a. Column equilibration step: Add 500 μL of equilibration solution BL to the adsorption column CA2 (the adsorption column is placed in the collection tube), centrifuge at 12,000 rpm for 1 min, pour out the waste liquid in the collection tube, and put the adsorption column back into the collection tube.

[0086] b. Cut out the single target DNA band from the agarose gel (try to remove the excess part) and put it into a clean centrifuge tube and weigh it.

[0087] c. Add 3 times the volume of PN solution to the gel block (if the gel weight is 0.1g, its volume can be regarded as 100μL, then add 300μLPN solution), place in a 50℃ water bath, and gently flip the centrifuge tube up and down to ensure that the gel block is fully dissolved. If there are still undissolved gel blocks, continue to leave them for a few minutes or add more sol solution until the gel block is completely dissolved. Note: For the recovery of small fragments <300bp, add 1 / 2 gel block volume of isopropanol after adding PN complete sol to improve the recovery rate; after the gel block is completely dissolved, lower the solution temperature to room temperature before loading it on the column, because the adsorption column has a stronger ability to bind DNA at room temperature.

[0088] d. Add the solution obtained in the previous step to an adsorption column CA2, place it at room temperature for 4 minutes, centrifuge it at 12,000 rpm for 60 seconds, pour out the waste liquid in the collection tube, and place the adsorption column CA2 in the collection tube. Note: The volume of the adsorption column is 800 μL. If the sample volume is greater than 800, it can be added in batches.

[0089] e. Add 600 μL of rinse solution PW to the adsorption column CA2, centrifuge at 12,000 rpm for 60 seconds, pour out the waste liquid in the collection tube, and place the adsorption column CA2 in the collection tube.

[0090] f. Repeat step e.

[0091] g. Place the adsorption column CA2 back into the collection tube and centrifuge at 12,000rpm for 2 minutes to remove as much rinsing solution as possible. Place the adsorption column CA2 at room temperature for several minutes and dry it thoroughly to prevent the residual rinsing solution from affecting the next step of the experiment. Note: Residual ethanol in the rinsing solution will affect subsequent enzyme reactions (enzyme digestion, PCR, etc.) experiments.

[0092] h. Place the adsorption column CA2 in a clean centrifuge tube and drop 30 μL ddH 2 O, place at room temperature for 5 minutes, and centrifuge at 12,000 rpm for 2 minutes to collect the DNA solution.

[0093] (3) Vector ligation and transformation

[0094] a. Prepare 5 μL of ligation system as follows; Ligation system (5 μL): PCR Product 4 μL; -T3 Cloning Vectorr 1μL.

[0095] b. Mix gently and react at room temperature (20℃-37℃) for 5 minutes. After the reaction is completed, place the centrifuge tube on ice.

[0096] c. PCR instrument 25℃ for 10 min;

[0097] d. Take out the competent cells DH5a from the -80℃ refrigerator and melt them in an ice bath;

[0098] e. Add the ligation product to 50 μL DH5α competent cells, mix gently, and place on ice for 30 min;

[0099] f. Heat shock in 42℃ water bath for 60s, then quickly put back on ice and let stand for 2min;

[0100] g. Add 900 μL of LB liquid medium balanced to room temperature, and culture at 200 rpm and 37°C for 50 min to revive the bacteria;

[0101] h. Centrifuge at 12000 rpm for 1 min, remove 900 μL of supernatant, resuspend competent cells and evenly spread on ampicillin-resistant plates;

[0102] i. Place the plate in a 37°C incubator for 30 minutes until the liquid is absorbed, invert the plate, and incubate for 12 hours to grow colonies;

[0103] j. Perform colony PCR identification and sequencing identification. After successful identification, amhr2 T and amhr2 G Standard plasmid.

[0104] 2. Preparation of standard curve

[0105] (1) DNA standard curve drawing

[0106] According to amhr2 T and amhr2 G Gene sequence, following the primer design principle, design T typing probe (as shown in SEQ ID NO.1) and G typing probe (as shown in SEQ ID NO.2). DNA Dilution was used to transfer the constructed DNA standard amhr2 T and amhr2 G Serial dilutions (1×10 8 , 1×10 7 , 1×10 6 , 1×10 5 , 1×104 and 1×10 3 copies / μL) were used as templates for qRT-PCR amplification and a DNA standard curve was prepared.

[0107] The sequence of the T typing probe is as follows:

[0108] amhr2 T Probe: 5'-VIC-CTTGCATCCTCATCGTGA-MGB-3' (such as SEQ ID NO.1

[0109] shown);

[0110] The sequence of the G typing probe is as follows:

[0111] amhr2 G Probe: 5'-FAM-CATCCGCATCGTGAT-MGB-3' (as shown in SEQ ID NO. 2);

[0112] Determination of the number of copies of the standard: Calculate the copy concentration (copies / μL) based on the concentration of the standard and the molecular weight (MW) of the plasmid;

[0113] The standard was set at 10 8 -10 3 copies / μL, 10-fold dilution.

