Application of ARMH3 inhibitors in the preparation of antiviral drugs for fish or the creation of germplasm for fish resistant to hemorrhagic diseases

By knocking out the ARMH3 gene in grass carp using CRISPR/Cas9 gene editing technology, antiviral drugs can be prepared or fish germplasm resistant to hemorrhagic disease can be created. This has solved the problem of high mortality caused by grass carp reovirus and achieved rapid improvement in grass carp germplasm and significant enhancement of antiviral ability.

CN121265818BActive Publication Date: 2026-05-26INST OF AQUATIC LIFE ACAD SINICA
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202511828025.5
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-12-05
Publication Date
2026-05-26
Estimated Expiration
2045-12-05

AI Technical Summary

Technical Problem

Grass carp reovirus (GCRV) causes hemorrhagic disease with a high mortality rate, resulting in severe losses to the grass carp farming industry. Furthermore, the natural germplasm resources of grass carp are declining, and traditional breeding methods are progressing slowly, making it difficult to quickly create new germplasm resistant to hemorrhagic disease.

Method used

By using an inhibitor of ARMH3 and knocking out the ARMH3 gene in grass carp through CRISPR/Cas9 gene editing technology, sgRNA targeting ARMH3 can be developed to prepare antiviral drugs for fish or create germplasm for fish resistant to hemorrhagic diseases, thereby improving antiviral capabilities.

Benefits of technology

The obtained ARMH3 knockout chimera population of grass carp showed a 33.34% higher survival rate against GCRV infection, significantly enhancing its resistance to hemorrhagic disease. This provides molecular targets and methods, offering a new avenue for innovation in grass carp breeding technology.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121265818B_ABST
    Figure CN121265818B_ABST
Patent Text Reader

Abstract

This invention belongs to the fields of genetic engineering and fish molecular breeding technology, specifically relating to the application of ARMH3 inhibitors in the preparation of antiviral drugs for fish or the creation of hemorrhagic disease-resistant fish germplasm. This invention discloses that ARMH3 is an important host factor for grass carp reovirus infection. The amino acid sequence of ARMH3 is shown in SEQ ID NO.1. ARMH3 is utilized by grass carp reovirus, promoting viral inclusion body formation, thereby facilitating viral replication and infection. This invention utilizes inhibitors of the ARMH3 protein encoded in grass carp... ARMH3 Genes were edited using CRISPR / Cas9 to create... ARMH3 Knockout chimeric grass carp populations exhibit significant resistance to hemorrhagic disease. This invention provides molecular targets and methods for the rapid creation of new grass carp germplasm resistant to hemorrhagic disease.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the fields of genetic engineering and fish molecular breeding technology, specifically involving the application of ARMH3 inhibitors in the preparation of antiviral drugs for fish or the creation of germplasm for fish resistant to hemorrhagic diseases. Background Technology

[0002] Grass carp, a major freshwater economic fish, holds an extremely important position in aquaculture. It is hailed as the top of China's "Four Major Domesticated Fish" and is a pillar species of freshwater aquaculture. Grass carp production has consistently ranked first among freshwater farmed fish in China, ensuring the rapid development of the fish farming industry and bringing huge economic benefits. However, with increasing stocking density and further deterioration of the farming environment, grass carp diseases have become frequent, especially hemorrhagic septicemia caused by grass carp reovirus (GCRV), which can have a mortality rate of over 85% in juvenile grass carp, causing significant economic losses to the grass carp farming industry. Simultaneously, due to habitat destruction and inbreeding in artificial breeding, the natural germplasm resources of grass carp have severely declined, with varying degrees of degradation in growth performance, disease resistance potential, and meat quality. This has resulted in grass carp farming facing multiple challenges: a shortage of superior breeds, frequent disease outbreaks, and declining quality, hindering the green and efficient development of the grass carp industry.

