PRX gene, application thereof and peroxidase protein

Abstract

The invention discloses a PRX gene, application thereof and peroxidase protein, and relates to the field of type III peroxidase and application thereof, and the peroxidase protein coded by the PRX gene screened by a dry water database transcriptome can participate in the synthesis process of lignin in citrus peel. The PRX gene CgPRX24 / CgPRX41 / CgPRX65 can participate in the synthesis process of lignin in citrus peel, the hardness of the citrus peel is promoted, and meanwhile, the PRX gene CgPRX24 / CgPRX41 / CgPRX65 can be used as a gene target for genetic engineering and biological preservation of citrus, so that the purpose of improving the peel texture in the postharvest storage process is achieved.

Description

Technical Field

[0001] The present invention relates to type III peroxidase and its application field, in particular to a PRX gene and its application and a peroxidase protein. Background Art

[0002] The cytological changes that occur during citrus fruit ripening and aging primarily include loosening of the cell wall structure and degradation of chloroplasts. During the young fruit stage, the primary cell walls and intercellular lamellae of fruit cells contain large amounts of pectin, cellulose, and other polysaccharides. During postharvest storage, the cell walls undergo deesterification and depolymerization reactions catalyzed by various enzymes, converting insoluble pectin, cellulose, and hemicellulose into soluble components. This loosens the tight cell walls, softening the fruit peel and making the fruit more susceptible to infection by pathogens, seriously affecting its edibility and commercial value.

[0003] Lignin is the second largest phenolic molecular polymer on Earth after cellulose, accounting for approximately 30% of the organic carbon in the biosphere. Lignin is primarily deposited in the secondary walls of certain plant tissues, including xylem, sclerenchyma, and bast fibers. Lignin, along with cellulose and hemicellulose, is the primary component of secondary cell walls. The presence of lignin significantly enhances the mechanical strength, hydrophobicity, and resistance of plant cell walls to adverse environments. Therefore, identifying key genes for lignin synthesis could alleviate the softening of citrus peel after harvest. Citrus drought is typically characterized by the abnormal accumulation of lignin. Using the drought transcriptome database, we can effectively identify functional genes related to lignin, providing biological targets for improving the postharvest texture of citrus.

[0004] In the model plant Arabidopsis thaliana, lignin synthesis involves both monomer synthesis and monomer polymerization. The PRX family is primarily involved in the monomer polymerization pathway. Nine PRX genes have been reported to participate in lignin synthesis in Arabidopsis thaliana, and three in poplar. Because the regulation of lignification in fleshy fruit parenchyma cells differs from that in vascular tissue, only FaPRX27 in strawberry and EjPRX12 in loquat have been shown to participate in the lignin polymerization pathway in fleshy fruit. Whether PRX genes participate in the lignin synthesis pathway in other fruits remains unknown. Therefore, studying the role of PRX genes in citrus fruit can enrich the pathways of fruit lignin synthesis. Summary of the Invention

[0005] The purpose of the present invention is to provide a PRX gene and its application and a peroxidase protein to solve the problem of softening of citrus peel after harvest in the prior art.

[0006] First, an embodiment of the present invention provides a PRX gene, and the peroxidase protein encoded by the PRX gene can participate in the synthesis of lignin in citrus peel.

[0007] Optionally, the PRX gene includes at least one of the CgPRX24 gene, the CgPRX41 gene, and the CgPRX65 gene;

[0008] The nucleotide sequence of the CgPRX24 gene is SEQ ID No. 1;

[0009] The nucleotide sequence of the CgPRX41 gene is SEQ ID No. 2;

[0010] The nucleotide sequence of the CgPRX65 gene is SEQ ID No. 3.

[0011] Secondly, in order to better solve the above problems, an embodiment of the present invention further provides an application of a PRX gene, comprising the following steps:

[0012] S1: Clone the coding sequences of citrus CgPRX24 and / or CgPRX41 and / or CgPRX65;

[0013] S2: cloning the coding sequence into a vector capable of expressing in plant cells to construct an overexpression vector;

[0014] S3: transforming the overexpression vector into citrus peel cells to obtain transient transformation samples.

[0015] Optionally, the method for cloning the coding sequence of citrus CgPRX24 and / or CgPRX41 and / or CgPRX65 described in S1 comprises:

[0016] Total RNA was extracted from citrus and reverse transcribed into cDNA as a template;

[0017] PCR amplification was performed using primer pairs OE-CgPRX24-F and OE-CgPRX24-R and / or OE-CgPRX41-F and OE-CgPRX41-R and / or OE-CgPRX65-F and OE-CgPRX65-R;

[0018] The PCR amplification products are recovered to obtain DNA fragments encoding sequences of CgPRX24 and / or CgPRX41 and / or CgPRX65.