[0114] Prepare PCR system:

[0115] qPCR reaction system (20 μL): BioSmart U+All-Powerful Multiple Probe qPCR PreMix 10 μL, standard 1 μL, upstream primer F1 (10 μM) 0.2 μL, downstream primer R1 (10 μM) 0.2 μL, T typing probe or G typing probe 0.6 μL, ddH 2 O 8.0μL.

[0116] PCR reaction program: 37°C for 2 min, 95°C for 2 min, 95°C for 10 sec, 60°C for 30 sec to collect signals, a total of 45 cycles.

[0117] 3. Primer specificity verification

[0118] To verify amhr2 T and amhr2 G The specificity of the probe is amhr2 T Standard (1×10 7 copies / μL) and amhr2 G Standard (1×107 5 μL of each of the three samples (copies / μL) were added to 90 μL DNA Dilution to prepare amhr2 T / amhr2 G Mixed samples (T / G mixed samples), where amhr2 T The concentration is 1×10 6 copies / μL,amhr2 G The concentration is 1×10 6 copies / μL. 6 copies / μL)、amhr2 T / amhr2 G Mixed sample and G sample (1×10 6 copies / μL) as templates, respectively using amhr2 T Probe and amhr2 G The probe was amplified by qRT-PCR.

[0119] qPCR reaction system (20 μL): BioSmart U+All-Powerful Multiple Probe qPCR PreMix 10 μL, standard 1 μL, upstream primer F1 (10 μM) 0.2 μL, downstream primer R1 (10 μM) 0.2 μL, T typing probe or G typing probe 0.6 μL, ddH 2 O 8.0μL.

[0120] The above system was mixed evenly, centrifuged, and divided into 96-well PCR plates. Three parallel PCR reactions were performed for each gene in each sample.

[0121] PCR reaction program: 37°C for 2 min, 95°C for 2 min, 95°C for 10 sec, 60°C for 30 sec to collect signals, a total of 45 cycles.

[0122] 3. Experimental Results

[0123] 1.amhr2 T Standard curve construction

[0124] amhr2 T The standard curve of the probe is as follows Figure 1 As shown. In 1×10 3 copies / μL~1×10 8 In the concentration range of copies / μL, the linear equation of the obtained copy number (x) and Ct value (y) is y=-3.1101×log(x)+40.56. TThe average slope of the standard curve was -3.1101, the average P intercept was 40.56, and the correlation coefficient was 1. The amplification efficiency of the qPCR reaction system was close to the ideal level.

[0125] 2.amhr2 G Standard curve construction

[0126] amhr2 G The standard curve of the probe is as follows Figure 2 As shown. In 1×10 3 copies / μL~1×10 8 In the concentration range of copies / μL, the linear equation of the obtained copy number (x) and Ct value (y) is y = -3.3334 × ㏒ (x) + 42.75. G The average slope of the standard curve was -3.3334, the average P intercept was 42.75, and the correlation coefficient was 1. The amplification efficiency of the qPCR reaction system was close to the ideal level.

[0127] 3.amhr2 T / amhr2 G Verification of probe and primer specificity

[0128] To verify the specificity of the dual fluorescent labeled probe and primers, amhr2 T 、amhr2 G The probe and primer were added to T sample, G sample, and T / G mixed sample respectively. Figure 3 It can be seen that amhr2 T The probe primers were at the same concentration as amhr2 T The gene was expressed in both T samples and T / G mixed samples, and the Ct values ​​were not significantly different (p>0.05). It was not expressed in G samples and negative controls. Figure 4 It can be seen that amhr2 G The probe primers were at the same concentration as amhr2 G The gene was expressed in both the G sample and the T / G mixed sample, and there was no significant difference in Ct values ​​(p>0.05). It was not expressed in the T sample and the negative control.

[0129] Example 2

[0130] In this example, a further verification test was conducted using gonads of 12-month-old catfish, as follows:

[0131] 1. Extraction and reverse transcription of gonadal RNA from 12-month-old catfish

[0132] The testes and ovarian tissues of 12-month-old catfish were stored in a -80°C refrigerator, and the total RNA of the gonads was extracted using the Trizol method. The specific extraction steps are as follows:

[0133] a. Weigh 50 mg of gonadal sample, transfer to a 2 mL enzyme-free centrifuge tube, add sterilized steel beads, add 1 mL of Trizol, and crush with a crusher for 30 seconds, and place at room temperature for 5 minutes;

[0134] b. Add 200 μL chloroform, shake for 3 minutes until pink turbidity occurs, and let stand at room temperature for 12 minutes;