[0003] Traditional methods for breeding grass carp resistant to GCRV (Hemorrhagic Disease of Grass Carp) rely on phenotypic selection following natural disease onset or artificial challenge, combined with family selection and hybridization. However, the long sexual maturity cycle of grass carp (4-5 years) leads to large generational gaps and slow progress. Utilizing molecular biology techniques to deeply study the grass carp genome, explore its own disease-resistant gene resources, obtain key host factors regulating GCRV infection, and establish precision breeding techniques based on molecular targets has become a core breakthrough for creating new germplasm of grass carp resistant to GCRV. This has significant theoretical and practical implications for promoting the innovation of grass carp molecular breeding technology and the sustainable development of the industry. Summary of the Invention

[0004] To address the aforementioned issues, this invention provides an application of an ARMH3 inhibitor in the preparation of antiviral drugs for fish or the creation of germplasm for fish resistant to hemorrhagic disease, providing a molecular target and method for the rapid creation of new grass carp germplasm resistant to hemorrhagic disease.

[0005] To achieve the above objectives, the specific technical solution of the present invention is as follows:

[0006] The first aspect of this invention provides the application of an inhibitor of ARMH3 in the preparation of antiviral drugs for fish or the creation of germplasm for fish resistant to hemorrhagic disease. The inhibitor of ARMH3 enhances the antiviral ability of target fish or creates germplasm for fish resistant to hemorrhagic disease by targeting and knocking out or reducing the expression of ARMH3 in fish. The amino acid sequence of ARMH3 is shown in SEQ ID NO.1.

[0007] Furthermore, the ARMH3 inhibitor is a CRISPR / Cas9 formulation that inhibits ARMH3 expression.

[0008] Furthermore, the CRISPR / Cas9 formulation is sgRNA; the sgRNA sequence is shown in SEQ ID NO.6.

[0009] Furthermore, the virus in question is a reovirus.

[0010] Furthermore, the antiviral effect is to inhibit reovirus replication or inhibit reovirus infection.

[0011] Furthermore, the reovirus is grass carp reovirus type II GCRV-II.

[0012] The second aspect of the present invention provides a method for creating grass carp germplasm resistant to hemorrhagic disease, which involves using gene editing technology to knock out the gene encoding ARMH3 in grass carp, thereby obtaining grass carp germplasm resistant to hemorrhagic disease.

[0013] Furthermore, the sequence of the target site is shown in SEQ ID NO.2.

[0014] Furthermore, the nucleotide sequence of the gene encoding ARMH3 is GeneID:127520932, updated on May 6, 2025.

[0015] Furthermore, the gene editing technology is any one or more of CRISPR / Cas9 gene editing technology, TALEN gene editing technology, and zinc finger nuclease gene editing technology.

[0016] Furthermore, the method includes the following steps: mixing the Cas9 protein with the sgRNA that targets the gene encoding ARMH3, injecting it into the fertilized eggs or gonadal cells of the target fish, and screening individuals in the F0 generation whose gene encoding ARMH3 has been knocked out by genotyping to identify grass carp resistant to hemorrhagic disease.

[0017] Furthermore, the sgRNA sequence is shown in SEQ ID NO.6.

[0018] Furthermore, the final concentrations of sgRNA and Cas9 in the mixture are 60 ng / μL and 300 ng / μL, respectively.

[0019] Furthermore, the injection dose is 2 nL / piece.

[0020] Furthermore, the hemorrhagic disease is caused by reovirus infection.

[0021] Furthermore, the reovirus is grass carp reovirus type II GCRV-II.