[0019] Optionally, the method for constructing an overexpression vector in S2 includes:

[0020] The recovered CgPRX24 and / or CgPRX41 and / or CgPRX65 coding sequence DNA fragments were digested with restriction enzymes KpnI and PstI;

[0021] The digested DNA fragments were ligated to the vector pCAMBIA2300 recovered by digestion with KpnI and PstI to construct overexpression vectors pCAMBIA2300-CgPRX24 and / or pCAMBIA2300-CgPRX41 and / or pCAMBIA2300-CgPRX65.

[0022] Optionally, the method of transforming the overexpression vector into citrus peel cells in S3 includes:

[0023] The overexpression vectors pCAMBIA2300-CgPRX24 and / or pCAMBIA2300-CgPRX41 and / or pCAMBIA2300-CgPRX65 were transformed into Agrobacterium tumefaciens by heat shock method;

[0024] The overexpression vector is transformed into citrus peel cells using Agrobacterium tumefaciens-mediated transformation technology.

[0025] Optionally, the nucleotide sequence of primer OE-CgPRX24-F is SEQ ID No. 4;

[0026] The nucleotide sequence of primer OE-CgPRX41-F is SEQ ID No. 5;

[0027] The nucleotide sequence of primer OE-CgPRX65-F is SEQ ID No. 6;

[0028] The nucleotide sequence of primer OE-CgPRX24-R is SEQ ID No. 7;

[0029] The nucleotide sequence of primer OE-CgPRX41-R is SEQ ID No. 8;

[0030] The nucleotide sequence of primer OE-CgPRX65-R is SEQ ID No.9.

[0031] Optionally, the transient transformation samples are used to study the functions of CgPRX24 and / or CgPRX41 and / or CgPRX65 genes in lignin synthesis in citrus peel.

[0032] Optionally, the method for studying the function of CgPRX24 and / or CgPRX41 and / or CgPRX65 genes in citrus peel lignin synthesis comprises:

[0033] qRT-PCR was used to detect the overexpression levels of CgPRX24 and / or CgPRX41 and / or CgPRX65 genes, and the primer pairs were RT-CgPRX24-F and RT-CgPRX24-R and / or RT-CgPRX41-F and RT-CgPRX41-R and / or RT-CgPRX65-F and RT-CgPRX65-R;

[0034] PRX enzyme activity assay was performed to verify the activity of peroxidase protein;

[0035] Determination of the hardness of citrus peel and determination of the lignin content of citrus peel;

[0036] Among them, the nucleotide sequence of primer RT-CgPRX24-F is SEQ ID No. 10;

[0037] The nucleotide sequence of primer RT-CgPRX41-F is SEQ ID No. 11;

[0038] The nucleotide sequence of primer RT-CgPRX65-F is SEQ ID No. 12;

[0039] The nucleotide sequence of primer RT-CgPRX24-R is SEQ ID No. 13;

[0040] The nucleotide sequence of primer RT-CgPRX41-R is SEQ ID No. 14;

[0041] The nucleotide sequence of primer RT-CgPRX65-R is SEQ ID No.15.

[0042] Finally, an embodiment of the present invention further provides a peroxidase protein, which is encoded by one of the above-mentioned PRX genes and is used to participate in the synthesis of lignin in citrus peel.

[0043] Compared with the prior art, the embodiments of the present invention have the following advantages and beneficial effects:

[0044] 1. The PRX gene provided in the embodiment of the present invention, the peroxidase protein (CgPRX24 / CgPRX41 / CgPRX65) encoded by the PRX gene can participate in the synthesis of lignin in citrus peel, thereby increasing the hardness of the citrus peel.

[0045] 2. In the present invention, the coding sequences of citrus CgPRX24 / CgPRX41 / CgPRX65 were cloned, an overexpression vector was constructed, and then the citrus peel was transiently transformed to increase the hardness of the citrus peel by promoting the lignin content of the peel. This shows that the CgPRX24 / CgPRX41 / CgPRX65 genes can be used as gene targets for genetic engineering and improved breeding of citrus to improve the texture quality of the fruit. BRIEF DESCRIPTION OF THE DRAWINGS

[0046] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the following briefly introduces the drawings required for use in the embodiments. It should be understood that the following drawings only illustrate certain embodiments of the present invention and therefore should not be regarded as limiting the scope. For ordinary technicians in this field, other relevant drawings can be obtained based on these drawings without paying any creative work.