[0135] c. Centrifuge at 4°C, 12,000 rpm for 15 min, and transfer the supernatant to a new 1.5 mL enzyme-free centrifuge tube;

[0136] d. Add 500 μL of isopropanol, gently invert and mix for 10 seconds, and let stand at room temperature for 5-10 minutes;

[0137] e. Centrifuge at 4°C, 12,000 rpm for 15 min, discard the supernatant, and dry the remaining liquid;

[0138] f. Add 1 mL of 70% ethanol and invert to rinse the white precipitate;

[0139] g.4℃, 12000rpm, centrifuge for 5min, discard the supernatant and dry the remaining liquid;

[0140] h. Add 1 mL of anhydrous ethanol and invert to rinse the white precipitate;

[0141] i. Centrifuge at 4°C, 12,000 rpm for 5 min, discard the supernatant, and dry the remaining liquid;

[0142] j. Open the centrifuge tube cover and let it stand for 5-10 minutes to dry the anhydrous ethanol;

[0143] k. Add 20 μL DEPC to hydrate and dissolve the RNA, and gently tap the tube wall to mix.

[0144] The RNA was stored at -80°C until use.

[0145] Nano Drop 2000 ultra-micro spectrophotometer was used to measure the DNA concentration and OD260 / OD280 ratio, and 1.0% agarose gel electrophoresis was used to detect the integrity of the DNA.

[0146] Then prepare 20 μL reverse transcription system as follows: Total RNA 1 μg; Oligo (dT) 1 μL; 2xTS Reaction Mix 10 μL; RT / RI Enzyme Mix 1μL; gDNARemover 1μL; RNase-free Water to make up to 20μL.

[0147] Mix gently and incubate at 42°C for 15 min.

[0148] Heat at 85℃ for 5 seconds to inactivate RT / RI and gDNA Remover were used for reverse transcription into the first-strand cDNA, which was then stored in a -20°C refrigerator for later use.

[0149] 2. Detection of amhr2 expression in 12-month-old catfish

[0150] qPCR reaction system (20 μL): BioSmart U+All-Powerful Multiple Probe qPCR PreMix 10 μL, cDNA 1 μL, upstream primer F1 (10 μM) 0.2 μL, downstream primer R1 (10 μM) 0.2 μL, amhr2 T probe or amhr2 G Probe 0.6 μL, ddHO 2 O 8.0μL.

[0151] The above system was mixed evenly, centrifuged, and divided into 96-well PCR plates. Three parallel PCR reactions were performed for each gene in each sample.

[0152] PCR reaction program: 37°C for 2 min, 95°C for 2 min, 95°C for 10 sec, 60°C for 30 sec to collect signals, a total of 45 cycles.

[0153] 3. Detection results of amhr2 expression in 12-month-old catfish

[0154] amhr2 T The probe and primers showed specific amplification in the testis samples of 12-month-old catfish, with an average Ct value of 24.63. According to the linear equation of copy number (x) and Ct value (y) y = -3.1101 × log (x) + 40.56, it can be seen that amhr2 T The gene expression level in the testis of Silurus catfish was 1.32×10 5 copies.

[0155] amhr2 G The probe and primers were amplified in the testis and ovary samples of 12-month-old catfish, with average Ct values ​​of 25.23 and 25.65, respectively. According to the linear equation of copy number (x) and Ct value (y) y = -3.3334 × ㏒ (x) + 42.75, it can be seen that amhr2 G The expression levels of the gene in the testis and ovary of Silurus catfish were 1.8×10 5 copies and 1.35×10 5 copies.

[0156] The results are as follows Figure 5 As shown, amhr2 T The probe and primers showed specific amplification only in the testis samples of Silurus catfish, amhr2G The probe and primers were amplified in the testis and ovary samples of Silurus catfish.

[0157] Example 3

[0158] In this example, further verification experiments were conducted using gonads of 50-day-old and 120-day-old catfish, as follows:

[0159] 1. Extraction and reverse transcription of gonadal RNA from 50-day-old and 120-day-old catfish

[0160] The testes and ovarian tissues of 50-day-old and 120-day-old catfish were stored in a -80°C refrigerator, and the total RNA of the gonads was extracted using the Trizol method. The specific extraction steps were the same as those in Example 2.

[0161] 2. Detection of amhr2 expression level in 50-day-old and 120-day-old catfish, as in Example 2.

[0162] 3. Detection results of amhr2 expression in 50-day-old and 120-day-old catfish

[0163] amhr2 T The probe and primers showed specific amplification only in the testis samples of 50-day-old and 120-day-old catfish, with average Ct values ​​of 23.27 and 23.90, respectively. According to the linear equation of copy number (x) and Ct value (y) y = -3.1101 × log (x) + 40.56, it can be seen that amhr2 T The expression levels of the gene in the testes of 50-day-old and 120-day-old catfish were 3.62×10 5 copies and 2.27×10 5 copies.