[0022] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0023] This invention provides the application of ARMH3 inhibitors in the preparation of antiviral drugs for fish or the creation of fish germplasm resistant to hemorrhagic diseases. The amino acid sequence of ARMH3 is shown in SEQ ID NO.1. This invention has found that ARMH3 is an important host factor for grass carp reovirus infection, and the protein encoding ARMH3... ARMH3 The gene interacts with the non-structural proteins NS80 and NS38 of grass carp reovirus. ARMH3 Overexpression of the gene promotes the expression of grass carp reovirus inclusion body forming proteins NS80 and NS38. Therefore, ARMH3 further facilitates viral replication and infection by promoting the formation of grass carp reovirus inclusion bodies, and the function of ARMH3 in promoting grass carp reovirus replication depends on its DUF1741 domain. This invention targets ARMH3 and developed an sgRNA with the sequence shown in SEQ ID NO.6. Through CRISPR / Cas9 gene editing in commercially farmed grass carp, the obtained... ARMH3 The chimeric grass carp population exhibited a significant advantage in resistance to hemorrhagic disease compared to wild grass carp populations. ARMH3 The infection survival rate of chimeric grass carp populations was increased by 33.34%. This invention provides molecular targets and methods for creating new grass carp germplasm resistant to hemorrhagic disease.

[0024] Armadillo-like helical domain protein 3 (ARMH3), a class of functional proteins containing conserved ARM domains, plays a crucial role in cell signaling, protein-protein interaction regulation, and disease pathway mediation. Existing research indicates that ARMH3 function exhibits significant species specificity: in mammals, ARMH3 participates in mitochondrial sheath assembly and sperm maturation during spermatogenesis, and also exerts antiviral effects by regulating the cGAS-STING innate immune pathway. In mammals, ARMH3 interacts with STING proteins in the Golgi apparatus, recruiting phosphatidylinositol 4-kinase β (PI4KB) to synthesize phosphatidylinositol 4-phosphate (PI4P), mediating the transport of STING from the Golgi apparatus to endosomal regions, thereby enhancing the host's antiviral immune response. However, other studies have also confirmed that ARMH3 can increase PI4P levels in the Golgi apparatus by binding to PI4KB, providing a necessary lipid environment for enterovirus replication and thus promoting viral infection. This invention discloses for the first time that fish ARMH3 participates in the replication regulation of grass carp reovirus and mediates the host antiviral pathway. Inhibitors of ARMH3 can be used to create grass carp germplasm resistant to hemorrhagic disease. Attached Figure Description

[0025] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0026] Figure 1 Sequence characteristics of grass carp ARMH3 and electrophoresis diagram of proteins expressed by the gcARMH3-FLAG recombinant expression vector. Figure 1 In this context, A represents the sequence characteristics of grass carp ARMH3; Figure 1 In the image, B represents the electrophoresis diagram of the protein expressed by the gcARMH3-FLAG recombinant expression vector.

[0027] Figure 2 The effect of gcARMH3-FLAG overexpression in CIK cells on GCRV infection and viral replication. Figure 2 In this context, A represents the degree of lesion in CIK cells overexpressing gcARMH3-FLAG after GCRV infection. Figure 2 In the figure, B represents the statistical results of viral titer in CIK cells overexpressing gcARMH3-FLAG after GCRV infection, and ** indicates P <0.01. Figure 2In the figure, C represents the expression of virus-related proteins 24 hours after GCRV infection following overexpression of gcARMH3-FLAG in CIK cells.

[0028] Figure 3 This study analyzed the interaction and co-localization of gcARMH3-FLAG with GCRV-related proteins after overexpression in CIK cells. Figure 3 In the figure, A represents the overexpression of gcARMH3-FLAG in CIK cells. The results of immunoblotting after co-precipitation were obtained 18 hours after GCRV infection. Figure 3 In the figure, B represents the overexpression of gcARMH3-FLAG in CIK cells. Immunofluorescence was used to detect the co-localization of gcARMH3-FLAG and NS80 18 h after GCRV infection. Figure 3 In the figure, C represents the overexpression of gcARMH3-FLAG in CIK cells. Immunofluorescence was used to detect the co-localization of gcARMH3-FLAG and NS38 18 h after GCRV infection. Scale bar: 10 µm.