[0047] Figure 1 This is the chromosomal location map of the PRX gene family in pomelo;

[0048] Figure 2 The protein structure and gene structure diagram of the PRX gene family of pomelo, Figure 2 A is the protein structure diagram of the PRX gene family in pomelo. Figure 2 B is the gene structure diagram of the PRX gene family in pomelo;

[0049] Figure 3 This is the gene expression analysis diagram of the PRX gene family in pomelo during different dry growing seasons;

[0050] Figure 4 Schematic diagram for the construction of CgPRX24 / CgPRX41 / CgPRX65 into pCAMBIA2300;

[0051] Figure 5 is the correlation diagram of gene CgPRX24, where Figure 5 A is the phenotype of CgPRX24 transiently overexpressed in pomelo fruit. Figure 5 B is the gene expression level diagram after transient overexpression of CgPRX24 in pomelo fruit. Figure 5 C is the graph showing the changes in PRX enzyme activity after transient overexpression of CgPRX24 in pomelo fruit. Figure 5 D is the change in firmness of pomelo fruit after transient overexpression of CgPRX24. Figure 5 E is the lignin content after transient overexpression of CgPRX24 in pomelo fruit. Figure 5 F is the phenotype of CgPRX24 transiently overexpressed in sweet orange fruit. Figure 5 G is the gene expression level diagram after transient overexpression of CgPRX24 in sweet orange fruit. Figure 5 H is the graph showing the changes in PRX enzyme activity after transient overexpression of CgPRX24 in sweet orange fruit. Figure 5 I is a graph showing changes in firmness of sweet orange fruit after transient overexpression of CgPRX24. Figure 5 J is the lignin content after transient overexpression of CgPRX24 in sweet orange fruit;

[0052] Figure 6 is the correlation diagram of gene CgPRX41, where Figure 6 A is the phenotype of CgPRX41 transiently overexpressed in pomelo fruit. Figure 6 B is the gene expression level diagram after transient overexpression of CgPRX41 in pomelo fruit. Figure 6 C is the graph showing the changes in PRX enzyme activity after transient overexpression of CgPRX41 in pomelo fruit. Figure 6 D is the change in firmness of pomelo fruit after transient overexpression of CgPRX41. Figure 6 E is the lignin content after transient overexpression of CgPRX41 in pomelo fruit. Figure 6 F is the phenotype of CgPRX41 transiently overexpressed in sweet orange fruit. Figure 6 G is the gene expression level diagram after transient overexpression of CgPRX41 in sweet orange fruit. Figure 6 H is the graph showing the changes in PRX enzyme activity after transient overexpression of CgPRX41 in sweet orange fruit. Figure 6 I is a graph showing changes in firmness of sweet orange fruit after transient overexpression of CgPRX41. Figure 6 J is a graph showing the lignin content after transient overexpression of CgPRX41 in sweet orange fruit;

[0053] Figure 7 is the correlation diagram of gene CgPRX65, where Figure 7 A is the phenotype of CgPRX65 transiently overexpressed in pomelo fruit. Figure 7 B is the gene expression level diagram after transient overexpression of CgPRX65 in pomelo fruit. Figure 7 C is the graph showing the changes in PRX enzyme activity after transient overexpression of CgPRX65 in pomelo fruit. Figure 7 D is the change in firmness of pomelo fruit after transient overexpression of CgPRX65. Figure 7 E is the lignin content after transient overexpression of CgPRX65 in pomelo fruit. Figure 7 F is the phenotype of CgPRX65 transiently overexpressed in sweet orange fruit. Figure 7 G is the gene expression level diagram after transient overexpression of CgPRX65 in sweet orange fruit. Figure 7 H is the graph showing the changes in PRX enzyme activity after transient overexpression of CgPRX65 in sweet orange fruit. Figure 7 I is a graph showing changes in firmness of sweet orange fruit after transient overexpression of CgPRX65. Figure 7 J is a graph showing the lignin content after transient overexpression of CgPRX65 in sweet orange fruit. DETAILED DESCRIPTION

[0054] To make the objectives, technical solutions, and advantages of the embodiments of the present invention more clear, the technical solutions of the embodiments of the present invention will be clearly and completely described below in conjunction with the accompanying drawings of the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Generally, the components of the embodiments of the present invention described and shown in the drawings herein can be arranged and designed in various different configurations.

[0055] Therefore, the following detailed description of the embodiments of the present invention provided in the accompanying drawings is not intended to limit the scope of the invention as claimed, but rather merely represents selected embodiments of the present invention. All other embodiments derived by persons of ordinary skill in the art based on the embodiments of the present invention without creative effort are intended to fall within the scope of protection of the present invention.