[0164] amhr2 G The probe and primers were amplified in the testes and ovaries of 50-day-old and 120-day-old catfish. The average Ct values ​​of the testes and ovaries of 50-day-old catfish were 23.51 and 24, respectively, and the average Ct values ​​of the testes and ovaries of 120-day-old catfish were 24.61 and 27.68, respectively. According to the linear equation of copy number (x) and Ct value (y) y = -3.3334 × ㏒ (x) + 42.75, amhr2 G The expression levels of the gene in the testis and ovary of 50-day-old catfish were 5.91×10 5 copies and 4.22×10 5 The expression levels in the testis and ovary of 120-day-old catfish were 2.77×10 5 copies and 3.32×10 4 copies.

[0165] The results are as follows Figure 6 As shown, amhr2 T The probe and primers showed specific amplification only in the testis samples of Silurus catfish, amhr2 G The probe and primers were amplified in the testis and ovary samples of Silurus catfish.

[0166] The above embodiments are only used to illustrate the present invention, and the protection scope of the present invention is not limited to the above embodiments. A person skilled in the art can achieve the purpose of the present invention based on the above disclosure of the present invention, and any improvement and deformation based on the concept of the present invention shall fall within the protection scope of the present invention, and the specific protection scope shall be subject to the claims.

Claims

1. A probe and primer for detecting the expression level of the sex determination gene amhr2 of catfish, characterized in that: The probe includes amhr2 T Probe and amhr2 G Probe, the amhr2 T The sequence of the probe is shown in SEQ ID NO.1, and the amhr2 G The sequence of the probe is shown in SEQ ID NO.2, the primers include an upstream primer F1 and a downstream primer R1, the sequence of the upstream primer F1 is shown in SEQ ID NO.3, and the sequence of the downstream primer R1 is shown in SEQ ID NO.

4.

2. The probe and primer for detecting the expression level of the sex determination gene amhr2 of catfish according to claim 1, characterized in that: The base sequence of the sex-determining gene amhr2 of the catfish is shown in SEQ ID NO:

5. The sex-related SNP mutation site in the kinase domain of the gene is located at position 86 of the sequence shown in SEQ ID NO: 5, resulting in a change in a single amino acid Leu / Arg, and the XY male fish exhibits a heterozygous amhr2 T / amhr2 G In XX female fish, the homozygous amhr2 G / amhr2 G ,amhr2 T Determines male differentiation.

3. A kit for detecting the expression level of the sex-determining gene amhr2 in catfish, characterized in that: The method comprises the probe and primers described in claim 1.

4. The kit according to claim 3, characterized in that Also included is Probe qPCR PreMix and ddH2O.

5. A method for detecting the expression level of the sex-determining gene amhr2 in catfish, characterized in that: The following steps are involved: (1) Using the gonad cDNA of the tested catfish sample as a template; (2) The amhr2 according to claim 1 T Probe and primers or the amhr2 G The probes and primers were used for qRT-PCR amplification; The amhr2 T The probe and primers were used to detect the expression of amhr2 gene in the testis samples of Silurus catfish; The amhr2 G The probe and primers were used to detect the expression level of amhr2 gene in the testis and ovary samples of Silurus catfish.

6. The method for detecting the expression level of the sex-determining gene amhr2 of catfish according to claim 5, characterized in that: amhr2 described in step (2) T The probe and primers showed specific amplification in the testis sample of Silurus fulvidraco. The linear equation of the copy number (x) and the Ct value (y) was y=-3.1101×log(x)+40.

56. G The probe and primers were amplified in the testis and ovary samples of Silurus fuliginosa. The linear equation of copy number (x) and Ct value (y) was y=-3.3334×㏒(x)+42.

75.

7. The method for detecting the expression level of the sex-determining gene amhr2 of catfish according to claim 5, characterized in that: During qRT-PCR amplification in step (2), the reaction system is 20 μL, including: BioSmart U+All-Powerful MultipleProbe qPCR PreMix 10 μL, cDNA 1 μL, upstream primer F1 0.2 μL with a concentration of 10 μM, downstream primer R1 0.2 μL with a concentration of 10 μM, amhr2 T probe or amhr2 G Probe 0.6 μL, ddH2O 8.0 μL.

8. Use of the probe and primers according to claim 1 in preparing a kit for detecting the expression level of the sex determination gene amhr2 of Silurus catfish.

9. Use of the probe and primer according to claim 1 or 2 or the kit according to claim 3 or 4 in detecting the expression level of the sex determination gene amhr2 in Silurus catfish.

10. Use of the method according to any one of claims 5 to 7 in detecting the expression level of the sex determination gene amhr2 in Silurus catfish.

Images