Application of miRNA in diagnosis and treatment of atrial fibrillation

Abstract

The invention belongs to the technical field of biological medicine, and particularly relates to application of miRNA in diagnosis and treatment of atrial fibrillation. The invention discloses a miRNA (micro Ribonucleic Acid) marker for detecting atrial fibrillation, the miRNA marker is hsa-miR-34a-3p, and the nucleotide sequence of the hsa-miR-34a-3p is as shown in SEQ ID NO. 1. The miRNA marker disclosed by the invention has important clinical significance on early detection and treatment of atrial fibrillation. The research of the invention supports the development of targeted therapy intended to restore autophagy balance and slow atrial fibrillation progression. And a therapeutic target and an important basis can be provided for clinical applications such as gene therapy and drug therapy of atrial fibrillation.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology, and in particular, relates to an application of miRNA in the diagnosis and treatment of atrial fibrillation. Background Art

[0002] Atrial fibrillation, also known as AF, is the most common sustained cardiac arrhythmia worldwide, affecting millions of people. Although the early stages of AF can usually be controlled with medication and lifestyle adjustments, more advanced cases face considerable treatment challenges. Patients with advanced AF often show resistance to conventional treatments, resulting in poor prognosis and a higher risk of complications. In addition, the development of targeted treatments for AF is hampered by the current incomplete understanding of the molecular mechanisms of AF. Therefore, a deeper understanding of these mechanisms is crucial to developing more effective treatments and improving patient outcomes.

[0003] MicroRNA (miRNA) is a short noncoding RNA of approximately 18-25 nucleotides in length that plays a crucial role in various pathophysiological processes, making it a key molecule for understanding disease mechanisms and identifying therapeutic targets. The miR-34 family includes three subtypes: miR-34a, miR-34b, and miR-34c. MiR-34a is located on human chromosome 1p36, while miR-34b and miR-34c are located on chromosome 11q23. Notably, miR-34a is abundantly expressed in cardiomyocytes. It is well known that it can induce apoptosis and is directly regulated by the tumor suppressor protein p53. This protein can be activated by cellular stressors such as DNA damage, oncogene activation, and hypoxia and plays a key role in cellular responses. However, the exact mechanism by which p53 affects the development of AF through miR-34a is not fully understood.

[0004] Autophagy is a key regulatory mechanism that maintains cellular homeostasis by sequestering damaged proteins and organelles. Autophagy is present in nearly all cell types and is triggered by a variety of signals, including nutrient deprivation, starvation, and cellular stress. It plays an important role in cellular physiology, and increasing evidence suggests that it has an important role in maintaining baseline autophagy in normal cardiomyocytes for adaptation and repair. However, autophagy is disrupted in atrial myocytes from patients with AF. Autophagy is a reversible degradation process found in eukaryotes that has emerged as a potential therapeutic target for various cardiovascular diseases, although its specific role in AF has remained largely unexplored. Summary of the invention

[0005] The primary purpose of the present invention is to provide an application of miRNA in the diagnosis and treatment of atrial fibrillation, so as to achieve the diagnosis, prevention and treatment of atrial fibrillation.

[0006] To this end, the present invention provides the following technical solutions.

[0007] The first aspect of the present invention provides a miRNA marker for detecting atrial fibrillation, wherein the marker is hsa-miR-34a-3p, and the nucleotide sequence of the hsa-miR-34a-3p is shown in SEQ ID NO.1.

[0008] In a preferred embodiment of the present invention, the nucleotide sequence of hsa-miR-34a-3p is: CAAUCAGCAAGUAUACUGCCCU.

[0009] In a preferred embodiment of the present invention, the expression of the marker hsa-miR-34a-3p is increased in the serum and atrial tissue of patients with atrial fibrillation.

[0010] The second aspect of the present invention provides a use of the miRNA marker for detecting atrial fibrillation as described above in the preparation of a product for diagnosis, prognosis, prevention or treatment of atrial fibrillation.

[0011] The third aspect of the present invention provides a use of the aforementioned miRNA marker for detecting atrial fibrillation in the preparation of a pharmaceutical composition for preventing and / or treating atrial fibrillation.

[0012] In a preferred embodiment of the present invention, the pharmaceutical composition comprises an hsa-miR-34a-3p inhibitor.

[0013] In a preferred embodiment of the present invention, the hsa-miR-34a-3p inhibitor can inhibit the expression of hsa-miR-34a-3p or can inhibit the function of hsa-miR-34a-3p.

[0014] The fourth aspect of the present invention provides a pharmaceutical composition for preventing and / or treating atrial fibrillation, the pharmaceutical composition comprising an hsa-miR-34a-3p inhibitor and a pharmaceutically acceptable carrier.

[0015] In a preferred embodiment of the present invention, the pharmaceutical composition further comprises other agents for inhibiting or treating atrial fibrillation.

[0016] A fifth aspect of the present invention provides a use of the miRNA marker for detecting atrial fibrillation as described above in the preparation of an atrial fibrillation diagnosis kit.

[0017] A sixth aspect of the present invention provides a kit for diagnosing atrial fibrillation, the kit comprising a reagent for detecting the expression level of the miRNA marker as described above.

[0018] In a preferred embodiment of the present invention, the reagent further comprises primers and instructions for specifically amplifying the miRNA marker, wherein the primers comprise a forward primer having a nucleotide sequence as shown in SEQ ID NO.2 and a reverse primer having a nucleotide sequence as shown in SEQ ID NO.3.

[0019] In a preferred embodiment of the present invention, the forward primer sequence is: 5'-TCCACTTCCAAGCTGAGCGAG-3', and the reverse primer sequence is: 5'-GTCCAGGGCATGATGGTTCT-3'.