[0056] It should be noted that similar reference numerals and letters denote similar items in the following drawings, and therefore, once an item is defined in one drawing, it does not need to be further defined or explained in subsequent drawings.

[0057] In the description of the present invention, it should be noted that the terms "first", "second", "third", etc. are only used to distinguish the description and cannot be understood as indicating or implying relative importance.

[0058] Example

[0059] The purpose of the present invention is to identify the key PRX gene involved in lignin synthesis during the dry season, enrich the molecular mechanism of citrus lignification, and provide a targeted gene target for texture modification of citrus varieties. An application of a PRX gene is provided, and the specific experimental method is as follows:

[0060] 1. Genome-wide bioinformatics identification of the PRX gene family

[0061] To identify members of the type III PRX gene family in the citrus genome, we first obtained the amino acid sequences of all type III PRX genes from the Arabidopsis gene database TAIR11 (https: / / www.arabidopsis.org) as queries, and used the protein sequences of the pomelo (Citrus grandis Osbeck.cv.'Wanbaiyou'v1.0) genome as a database. We used local Blastp analysis, and sequences with e-value > 1e-4 were identified as potential PRX genes. Further Pfam analysis confirmed that it had a conserved RPX domain (Pfam ID: PF00141). The generated citrus PRX sequence was used as a query, and the Arabidopsis database was blasted to confirm whether the identified gene was correct based on whether the Arabidopsis gene with the highest homology was a type III PRX family gene. Based on the identification results of the type III PRX gene family, TBtools was used to display the chromosome location, protein structure, and gene structure of the citrus gene family members. Figure 1 and Figure 2 As shown, a total of 88 PRXs were identified in pomelo, all of which had the conserved structure of peroxidases.

[0062] 2. Sampling of citrus fruits and dry sap cells

[0063] Red-fleshed pomelo fruit (Citrus grandis) for citrus juice sac dry water data analysis: Sampling was carried out in 2018, 2021, and 2022. The pomelo fruit was picked after it was fully mature (TSS greater than 10%). After picking, it was sterilized with prochloraz and air-dried. The individual fruits were bagged and placed in a cold storage. The storage conditions were 8-10°C and 80-85% relative humidity. After 70 days of storage, at least 50 fruits were selected, and normal juice sacs and dry juice sacs were sampled from them and frozen at -80°C. Normal and dry juice sacs of pomelo fruits with similar sugar and acid content, uniform size and shape were sampled and then stored in a -80°C refrigerator for RNA-Seq analysis. Figure 3 As shown in the figure, the expression levels of CgPRX24 and CgPRX41 showed an increasing trend in three growing seasons, and the expression level of CgPRX65 was significantly upregulated in one growing season.

[0064] 3. RNA extraction and cDNA synthesis

[0065] Total RNA was extracted from citrus juice cells using a plant total RNA extraction kit (Acryl, Cat: AG21101), RNA quality was verified by agarose gel electrophoresis, and its concentration was determined by ultra-micro nucleic acid quantification. cDNA was synthesized using the EvoM-MLV Reverse Transcription Kit (Acryl, Cat: AG11734).

[0066] 4. PCR amplification of CgPRX24 / CgPRX41 / CgPRX65 coding sequences

[0067] The primers OE-CgPRX24-F (SEQ ID No. 4) / OE-CgPRX41-F (SEQ ID No. 5) /

[0068] OE-CgPRX65-F (SEQ ID No. 6) and OE-CgPRX24-R (SEQ ID No. 7) / OE-CgPRX41-R (SEQ ID No. 8) / OE-CgPRX65-R (SEQ ID No. 9) and high-fidelity enzyme

[0069] PhantaMax Super-Fidelity DNA Polymerase (Novizan, CAT: P505) was used to amplify the CgPRX24 / CgPRX41 / CgPRX65 coding sequence DNA fragments from citrus cDNA. The fragment lengths were 1047 bp, 1008 bp, and 939 bp (including the enzyme cleavage site), respectively (refer to Figure 4 ), the amplified DNA fragment was sequenced and confirmed to be citrus

[0070] The coding sequence of CgPRX24 / CgPRX41 / CgPRX65 gene is (SEQ ID No. 1) / (SEQ ID No. 2) / (SEQ ID No. 3). Under ultraviolet light, a clean blade was used to cut out the agarose gel containing the target fragment, and the DNA fragment was recovered using a kit (Acrolein, CAT: AG21005).

[0071] PCR amplification program: 98°C, 30s; 98°C, 10s, 64°C, 30s, 72°C, 1min, 35 cycles; extension at 72°C for 5min.