[0029] Figure 4 The effects of overexpression of gcARMH3-FLAG, gcARMH3(1-399aa)-FLAG and gcARMH3_DUF1741-FLAG on GCRV virus inclusion body formation in CIK cells. Figure 4 In the figure, A represents the result of detecting viral inclusion bodies produced 18 hpi after GCRV infection using NS80 antibody. Figure 4 B in the figure represents the result of quantification of the average fluorescence intensity of immunofluorescence of NS80 virus inclusion bodies. Figure 4 In the figure, C represents the result of detecting viral inclusion bodies produced 18 hpi after GCRV infection using NS38 antibody. Figure 4 In the figure, D represents the result of quantification of the average fluorescence intensity of NS38 viral inclusion bodies using immunofluorescence. Scale bar: 40µm. ** indicates... P <0.01, ns indicates no significant difference between groups.

[0030] Figure 5 This is an infographic illustrating the knockout of the ARMH3 gene in grass carp. Figure 5 In this context, A represents the location of the target site sequence within the ARMH3 genome. Figure 5 In the figure, B represents the in vitro cleavage detection of ARMH3 gRNA2 and gRNA3. Figure 5 In the diagram, C represents the sequencing peak of the ARMH3 gene in wild-type grass carp, and the gRNA2 and gRNA3 target site sequences are marked with red underlines. Figure 5 In this context, D represents the F0 generation obtained using the gRNA2 sequence targeting the ARMH3 gene. ARMH3 Sequencing peak diagram of knockout chimeric grass carp.

[0031] Figure 6 The effect of ARMH3 gene editing on the survival of infected juvenile grass carp is shown in blue. The blue curve represents the survival rate of wild-type grass carp, and the red curve represents... ARMH3 Survival rate curve of knockout chimeric grass carp. Detailed Implementation

[0032] The specific embodiments of the present invention are described in detail below, but it should be understood that the scope of protection of the present invention is not limited to the specific embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention. Unless otherwise specified, the experimental methods described in the embodiments of the present invention are conventional methods, and the materials and reagents used in the following embodiments are commercially available unless otherwise specified.

[0033] Example 1: Sequence characteristics of grass carp ARMH3 and electrophoresis experiment of protein expressed by gcARMH3-FLAG recombinant expression vector

[0034] Query and download grass carp from the NCBI database ARMH3 The nucleotide sequence of the gene is GeneID: 127520932, updated on May 6, 2025. In this embodiment of the invention, grass carp... ARMH3 Gene markers are gcARMH3 Then according to gcARMH3 Nucleotide sequences and multiple cloning sites of the eukaryotic expression vector p3×FLAG-CMVTM-14 were used to design amplification using Clone Manager software. gcARMH3 Primer set.

[0035] Using wild-type grass carp cDNA as a template, primers were used to amplify... gcARMH3 The CDS area, and simultaneously gcARMH3 Double digestion with p3×FLAG-CMVTM-14, followed by ligation reaction to... gcARMH3 The cells were inserted into the FLAG-CMVTM-14 vector, then transformed with *E. coli* DH5α competent cells. Single clones were picked for culture and sequencing verification. Cells with correct sequencing were then... gcARMH3 Nucleotide sequences are translated into protein sequences. The amino acid sequence of grass carp ARMH3 is shown in SEQ ID NO.1.

[0036] SEQ ID NO.1:

[0037] .

[0038] Protein domain analysis was performed on grass carp ARMH3 cells using the NCBI database, and a protein domain map of gcARMH3 was constructed using Illustrator for Biological Sequences (IBS) software. Two bacterial strains with correct sequencing results were selected and cultured extensively. Plasmids were extracted using the OMEGA kit, and their concentration and purity were determined using a micro-UV spectrophotometer. The obtained recombinant plasmid was named gcARMH3-FLAG and transfected into CIK cells. After 48 hours of transfection, cells were collected, and cellular proteins were extracted using RIPA lysis buffer. Western blotting was then used to verify protein expression.