[0020] By means of the above technical solution, the present invention has at least the following advantages: 1. The present invention found that p53 was significantly increased in an in vitro simulated atrial fibrillation test, and also promoted the increase of miR-34a levels. As a direct target of miR-34a, the expression of insulin-like growth factor 1 receptor (IGF1-R for short) in these cells decreased. Further in vitro and in vivo experiments showed that the administration of miR-34a-3p inhibitors can enhance the expression of IGF1R, and the addition of miR-34a-3p mimics further reduced the level of IGF1R in HL-1 cells and increased autophagy activity. By targeting IGF1R mRNA through miR-34a, autophagy is reduced by activating the PI3K / AKT / mTOR pathway, thereby affecting the development of atrial fibrillation.

[0021] 2. The present invention has discovered for the first time that the expression of has-miRNA-34a-3p is related to atrial fibrillation. By detecting the expression level of has-miRNA-34a-3p in the blood of a subject, it is possible to determine whether the subject suffers from atrial fibrillation or whether the subject is at risk of suffering from atrial fibrillation, thereby guiding clinicians to provide prevention or treatment plans for the subject. It can also provide therapeutic targets and important basis for clinical applications such as gene therapy and drug therapy for atrial fibrillation.

[0022] The above description is only an overview of the technical solution of the present invention. In order to more clearly understand the technical means of the present invention and implement it according to the contents of the specification, the preferred embodiments of the present invention are described in detail as follows. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1The co-expressed miRNAs identified by WGCNA are shown: (A) Construction of gene co-expression network, with each gene cluster represented by a color in the gene cluster dendrogram; (B) Correlation analysis between gene cluster profile and risk phenotype, with the numbers in and outside brackets representing p-value and Pearson coefficient, respectively; (C) Correlation and significance of turquoise module with patients in the atrial fibrillation group, with GS>0.5 and MM>0.8 defined as key miRNAs in the module; (D) Target genes were sequenced and mutually verified using three databases: miRDB, miRTarBase, and TargetScan; Sankey diagram was used to visualize the correspondence between key miRNAs and target genes; (E, S1A) Histograms were constructed by GO and KEGG analysis of turquoise hub target genes; Figure 2 Identification of differentially expressed miRNAs is shown: (A) Volcano plot showed that 87 miRNAs were upregulated and 58 miRNAs were downregulated in the AF group compared with the SR group; (B) Topological network plot showed the target genes of upregulated miRNAs; (C) Topological network plot showed the target genes of downregulated miRNAs; (D, E, S2A) Histograms were constructed by GO and KEGG analysis of the target genes of upregulated miRNAs (D) and downregulated miRNAs (E); Figure 3 The identification of characteristic genes is shown: (A) Venn diagram analysis detected 22 key miRNAs that intersected with the above groups; (B) Residual reverse cumulative distribution plot of the model constructed using RF random forest tree, SVM, XGB, GLM, Elastic net, stepLDA, PLS and msaenet, the Y-axis value represents the percentile of outliers; (C) Box plot of sample residuals of 8 algorithms, the x-axis value represents the quantile of outliers, and the red dot represents the mean; (D) ROC analysis of algorithms such as RF random forest tree, SVM, XGB, and GLM; (E) The top 10 important genes output by the 8 algorithms, a total of 30 Parkinson's glioma characteristic genes were identified; Figure 4Hsa-miR-34a-3p is a key gene in the AF group: (A) The inverted graph shows the number of overlapping genes identified by various algorithms, and the bar graph on the left shows the total number of elements contained in each original dataset; the intersection below, through horizontal correspondence, uses the point to refer to the corresponding dataset name on the left, and connects the points vertically to represent the intersection between the corresponding datasets, that is, through the connection between points, it corresponds to the overlap of circles in the traditional Venn diagram; the vertical correspondence with the above-mentioned bar graph indicates the number of intersecting elements in this intersection; (B) The box plot shows that the hsa-miR-34a-3p difference between the AF group and the SR group is statistically significant; (C) ROC analysis of hsa-miR-34a-3p to reflect the expression difference between the AF group and the SR group; (D) qPCR results of miR-34a-3p in the SR-AF group of HL-1 cells; Figure 5 The results showed that IGF1-R is a target gene of miR-34a-3p and affects atrial fibrillation through the PI3K / AKT / MTOR pathway: (A) qPCR results of eight target genes HNRNPU, IGF1R, TRAM2, HNRNPAB, IGSF3, ZNF711, SDE2, SH3GLB1 and TMEM33; (B) Luciferase reporter gene analysis to detect the luciferase activity of 293T cells overexpressing miR-34a-3p-mimic or NC-mince in IGF1-R WT or IGF1-R MT Mut; (D) WB images of SR and SR+miR-34a-3p-mimic groups; (E) WB images of SR, AF, AF+NC, AF+miR-34a-3p mimic, and AF+miR-34a-3p inhibitor groups. (F) WB profiles of PI3K / AKT / MTOR pathway in SR, AF, AF+si-NC, AF+si-IGF1R, AF+si-P53, AF+miRNA-NC, and AF+miR-34a-3p-mimic groups; Figure 6The results show that P53 / miR-34a-3p / IGF1R affects the autophagy level in atrial fibrillation: (A) WB images of SR, SR+miRNA-NC, SR+miR-34a-3p-mimics, SR+miR-34a-3p-inhibitor, SR+3-methyladenine, AF, and AF+ groups; (B) WB images of SR(0.9NaCl)+miRNA-NC, AF+miR-34a-3p-mimics, AF+miR-34a-3p-inhibitor, AF+rapamycin, AF+3-methyladenosine0.1ml / 100g) / AF (Ach+CaCl20.1ml / 100g) + miRNA-NC / AF (Ach+CaCl20.1ml / 100g); (C) WB images of SR / AF / AF+ IGF1-R immunofluorescence staining of miRNA-NC / AF+mir-34a-3p inhibitor; (D) ECG of SR / AF / AF+ miRNA-NC / AF+ miR-34a-3p inhibitor; Figure 7 P53 / miR-34a-3p / IGF1R affects the occurrence and prognosis of atrial fibrillation: (A) WB images of left atrial tissues of SR and AF patients; (B) WB images of left atrial tissues of SR and AF patients; (C) miR-34a-3p qPCR results in SR and AF groups; (D) immunofluorescence staining of miR-34a-3p in primary atrial myocytes; (E) immunofluorescence staining of IGF1-R in SR / AF patient group; Figure 8 This is the KEGG enrichment analysis diagram; Fig. 9 This is a large enrichment map of miRNAs pathway. DETAILED DESCRIPTION