[0072] The nucleotide coding sequences of the citrus CgPRX24, CgPRX41, and CgPRX65 genes are shown as follows:

[0073] SEQ ID No. 1:

[0074]

[0075] SEQ ID No.2:

[0076]

[0077] SEQ ID No.3:

[0078] ATGGCTGTGACATCAGTTCATTGCCAAGCAGGGACTCGTGTTGGATTTTATTCAAGGTCATGTCCTCGAGCTGAGTCCATAGTTAAGTCTACGGTTCAGGCTCATTTCAGGTCTGATCCCACAGTTGCTCCTGGGTTACTGAGGATGCATTTTCATGACTGTTTTGTCCACGGCTGTGATGCTTCCATTCTCATTAATGGCCCCAACACTGAGAAAACTGCACCACCCAACCGTCTGTTGAGAGGATATGATGTAATTGATGATGCCAAATCCCAGATTGAGGCTGCATGTCCTGGCATCGTCTCTTGCGCTGACATTCTTGCCCTCGCCGCCCGTGATTCTGTCGTCGTGACAAGAGGAATAAGTTGGCAAGTGCCCACAGGACGCAGAGATGGCAGGATATCATTGGCATCCGATACTGCCAATCTTCCAGGTTTCACCGAGTCTGTTGAAGCGCAAAAGCAAAAGTTTCTTGACAAGGGTTTGAACACTCAGGATCTTGTTACTCTTGTTGGAGCACATACAATCGGTACTACAGCTTGCCAAATATTTAAGTACAGACTTTATAACTTCACTACAACAACAGCAACAGGAGCTGATCCAACCATAGACGCTACGTTCATTCCTCAACTCCGTGCACTCTGTCCGGAGAACGGTGACGGAGCAAGGCGCGTTGCACTTGACACCGGTAGCCCTAATCGATTCGACACGTCCTTCTTCTCGAATTTGAGAAACGGGCGGGGAGTGCTAGAGTCTGATCAGAAGCTATGGAGTGATGCTTCTACTAAAGCGGTCGTGCAAAGGTTCTTGGGTGTGAGAGGATTGCTAGGGCTGACCTTCAATGTGGAGTTTGGAAGATCCATGGTTAAAATGAGTAACATTGGCGTCAAGACTGGCACTGATGGTGAAATTCGCAAAATATGTTCCGCAATTAACTAA

[0079] The nucleotide sequences of primers OE-CgPRX24-F, OE-CgPRX41-F, and OE-CgPRX65-F, SEQ ID No. 4, SEQ ID No. 5, and SEQ ID No. 6, are shown below:

[0080] SEQ ID No.4: actattctagggtaccATGGCTTCACTTCGTTATCTTCTTG

[0081] SEQ ID No.5: actattctagggtaccATGGGTACGAAAGCTGTCTTCTT

[0082] SEQ ID No.6: actattctagggtaccATGGAGGGTGCTTTTGCAGTAC

[0083] The nucleotide sequences of primers OE-CgPRX24-R, OE-CgPRX41-R and OE-CgPRX65-R are SEQ ID No.7, SEQ ID No.8 and SEQ ID No.9 as shown below:

[0084] SEQ ID No.7: ggtatctagactgcagGAAAGAGCTGACCAAATCACCC

[0085] SEQ ID No.8: ggtatctagactgcagGGACTTGTCGTGGAGCTTGTT

[0086] SEQ ID No.9: ggtatctagactgcagGTTAATTGCGGAACATATTTTGCGA

[0087] 5. Construction of CgPRX24 / CgPRX41 / CgPRX65 overexpression vector

[0088] The CgPRX24 / CgPRX41 / CgPRX65 coding sequence DNA fragment and the overexpression vector pCAMBIA2300 were double-digested with restriction endonucleases KpnⅠ and PstⅠ. -Basic Seamless Cloning and Assembly Kit (full gold, CAT: CU201-02) instructions for ligation of the recombinant vector. The ligation product was transformed into E. coli DH5α and the plasmid was extracted using a plasmid extraction kit. Plasmid Mini Prep Kit (full gold, CAT: EM101-02) was used to extract the plasmid of the positive clone to obtain the overexpression vector of CgPRX24 / CgPRX41 / CgPRX65

[0089] pCAMBIA2300-CgPRX24 / pCAMBIA2300-CgPRX41 / pCAMBIA2300-CgPRX65 Figure 4 shown.