[0024] In order to make the technical means, creative features, objectives and effects of the present invention easy to understand, the technical solutions in the embodiments of the present invention will be clearly and completely described below in combination with the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0025] Unless otherwise specified, the experimental methods used in the following examples are all conventional methods.

[0026] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources.

[0027] Example 1: Sample source and sample preparation 1. Sample source The AF research biobank was established in November 2007 at the Drum Tower Hospital affiliated to Nanjing University Medical School. The experiments involved in the present invention were conducted in accordance with the Declaration of Helsinki and approved by the Ethics Committees of Nanjing Medical University and Nanjing University. Atrial tissue, preoperative venous blood, and detailed clinical data involved in the experiments of the present invention were obtained with the written informed consent of the patients.

[0028] In this study, patients undergoing isolated MV surgery (mitral valve surgery) were included, and the following patients were excluded: 1) patients over 65 years old or with a history of cancer; 2) patients with fracture within six months; 3) patients with coronary artery disease (CAD); 4) patients with aortic or valvular calcification; 5) patients with bacterial endocarditis or active rheumatic disease; 6) patients with diabetes or renal insufficiency (serum creatinine >136 umol / L).

[0029] Finally, a total of 10 patients with persistent atrial fibrillation (PeAF) as the AF group and 10 patients with sinus rhythm (SR) matched with the AF group in terms of gender and age were recruited into this trial as the SR group.

[0030] 2. Sample preparation The atrial appendages of the AF group and the SR group were removed and immediately frozen in liquid nitrogen, stored at -80°C, and used as test samples. It should be noted that all subjects provided written informed consent and were admitted to the Drum Tower Hospital affiliated to Nanjing University Medical School. The research in this invention followed the principles outlined in the Declaration of Helsinki and was approved by the Institutional Review Board of Nanjing Drum Tower Hospital (IRB No. 2016-151-01).

[0031] Example 2: Experimental method 1. Sample RNA extraction, library preparation and deep sequencing UID miRNA-seq experiments, high-throughput sequencing, and data analysis were performed by Seqhealth Technology Co., Ltd., Wuhan, China.

[0032] Total RNA was extracted from atrial tissue during surgery using TRIzol Reagent (Invitrogen, cat. NO15596026). The specific extraction method was referred to in Chomczynski et al. (DOI: 10.1006 / abio.1987.9999). After RNA extraction, DNase I was used for DNA digestion. Quantitative detection of RNA was obtained by detecting the A260 / A280 value using NanodropTM onec spectrophotometer (Thermo Fisher Scientific Inc.). RNA integrity was verified by 1.5% agarose gel electrophoresis. Finally, the qualified RNA was quantified using QubitTM RNA Broad Range Assay kit (Life Technologies, Q10210) using Qubit3.0.

[0033] Using KC-Digital TM Illumina ® The miRNA library was prepared using the Small RNA Library Preparation Kit (Cat. No. DR08602, Wuhan Seqhealth Co., Ltd., China) and 3 μL of total RNA was used as the input for miRNA library preparation according to the instructions of the kit. The kit eliminates the repeat bias in the PCR and sequencing steps by labeling the pre-amplified small RNA molecules with unique molecular identifiers (UMIs) of 8 random bases. The eluted cDNA library was separated by 6% PAGE gel. The ~160 bp band was isolated, purified, and quantified using qbit3.0, and finally sequenced on a HiSeq X-10 sequencer (Illumina) using the PE150 model.

[0034] 2. miRNA-Seq data analysis Fastx_toolkit (version: 0.0.13.2) was first used to filter the raw sequencing data, discard low-quality reads, and then cutadapt (version: 1.15) was used to trim the adapter sequences. Clean reads were further processed with in-house scripts to remove duplicate bias introduced during library preparation and sequencing. In brief, clean reads were first clustered according to UMI sequences, and reads with the same UMI sequence were grouped into the same cluster. Reads with 100% sequence identity were extracted into new subclusters by pairwise alignment of reads within the same cluster. After all subclusters were generated, multiple sequence alignments were performed for each subcluster to obtain a consensus sequence for each subcluster. After completing these steps, any errors and biases introduced by PCR amplification or sequencing were eliminated. Bowtie (version: 1.1.2) with default parameters was used to map the deduplicated consensus sequence of each sample to the human reference genome (genome assembly GRCh38.p14). The mirdeep2 software package (version: 2.0.0.8) was used to map the reads to known primary-miRNAs in the miRBase database and predict new miRNAs. The edgeR software package (version: 3.12.1) was used to identify the differential expression of miRNAs between the groups. The statistical significance of the difference in miRNA expression was judged by p value < 0.05 and |Log2 expression change fold|> 1 as the cutoff value. The target mRNAs of differentially expressed miRNAs were predicted using miRanda v3.3a. KOBAS software (version: 2.1.1) was used to perform gene ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment analysis on the target mRNAs, and the corrected p value cutoff was 0.05 to judge the enrichment to be statistically significant. The miRNA-mRNA co-expression network was constructed by WGCNA (version: 1.61), and the correlation threshold between miRNA and mRNA was > 0.8.

[0035] 3. HL-1 cardiomyocyte culture The HL-1 cardiomyocytes involved in the present invention were obtained from Dr. William Claycomb (Louisiana State University, New Orleans) and cultured in incomplete Claycomb medium (Sigma; 51800C) supplemented with 10% fetal bovine serum (Wisent), 100 U / ml penicillin (Wisent), 100 µg / ml streptomycin (Wisent), 4 mM l-glutamine (Sigma), 0.3 mM l-ascorbic acid (Sigma) and 100 µM norepinephrine (Sigma). HL-1 cardiomyocytes were cultured on cell culture plastic or glass covers coated with 0.02% gelatin (Sigma) at 37°C in a humidified atmosphere of 5% CO2.

[0036] 4. Rapid electrical stimulation of HL-1 cardiomyocytes HL-1 cells (≥3×10 5 Cells) were seeded into gelatin / fibronectin-coated six-well culture dishes. When cells reached confluence, they were rapidly electrically stimulated to a 5-fold rate increase, as in clinical AF (5 Hz; 3 V; pulse duration of 5 ms) for 12 or 24 h using a C-Pace100 culture pacemaker (IonOptix). Tyrode's solution medium (137 mmol / NaCl, 5.4 mmol / l KCl, 1.2 mmol / l MgSO4, 1.8 mmol / lCal2, 1.2 mmol / l KH2PO4, 10 mmol / l glucose, and 10 mmol / l HEPES, pH adjusted to 7.4 with NaOH) was used for electrical stimulation. HL-1 cells cultured in normal Tyrode solution medium for 12 and 24 h without electrical stimulation were used as the normal control group, and HL-1 cells were paced with electrical stimulation (1 Hz; 3 V; pulse duration of 5 MS) at designated times using a C-Pace100 pacemaker (IonOptix) as the pacing control group.

[0037] siRNA (small interfering RNA) for p21 and its control siRNA were purchased from RiboBio and transfected into HL-1 cells using Lipofectamine 3000 (Thermo Fisher) according to the manufacturer's instructions. In the AngII experiment, when HL-1 cells were confluent in growth medium (Claycomb medium), the confluent cells were transferred to serum-free Claycomb medium and incubated with 1 µM / l AngII (Sigma) for the indicated time.

[0038] 5. Immunofluorescence Cells were grown on sterile coverslips, fixed with 4% paraformaldehyde, and permeabilized in PBS containing 1% BSA and 0.3% Triton X-100. The resulting cells were incubated in primary antibodies (4°C, overnight) and then in secondary antibodies for 40-60 min. The primary antibodies used were as follows: anti-p53 (1:200; Cell Signaling), anti-IGF1-R (1:250; ab182408; Abcam). The secondary antibodies were Alexa Fluor 488, Alexa Fluor 555, Alexa Fluor 594, and Alexa Fluor 647 (Abcam). Coverslips were mounted on Vectashield containing 4',6-diamidino-2-phenylindole (DAPI) and observed using a confocal microscope (FV3000; OLYMPUS).

[0039] 6. Protein extraction and Western blot analysis HL-1 cardiomyocytes or human tissue samples were lysed in radioimmunoprecipitation assay (RIPA) lysis buffer (Cell Signaling) with the addition of protease and phosphatase inhibitors (Complete Mini and PhosSTOP; Roche) and placed on ice for 5–15 min. The supernatant was centrifuged and the protein concentration of each sample was determined using the bicinchoninic acid method (BCA; Thermo Fisher).

[0040] Protein homogenates were separated in equal amounts by SDS-polyacrylamide gel electrophoresis (SDS-PAGE) and transferred to nitrocellulose membranes. The membranes were blocked in blocking buffer and probed with primary antibodies (overnight at 4°C). The following primary antibodies were used: p53 (2524; Cell Signaling), IGF1-R (1:250; ab182408; Abcam); p62 (1:250; ab109012; Abcam), LC3A / B (1:250; ab62721; Abcam), TUBAB (1:250; ab108629; Abcam), GAPDH (1:250; ab8245; Abcam), β-actin (1:250; ab8226; Abcam).

[0041] The membranes were then incubated with anti-mouse or anti-rabbit secondary antibodies (Abcam). Signals were detected using enhanced chemiluminescence (ECL) detection (Thermo Fisher) and quantified by densitometry.

[0042] 7. Luciferase reporter assay Plasmids overexpressing IGF1-R and carrying wild-type (WT) or mutant (Mut) RIMBP2 CDS were co-transfected into 293T cells using Lipofectamine™ 3000. The activities of firefly luciferase and Renilla luciferase in each well were determined using a dual-luciferase reporter assay kit (Yeasen Biotechnology). The results are presented as the relative activity of firefly luciferase relative to Renilla luciferase. Based on the ratios obtained, the activation of the target reporter gene was compared between the different samples.

[0043] Example 3: Results and Analysis 1. WGCNA identified co-expressed miRNAs.