[0090] 6. Transformation of Agrobacterium with overexpression vector

[0091] Remove competent GV3101 cells from the -80°C freezer, pinch them briefly with your fingertips to thaw slightly, and then thaw on ice. Add approximately 0.01 μg of plasmid to 30 μl of thawed competent cells in an ice-water mixture. Gently mix and perform the following steps: incubate on ice for 5 minutes, in liquid nitrogen for 5 minutes, in a 37°C water bath for 5 minutes, and in an ice bath for 5 minutes. Add 700 μL of LB medium (containing kanamycin and rifampicin antibiotics) and incubate at 28°C, 200 rpm, for 2-3 hours. Spread onto an LB plate containing kanamycin and rifampicin antibiotics and incubate inverted at 28°C for 48-72 hours. Verify positive single clones by PCR on the bacterial suspension.

[0092] PCR reaction conditions: 95°C for 3 min; 95°C for 15 s, 55°C for 15 s, 72°C for 2 min, 35 cycles; 72°C for 5 min.

[0093] 7. Preparation of Agrobacterium tumefaciens culture solution

[0094] The positive monoclonal bacteria were inoculated into double-antibody culture medium (Kana, Rif) at a ratio of 1:100 and cultured at 28°C, 220 rpm for 10-12 hours until the OD 600 When the bacterial suspension reaches 1.0-1.2, it is collected and resuspended with extraction solution (5mM MES, 2mM Na3PO4, 100uMacetosyringoned and 0.5% glucose) and its OD is adjusted. 600 To between 0.8-0.9, incubate in the dark at 28℃ for 2 hours before injection.

[0095] 8. Instant transformation of citrus peels

[0096] After the fruits are picked, they are immediately transported back to the laboratory for transient transfection. Fruits with consistent growth status, no diseases, and no obvious mechanical injuries are selected for transient transfection. The fruits are washed and soaked with 2% NaClO in advance. The fruit surface is disinfected with 75% alcohol before injection. The peel of each fruit is divided into two parts longitudinally. Four holes (2mm-5mm deep) are made at equal distances at the equator with a sterile pipette tip. No less than 1ml of bacterial solution is injected. One side is used as a control injection with an empty vector, and the other side is injected with the target gene (such as Figure 5 A; Figure 5 F; Figure 6 A; Figure 6 F; Figure 6 A; Figure 6 F). After the bacterial solution has been absorbed, wipe the peel clean of any remaining marks. Bag the fruit individually in a fresh-keeping bag and store in the dark at 22-25°C and 40-50% relative humidity. Sample the fruit after 6-9 days of storage. Peel the peel according to the infected area of ​​the fruit, quickly chop the sample, freeze it in liquid nitrogen, and store at -80°C.

[0097] 9. qRT-PCR analysis of overexpressed gene fruits

[0098] Total RNA was extracted from the peel of the transgenic strain (Aikerui, CAT: AG21101), and cDNA was synthesized using a reverse transcription kit. The expression level of the target gene was detected by qRT-PCR. The detection primer pairs were RT-CgPRX24-F and RT-CgPRX24-R, RT-CgPRX41-F and RT-CgPRX41-R, and RT-CgPRX65-F and RT-CgPRX65-R. -△△Ct The relative expression of CgPRX24 / CgPRX41 / CgPRX65 genes in transgenic lines was calculated by defining the sample with no load as the reference factor, i.e., the expression level of CgPRX24 / CgPRX41 / CgPRX65 in the sample was 1, and then the multiple of the gene expression in the transiently transfected citrus relative to the reference factor was calculated. -△△Ct , which is the relative expression level. The results showed that CgPRX24 / CgPRX41 / CgPRX65 genes were highly expressed in transiently transfected pericarp compared with empty pericarp, and the expression level was more than 1.5 times that of the control (refer to Figure 5 B; Figure 5 G; Figure 6 B; Figure 6 G; Figure 7 B; Figure 7 G)

[0099] qRT-PCR reaction conditions: 95°C for 30 s; 95°C for 5 s; 60°C for 30 s, 40 cycles.

[0100] The nucleotide sequences of primers RT-CgPRX24-F, RT-CgPRX41-F and RT-CgPRX65-F are SEQ ID No. 10, SEQ ID No. 11 and SEQ ID No. 12 as shown below:

[0101] SEQ ID No.10: AGGCATGTCGAAGGGTTGTTTCC

[0102] SEQ ID No.11: GCCGAGGACATTATCAGGGAACAAG

[0103] SEQ ID No.12:GCATGTCCTGGCATCGTCTCTTG

[0104] The nucleotide sequences of primers RT-CgPRX24-R, RT-CgPRX41-R and RT-CgPRX65-R are SEQ ID No. 13, SEQ ID No. 14 and SEQ ID No. 15 as shown below:

[0105] SEQ ID No.13: GCCGTTCTGCTGTCTCTCTTCC

[0106] SEQ ID No.14: AAGCATCACAAGACTGGACAGCAC

[0107] SEQ ID No.15: CCTGGAAGATTGGCAGTATCGGATG

[0108] 10. PRX enzyme activity assay

[0109] After 0.2g of sample was fully ground with liquid nitrogen, 5ml of acetic acid-sodium acetate buffer (pH5.5, containing 1mmolPEG, 4% PVPP and 1% TritonX-100) was added. Centrifuge at 12000g, 4℃ for 30min. The supernatant was the crude enzyme solution. The subsequent reaction was carried out after estimating the volume. The reaction system was 3ml of guaiacol solution, 0.5ml of enzyme solution, and 0.2ml of hydrogen peroxide solution. The timing was started immediately after mixing. The absorbance value at 470nm was measured at 30s after the start as the initial value. The absorbance change was recorded every 30s. The change within 3min was recorded. The control was distilled water. It was expressed in terms of protein content, and the results were expressed in Umin -1 mg - 1 The results showed that after overexpression of CgPRX24 / CgPRX41 / CgPRX65, the PRX enzyme activity increased by at least 1.3 times compared with the control group. (Refer to Figure 5 C; Figure 5 H; Figure 6 C; Figure 6 H; Figure 7 C; Figure 7 H).

[0110] 11. Peel hardness test

[0111] The fruit hardness was measured using an FTA fruit texture analyzer. A 1mm probe was used for the navel fruit, with the measurement parameters set to a test speed of 30mm / s and a test distance of 3.5mm. The hardness of the peel around the injection hole was measured. The yellow peel layer of the honey pomelo peel was removed, and the white peel layer with traces of bacterial liquid was retained with a thickness of 1.5-2cm. The hardness was measured using a 2.5mm probe and a measurement distance of 2mm. The results showed that overexpression of CgPRX24 / CgPRX41 / CgPRX65 could increase the hardness of the peel to 8%-28%. (Ref. Figure 5 D; 5I; 6D; 6I; 7D; 7I).

[0112] 12. Determination of lignin content

[0113] Weigh 0.2 g of sample and grind it into powder using an automatic grinder. Add 5 ml of 100% ethanol to the sample, vortex mix, centrifuge at 4°C, 12000g for 10 min, and discard the supernatant; add 3 ml of 95% ethanol solution to the sample, vortex mix, centrifuge at 4°C, 12000g for 5 min, discard the supernatant, and repeat three times; add 3 ml of ethanol:n-hexane (v / v 1:2) to the precipitate, vortex mix, centrifuge at 4°C, 12000g for 5 min, discard the supernatant, and repeat three times; place the precipitate at 70°C to dry overnight. Add 25% bromoacetyl (dissolved in acetic acid) to the dried precipitate, heat in a 70°C water bath for 30 minutes, cool to 25°C, add 0.9 ml of 2 mol / L NaOH to terminate the reaction, vortex mix, and centrifuge at 4°C, 12000g for 15 minutes. The blank is the added reagent solution. Dilute the supernatant after centrifugation and measure the absorbance at 280 nm using a microplate reader. The result is 10 3 OD 280 kg -1 FreshWeight (FW) stated that the results showed that overexpression of CgPRX24 / CgPRX41 / CgPRX61 could increase lignin content by 12%-50%, indicating that CgPRX24 / CgPRX41 / CgPRX61 mainly increases the firmness of the fruit peel by increasing the lignin content of the fruit. (Ref. Figure 5 E; 5J; 6E; 6J; 7E; 7J).

[0114] Test results

[0115] Overall, compared with the control fruits, the peel hardness of pomelo and sweet orange fruits increased and the lignin content increased after successful transient overexpression of CgPRX24 / CgPRX41 / CgPRX65. Therefore, CgPRX24 / CgPRX41 / CgPRX65 can be used as a potential target for improving the texture of citrus fruit.

[0116] The above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention. Those skilled in the art will readily appreciate that the present invention is susceptible to various modifications and variations. Any modifications, equivalent substitutions, improvements, and the like made within the spirit and principles of the present invention are intended to be included within the scope of protection of the present invention. It should be noted that the structures or components illustrated in the accompanying drawings are not necessarily drawn to scale, and that descriptions of known components, processing techniques, and processes are omitted to avoid unnecessarily limiting the present invention.

Claims

1. A PRX gene, characterized in that: The peroxidase protein encoded by the PRX gene can participate in the synthesis of lignin in citrus peel.