[0044] like Figure 1 As shown in Figures A and 1B, the present invention identified five modules using weighted gene co-expression network analysis (WGCNA), among which the green module was significantly associated with atrial fibrillation (AF). In this module, the criteria for identifying key miRNAs (GS>0.5 and MM>0.8) were set, and 114 miRNAs were highlighted ( Figure 1 C). To validate the target genes of these miRNAs, three databases—mirdb, miRTarBase, and targetscan—were used and their findings were mutually confirmed. Figure 1 D) shows the relationship between these key microRNAs and their target genes. Further analysis of gene enrichment in the GO (Gene Ontology) database showed that these target genes mainly play a role in key cell cycle transitions, especially the G1 / S and mitotic phases ( Figure 1 E), while KEGG enrichment analysis showed that it is more widely involved in cell cycle and environmental information processing ( Figure 8 ). These findings suggest that these biological processes and pathways may be substantially suppressed in cases of AF and that miRNAs play a role in promoting mRNA degradation, affecting these critical functions.

[0045] 2. Identification of differentially expressed miRNAs The present invention identified 145 differentially expressed miRNAs between AF and SR (Figure 2A). Topological network diagram ( Figure 2 C) shows the upregulated miRNAs ( Figure 2 B) and down-regulated target genes of miRNAs. It is worth noting that GO enrichment analysis showed that the enrichment results of target genes of miRNAs with high expression were consistent with the WGCNA results ( Figure 2 D), while the enrichment of low-expressed target genes of miRNAs is in biological processes such as histone modification ( Figure 2E). In KEGG enrichment analysis, miRNAs pathways were highly enriched and target genes were highly expressed ( Fig. 9 These results suggest that miRNA dysregulation in AF has broad molecular effects that may impact both the pathology and therapeutic approaches of the disease.

[0046] 3. Identification of characteristic genes.

[0047] Through WGCNA and differential analysis, the present invention identified 22 overlapping genes ( Figure 3 A). Subsequently, the inventors used eight machine learning algorithms to train a diagnostic model to distinguish gliomas from normal tissues, thereby identifying the characteristic genes of AF. Figure 3 B) Residual box plot ( Figure 3 C) and ROC curve analysis ( Figure 3 D) all indicate that the model has a high predictive ability. In view of the high accuracy of each algorithm, the present invention selects the 10 most important genes from each algorithm as characteristic genes according to RMSE ( Figure 3 E).

[0048] 4. Hsa-miR-34a-3p is a key gene in the AF group Use a subversion plot to visualize the overlap between different methods ( Figure 4 A). hsa-miR-34a-3p (sequence as shown in SEQ ID NO.1: CAAUCAGCAAGUAUACUGCCCU) was identified as the most critical gene and ranked among the top 10 characteristic genes by 7 algorithms. It is worth noting that hsa-miR-34a-3p was significantly differentially expressed between the AF (atrial fibrillation) group and the SR (sinus rhythm) group ( Figure 4 B). The expression pattern of hsa-miR-34a-3p clearly distinguished the SR group from the AF group, with a diagnostic ROC (Receiver Operating Characteristic) AUC (Area Under The Curve) value of 0.975, which has good sensitivity and specificity. This finding emphasizes the accuracy of the multiple algorithms used above and highlights the benefit of their combined application. Further ROC analysis of hsa-miR-34a-3p was performed to illustrate the expression differences between the AF and SR groups ( Figure 4 C). In the experimental setting of the present invention, HL-1 cells were divided into two groups, one group was subjected to an electric shock model to simulate AF, and the other group was used as an SR group. Total RNA was extracted from both groups and qPCR analysis of miR-34a-3p was performed. The results were consistent with the sequencing data and predictions. The results showed that the expression of miR-34a-3p in the AF group was significantly increased, AF / SR=2.76 / 1 ( Figure 4 D).

[0049] 5. IGF1-R is a target gene of miR-34a-3p and affects atrial fibrillation through the PI3K / AKT / MTOR pathway Eight potential target genes of miR34a-3p were identified by WGCNA: HNRNPU, IGF1-R, TRAM2, HNRNPAB, IGSF3, ZNF711, SDE2, SH3GLB1 and TMEM33. To further study the targets of miR-34a-3p, RNA was extracted from normal HL-1 cells (SR group) and electrically stimulated HL-1 cells (AF group), with four replicates per cell, and analyzed by QPCR. Among them, compared with the SR group, only the mRNA levels of HNRNPU (reduced to 66.7%), IGF1R (reduced to 50.1%) and ZNF711 (reduced to 62.3%) in the AF group cells were significantly reduced, and the reduction in IGF1-R was the largest (reduction of 49.9%). Figure 5 A). In order to further explore potential m6A modification sites, the present invention designed wild-type and mutant IGF1-R luciferase reporter plasmids. In the wild-type IGF1-R construction plasmid, the N6-methyladenosine (A) residue was replaced by a thymine (T) residue.

[0050] As expected, the fluorescence ratio of miR-34a-3p mimic (MCE Catalog No.: HY-R00713 RNA) in the IGF1-R wild-type group (IGF1-R-WT) was significantly reduced to 71.9% compared with the negative control mimic. In contrast, the fluorescence ratio after treatment with miR-34a-3p mimic did not change in the IGF1R mutant group (IGF1-R-MT) relative to the control group. Therefore, IGF1-R is a confirmed target of miR-34a-3p ( Figure 5 B). In the AF group (HL-1 cells with simulated electric shock), the expression of IGF1-R protein was significantly higher than that in the SR group (HL-1 cells cultured normally). The levels of TUBAB protein and P53 protein, the specific markers of atrial fibrillation, were also significantly increased ( Figure 5 C). In the cell culture experiment, the cells were divided into two groups by immunofluorescence staining analysis: SR group and SR+miR-34a-3p mimics (50 nM added) group. Among them, the expression of IGF1-R protein in the SR+miR-34a-3p mimics group was lower ( Figure 5 D) In ​​vitro, HL-1 cells were divided into the following groups (1) to (5): (1) SR group means that HL-1 cells were not stimulated by electric shock; (2) AF group means HL-1 cells were electrically stimulated at 6 V and 3 Hz for 8 h; (3) AF+si-NC group means HL-1 cells were electrically stimulated at 6 V and 3 Hz for 8 h + culture medium (DMEM+10% FBS+1% P / S, purchased from Wuhan Shanen Biotechnology Co., Ltd., catalog number: SNLM-319, unless otherwise specified, the culture medium described below has the same composition) + si-NC (MCE Company, catalog number: HY-150150) 100 nM; (4) AF+miR-34a-3p-mimetic group: HL-1 cells were electrically stimulated at 6 V and 3 Hz for 8 h + culture medium + miR-34a-3p-mimetic (MCE, catalog number: HY-R00713) 50 nM; (5) AF+miR-34a-3p-inhibitor group: HL-1 cells were electrically stimulated at 6 V and 3 Hz for 8 h, and then cultured with culture medium and 50 nM miR-34a-3p-inhibitor (MCE, catalog number: HY-RI00713).

[0051] Western blot analysis showed that IGF1-R expression increased in HL-1 cells after AF modeling. However, this increase was reversed after the addition of AF+miR-34a-3p-mimics, whereas IGF1-R levels increased after the addition of AF+miR-34a-3p-inhibitors. Notably, the expression of the AF marker TUBAB reflected the trend of IGF1-R expression ( Figure 5 E).

[0052] Further studies on the molecular mechanism of miR-34a-3p / IGF1-R affecting the pathogenesis of atrial fibrillation showed that the previously discovered IGF1R that regulates liver cancer autophagy through the PI3K / AKT / MTOR pathway was divided into the following groups in HL-1 cells: (1) SR group means that HL-1 cells were not stimulated by electric shock; (2) AF group means HL-1 cells were electrically stimulated at 6 V and 3 Hz for 8 h; (3) AF+si-NC group means HL-1 cells were electrically stimulated at 6 V and 3 Hz for 8 h + culture medium + si-NC 100 nM; (4) AF+si-IGF1R group means HL-1 cells were electrically stimulated at 6 V and 3 Hz for 8 h + culture medium + si-IGF1R (MCE Company, catalog number: HY-RS06616) 100 nM; (5) AF+si-P53 group means HL-1 cells were electrically stimulated at 6 V and 3 Hz for 8 h + culture medium + si-P53 (MCE Company, catalog number: HY-132595A) 150 nM; (6) AF+miRNA-NC group means HL-1 cells were electrically stimulated at 6 V and 3 Hz for 8 h + culture medium + si-miRNA-NC (MCE Company, catalog number: HY-150150) 50 nM; (7) AF+miR-34a-3p-mimetic group: HL-1 cells were electrically stimulated at 6 V and 3 Hz for 8 h, followed by culture medium and 50 nM miR-34a-3p-mimetic.

[0053] Western blot analysis showed that AF increased the phosphorylation level of the PI3K / AKT / MTOR pathway. This effect was enhanced in the AF+si-P53 group and weakened in the AF+si-IGF1R group and the AF+miR-34a-3p-mimic group. Therefore, the phosphorylation level of the PI3K / AKT / MTOR pathway seems to be positively correlated with IGF1R protein expression, and the miR-34a-3p / IGF1R axis mediates the above changes by regulating pathway phosphorylation ( Figure 5 F).

[0054] 6. P53 / miR-34a-3p / IGF1R affects the autophagy level in atrial fibrillation To investigate the relationship between the miR-34a-3p / IGF1R axis and autophagy, HL-1 cells were divided into the following groups (1) to (11): (1) SR group means that HL-1 cells were not stimulated by electric shock; (2) SR+miRNA-NC group means that HL-1 cells were not stimulated by electric shock; (3) SR+miR-34a-3p-mimics group means HL-1 cells were not stimulated by electric shock + culture medium + miR-34a-3p-mimics 100 nM; (4) SR+miR-34a-3p-inhibitor group means HL-1 cells were not subjected to electric shock stimulation + culture medium + miR-34a-3p-inhibitor 100 nM; (5) SR+3-methyladenosine group means that HL-1 cells were not stimulated by electric shock + 3-methyladenosine 40 nM; (6) AF group means HL-1 cells were electrically stimulated at 6 V and 3 Hz for 8 h; (7) AF+miRNA-NC group: HL-1 cells were electrically stimulated at 6 V and 3 Hz for 8 h, plus culture medium and miRNA-NC (MicroRNA Agomir Negative Control, MCE, catalog number: HY-R04602A) 100 nM; (8) AF+miR-34a-3p-mimics group means HL-1 cells were electrically stimulated at 6 V and 3 Hz for 8 h + culture medium + miR-34a-3p-mimics 100 nM; (9) AF+miR-34a-3p-inhibitor group means HL-1 cells were electrically stimulated at 6 V and 3 Hz for 8 h + culture medium + miR-34a-3p-inhibitor 100 nM; (10) AF+rapamycin group means HL-1 cells were electrically stimulated at 6 V and 3 Hz for 8 h + culture medium + rapamycin 60 nM; (11) AF+3-methyladenosine group means that HL-1 cells were electrically stimulated at 6 V and 3 Hz for 8 h, followed by culture medium + 40 nM 3-methyladenosine.