2. A PRX gene according to claim 1, characterized in that: The PRX gene includes at least one of the CgPRX24 gene, the CgPRX41 gene and the CgPRX65 gene; The nucleotide sequence of the CgPRX24 gene is SEQ ID No. 1; The nucleotide sequence of the CgPRX41 gene is SEQ ID No. 2; The nucleotide sequence of the CgPRX65 gene is SEQ ID No.

3.

3. A use of the PRX gene according to claim 1 or 2, characterized in that: The following steps are involved: S1: Clone the coding sequences of citrus CgPRX24 and / or CgPRX41 and / or CgPRX65; S2: cloning the coding sequence into a vector capable of expressing in plant cells to construct an overexpression vector; S3: transforming the overexpression vector into citrus peel cells to obtain transient transformation samples.

4. The use of a PRX gene according to claim 3, characterized in that: The method for cloning the coding sequence of citrus CgPRX24 and / or CgPRX41 and / or CgPRX65 described in S1 comprises: Total RNA was extracted from citrus and reverse transcribed into cDNA as a template; PCR amplification was performed using primer pairs OE-CgPRX24-F and OE-CgPRX24-R and / or OE-CgPRX41-F and OE-CgPRX41-R and / or OE-CgPRX65-F and OE-CgPRX65-R; The PCR amplification products are recovered to obtain DNA fragments encoding sequences of CgPRX24 and / or CgPRX41 and / or CgPRX65.

5. The use of a PRX gene according to claim 3, characterized in that: The method for constructing an overexpression vector described in S2 includes: The recovered CgPRX24 and / or CgPRX41 and / or CgPRX65 coding sequence DNA fragments were digested with restriction enzymes KpnI and PstI; The digested DNA fragments were ligated to the vector pCAMBIA2300 recovered by digestion with KpnI and PstI to construct overexpression vectors pCAMBIA2300-CgPRX24 and / or pCAMBIA2300-CgPRX41 and / or pCAMBIA2300-CgPRX65.

6. The use of a PRX gene according to claim 3, characterized in that: The method of transforming the overexpression vector into citrus peel cells in S3 comprises: The overexpression vectors pCAMBIA2300-CgPRX24 and / or pCAMBIA2300-CgPRX41 and / or pCAMBIA2300-CgPRX65 were transformed into Agrobacterium tumefaciens by heat shock method; The overexpression vector is transformed into citrus peel cells using Agrobacterium tumefaciens-mediated transformation technology.

7. The use of a PRX gene according to claim 4, characterized in that: The nucleotide sequence of primer OE-CgPRX24-F is SEQ ID No. 4; The nucleotide sequence of primer OE-CgPRX41-F is SEQ ID No. 5; The nucleotide sequence of primer OE-CgPRX65-F is SEQ ID No. 6; The nucleotide sequence of primer OE-CgPRX24-R is SEQ ID No. 7; The nucleotide sequence of primer OE-CgPRX41-R is SEQ ID No. 8; The nucleotide sequence of primer OE-CgPRX65-R is SEQ ID No.

9.

8. The use of a PRX gene according to claim 3, characterized in that: The transient transformation samples are used to study the functions of CgPRX24 and / or CgPRX41 and / or CgPRX65 genes in citrus peel lignin synthesis.

9. The use of a PRX gene according to claim 8, characterized in that: The method for studying the function of CgPRX24 and / or CgPRX41 and / or CgPRX65 genes in citrus peel lignin synthesis comprises: qRT-PCR was used to detect the overexpression levels of CgPRX24 and / or CgPRX41 and / or CgPRX65 genes, and the primer pairs were RT-CgPRX24-F and RT-CgPRX24-R and / or RT-CgPRX41-F and RT-CgPRX41-R and / or RT-CgPRX65-F and RT-CgPRX65-R; PRX enzyme activity assay was performed to verify the activity of peroxidase protein; Determination of the hardness of citrus peel and determination of the lignin content of citrus peel; Among them, the nucleotide sequence of primer RT-CgPRX24-F is SEQ ID No. 10; The nucleotide sequence of primer RT-CgPRX41-F is SEQ ID No. 11; The nucleotide sequence of primer RT-CgPRX65-F is SEQ ID No. 12; The nucleotide sequence of primer RT-CgPRX24-R is SEQ ID No. 13; The nucleotide sequence of primer RT-CgPRX41-R is SEQ ID No. 14; The nucleotide sequence of primer RT-CgPRX65-R is SEQ ID No.

15.

10. A peroxidase protein, characterized in that The lignin synthesized by the PRX gene according to claim 1 or 2 is used to participate in the synthesis of lignin in citrus peel.

Images