[0055] Western blot analysis showed that compared with the SR group, the expression of autophagy marker protein P62 in the AF group was increased and the LC3II / LC3I ratio was decreased, indicating that the level of autophagy in HL-1 cells of the atrial fibrillation model was reduced. This pattern is consistent with the observations in the 3-methyladenosine treatment group, in which the level of autophagy also decreased during AF.

[0056] In the SR group, the introduction of miR-34a-3p-mimic resulted in increased P62 levels and decreased LC3II / LC3I ratio, also indicating decreased autophagy. This effect was consistent with 3-methyladenine treatment. In contrast, treatment with mir-34a-3p-inhibitor resulted in decreased P62 levels and increased LC3II / LC3I ratio, indicating enhanced autophagy.

[0057] In the mock-recovery (SR) group, the miR-34a-3p mimic mimicked the effects of the autophagy inhibitor 3-methyladenine, suggesting that miR-34a-3p may play a role in downregulating autophagy. Similarly, in the atrial fibrillation (AF) group treated with the miR-34a-3p mimic, P62 levels increased and the LC3II / LC3I ratio decreased, echoing the effects observed with 3-methyladenosine treatment in the same model. In contrast, AF+miR-34a-3p inhibitor treatment decreased P62 expression and increased the LC3II / LC3I ratio, a result suggesting that inhibition of miR-34a-3p enhanced autophagy, similar to the effects of the autophagy activator rapamycin.

[0058] Interestingly, treatment with miR-34a-3p mimics also resulted in decreased P53 expression in the AF model, suggesting a potential negative feedback loop between P53 and miR-34a-3p.

[0059] To further explore, 6-week-old C57 mice were used as experimental subjects, and acetylcholine (Ach, 66μg / ml) and calcium chloride (CaCl2, 10mg / kg) were administered through the tail vein to induce AF model. The AF model mice were divided into 4 groups (6 mice in each group): saline-treated SR group, AF group, AF + miRNA-NC group, and AF + miR-34a-3p inhibitor group. Western blot analysis showed that compared with the SR group, the autophagy level in the AF group was decreased, the LC3II / LC3I ratio was decreased, and P62 was increased. Compared with the AF group, no significant changes were observed in the LC3II / LC3I or P62 levels in the AF+miRNA-NC group. However, the AF+miR-34a-3p-inhibitor group showed a decrease in P62 level and an increase in the LC3II / LC3I ratio, indicating enhanced autophagy.

[0060] IGF1R immunofluorescence staining was performed on the left atrial tissues of the above four groups of mice, and it was observed that the expression of IGF1R in the atrial fibrillation (AF) group was higher than that in the sinus rhythm (SR) group. There was no significant difference in IGF1R expression between the AF group and the AF+miRNA-NC group. It is worth noting that after treatment with miR-34a-3p inhibitor, the level of IGF1R was significantly increased. This suggests that although IGF1R expression increases during AF, p53-induced miR-34a-3p appears to alleviate this increase. miR-34a-3p mimics can further amplify the expression of IGF1R (see Figure 6C). Starting from the 4th week of modeling, the electrocardiograms of mice in each group were recorded every day. By the 6th week, the results were as follows: the SR group maintained sinus rhythm; the AF group and the AF+miRNA-NC group both developed atrial fibrillation; the AF+mir-34a-3p inhibitor group also developed atrial fibrillation, but the severity was reduced compared with the AF group (see Figure 6 D).

[0061] 7. P53 / miR-34a-3p / IGF1R affects the occurrence and prognosis of atrial fibrillation In order to verify the above conclusions, the present invention also collected left atrial tissue from patients undergoing mitral valve bioreplacement surgery for verification. A total of 20 cases in the AF group and 20 cases in the SR group were collected. The baseline conditions of the two groups were similar, and the surgical method was the same, namely biological mitral valve replacement. Before the operation, an electrocardiogram was performed on each patient, and the patient was divided into two groups according to whether the patient had atrial fibrillation or not. The average duration of atrial fibrillation in the atrial fibrillation group was about 11.8 months, and all patients underwent radiofrequency ablation of atrial fibrillation during the operation. The left auricle tissue removed during the operation was collected, and WB, QRT-PCR and immunofluorescence detection were performed, primary atrial myocytes were extracted for culture, and the obtained cells were subjected to immunofluorescence detection.

[0062] The results showed that compared with the SR group, the expression of miR-34a-3p in the left atrial tissue of the AF group was significantly increased, AF / SR=1.81 (see Figure 7 C), and miR-34a-3p is mainly concentrated in the cytoplasm (see Figure 7 D).

[0063] WB images showed that the expression of P53 protein was significantly increased in the atrial fibrillation group (AF), which has been confirmed in previous studies. At the same time, the expression levels of IGF1R and TUBAB were significantly increased in the AF group (see Figure 7 A). This indicates that the expression of IGF1R increases significantly during the onset of atrial fibrillation, which is consistent with the results of previous cell and animal experiments on atrial fibrillation. The same conclusion can be drawn when observing autophagy indicators: the increase in the expression level of P62 protein and the ratio of LC3I / LC3II in the atrial fibrillation group is a manifestation of decreased autophagy level (see Figure 7 B).

[0064] IGF1R immunofluorescence staining was performed on the primary cells of the left atrium of the two groups, and it was observed that the expression of IGF1R in the atrial fibrillation (AF) group was higher than that in the sinus rhythm (SR) group (see Figure 7 E).

[0065] In summary, the regulatory relationship of the P53 / miR-34a-3p / IGF1R axis may have a similar regulatory relationship in clinical samples.

[0066] In order to explore the relationship between the expression of miR-34a-3p in left atrial tissue and the prognosis of patients with atrial fibrillation (AF), the present invention further conducted a long-term follow-up study on these postoperative patients and expanded the sample size for observation. Follow-up evaluation was performed at 3 months, 6 months, 9 months, 12 months and 24 months after surgery.

[0067] in conclusion: In summary, the present invention's study of the role of the P53 / miR-34a-3p / IGF1R axis in the regulation of autophagy in atrial fibrillation (AF) reveals a complex interaction between molecular pathways that significantly affects cardiac homeostasis and the progression of the disease. The present invention's experiments and results analysis reveal the key regulatory mechanisms of autophagy in atrial fibrillation, providing important directions for potential therapeutic strategies for this common arrhythmia.

[0068] The experimental data presented here specifically highlight the dysregulation of P53 in AF, with significant elevations in affected cardiac tissue. P53 is primarily considered a tumor suppressor gene that is integral to a variety of cellular functions, including apoptosis, cell cycle control, and DNA repair. In AF, elevated levels of P53 may indicate cellular stress and dysfunction, leading to the pathological remodeling observed in atrial myocytes.

[0069] Furthermore, the present study revealed the downstream effects of P53 dysregulation, particularly its role in enhancing miR-34a-3p expression. MiRNAs such as miR-34a-3p are crucial in post-transcriptional gene regulation, targeting specific miRNAs for degradation or translational repression. In AF, elevated miR-34a-3p levels appear to accelerate the degradation of IGF1R mRNA, thereby affecting the expression and function of insulin-like growth factor 1 receptor (IGF1R), a transmembrane receptor tyrosine kinase involved in a variety of cellular processes including growth, proliferation, and survival.

[0070] The present study shows that the dysregulation of IGF1R in atrial fibrillation (AF) regulates autophagy through the PI3K / AKT / mTOR signaling pathway. This pathway plays a key role in the regulation of autophagy: the activation of mTOR inhibits the autophagic process, while its inhibition promotes the autophagic process.

[0071] Furthermore, the present findings identify a mechanistic link between disruption of the P53 / miR-34a-3p / IGF1R axis and abnormal autophagy in AF. Elevated P53 levels enhance miR-34a-3p expression, which in turn targets IGF1R mRNA for degradation. This degradation leads to impaired IGF1R signaling and subsequent dysregulation of autophagy. This dysregulation may contribute to the pathological remodeling and electrical instability characteristic of AF.

[0072] Crucially, the results of the present invention have important clinical implications for the treatment of atrial fibrillation. By describing the molecular mechanisms of autophagy dysregulation in atrial fibrillation, the present study supports the development of targeted therapies aimed at restoring autophagy balance and slowing the progression of atrial fibrillation. Targeting components of the P53 / miR-34a-3p / IGF1R axis or modulating downstream signaling pathways such as PI3K / AKT / mTOR provides a promising therapeutic approach.

[0073] In conclusion, our study elucidates the complex interplay between the P53 / miR-34a-3p / IGF1R axis and autophagy dysregulation in atrial fibrillation (AF). By describing the underlying molecular mechanisms in detail, this study not only highlights potential therapeutic targets but also lays the foundation for future research and clinical interventions to manage this challenging arrhythmia.

[0074] The above description is only a preferred embodiment of the present invention and does not limit the present invention in any form. Although the present invention has been disclosed as a preferred embodiment as above, it is not used to limit the present invention. Any technician familiar with this profession can make some changes or modifications to equivalent embodiments of equivalent changes by using the methods and technical contents disclosed above without departing from the scope of the technical solution of the present invention. However, any simple modification, equivalent change and modification made to the above embodiments according to the technical essence of the present invention without departing from the content of the technical solution of the present invention still fall within the scope of the technical solution of the present invention.

Claims

1. A miRNA marker for detecting atrial fibrillation, characterized in that: The marker is hsa-miR-34a-3p, and the nucleotide sequence of hsa-miR-34a-3p is shown in SEQ ID NO.

1.

2. The miRNA marker according to claim 1, characterized in that The expression of the marker hsa-miR-34a-3p was increased in the serum and atrial tissue of patients with atrial fibrillation.

3. Use of the miRNA marker for detecting atrial fibrillation according to claim 1 in the preparation of a product for diagnosis, prognosis, prevention or treatment of atrial fibrillation.

4. Use of the miRNA marker for detecting atrial fibrillation according to claim 1 in the preparation of a pharmaceutical composition for preventing and / or treating atrial fibrillation.

5. The use according to claim 4, characterized in that: The pharmaceutical composition comprises an hsa-miR-34a-3p inhibitor.

6. The use according to claim 5, characterized in that: The hsa-miR-34a-3p inhibitor can inhibit the expression of hsa-miR-34a-3p or can inhibit the function of hsa-miR-34a-3p.

7. A pharmaceutical composition for preventing and / or treating atrial fibrillation, characterized in that: The pharmaceutical composition comprises an hsa-miR-34a-3p inhibitor and a pharmaceutically acceptable carrier.

8. The pharmaceutical composition according to claim 7, characterized in that The pharmaceutical composition may further comprise other agents for inhibiting or treating atrial fibrillation.

9. Use of the miRNA marker for detecting atrial fibrillation according to claim 1 in preparing an atrial fibrillation diagnostic kit.

10. A kit for diagnosing atrial fibrillation, characterized in that: The kit comprises a reagent for detecting the expression level of the miRNA marker according to claim 1.

11. The kit according to claim 10, characterized in that The reagent comprises a primer pair for specifically amplifying the miRNA marker and instructions, wherein the primer pair comprises a forward primer having a nucleotide sequence as shown in SEQ ID NO.2 and a reverse primer having a nucleotide sequence as shown in SEQ ID NO.3.

Images