[0039] Experimental results are as follows Figure 1 As shown, the grass carp ARMH3 gene encodes 654 amino acids in its entirety and contains the DUF1741 domain. Figure 1 (A) The protein size detected by Western Blot is consistent with the predicted size. gcARMH3 -FLAG protein is of similar size and has a single band, with the protein band located between 65kDa and 80kDa (the molecular weight calculated from gcARMH3-FLAG is approximately 75kDa). Figure 1 (B in the middle).

[0040] Example 2: Effects of grass carp ARMH3 overexpression in CIK cells on GCRV infection and viral replication

[0041] In this embodiment, CIK cells were divided into 5×10 5 Cells were evenly seeded into 12-well plates. After 12 hours, 1 μg of FLAG-CMVTM-14 (empty FLAG plasmid) and 1 μg of gcARMH3-FLAG plasmid prepared in Example 1 were transfected into CIK cells. The experiment included an uninfected group (Mock) and a GCRV-infected group, with three replicates per group. 36 hours after transfection, GCRV-infected cells were added to each well of GCRV-infected group (MOI: 1) diluted with 500 μL serum-free MEM medium; the uninfected group was added to each well of 500 μL serum-free MEM medium. Both groups of cells were incubated at 25°C. In the GCRV-infected group, the 12-well plates were gently shaken every 15 minutes. After incubation for 1 hour, the medium was removed; after washing the cells with PBS, 1 mL of MEM medium containing 2% FBS was added, and the cells were continued to be cultured at 25°C. Eighteen hours after infection, cells were observed under a microscope. Once cytopathic effects appeared, 500 μL of supernatant was collected from each well of the infected group and placed in a 1.5 mL EP tube, which was then stored at -80°C. 250 μL of 4% paraformaldehyde was added to each well of all cells, and the cells were fixed at room temperature for 30 min. The fixative was then removed. Next, 300 μL of 1% crystal violet solution was added and the cells were incubated overnight at room temperature. After removing the crystal violet solution, the cells were air-dried and photographed.

[0042] CIK cells were divided into 1×10 5 Cells were seeded in 96-well plates. The collected GCRV virus supernatant was serially diluted with serum-free MEM medium, and 100 μL of the diluted virus suspension was added to each well. The plates were incubated at 25°C for 1 hour, after which the virus dilution was removed. Cells were washed with PBS, and 100 μL of MEM medium containing 2% FBS was added to each well. Two columns of the 96-well plates were selected, each containing 100 μL of MEM medium containing 2% FBS, as negative controls. Cells were then cultured at 25°C. On day 3, the presence of lesions in each well was observed under a microscope and compared with the negative controls. The number of positive wells in each row was recorded. The TCID of GCRV was calculated using the Reed-Muench formula. 50The values ​​were then converted to GCRV viral titers, expressed in PFU / mL. Graphs were plotted using Graphpad Prism 9.0, and the effects of overexpression of the empty FLAG plasmid and the gcARMH3-FLAG plasmid on GCRV infection and replication were compared and analyzed.

[0043] CIK cells were divided into 1×10 6 Cells were seeded in 6-well plates, and after 12 h, empty FLAG plasmid and gcARMH3-FLAG plasmid prepared in Example 1 were transfected into CIK cells, respectively. An uninfected group (Mock) and a GCRV-infected group were set up. 36 h after transfection, GCRV-infected cells were added to each well of GCRV-infected group (MOI: 1) diluted with 500 μL serum-free MEM medium; the uninfected group was added to each well of 500 μL serum-free MEM medium. Both groups of cells were incubated at 25°C. In the GCRV-infected group, the 6-well plates were gently shaken every 15 min, and after 1 h of incubation, the medium was removed. After washing the cells with PBS, 1 mL of MEM medium containing 2% FBS was added, and the cells were cultured again at 25°C. Cells were collected 24 hpi post-infection, and lysis buffer (Thermo Fisher Scientific) containing protease inhibitors was added. The supernatant was collected, and Western blotting was performed to detect the expression of GCRV-related viral proteins. The antibodies used were FLAG mouse antibody (1:5000), NS80 rabbit antibody (1:2000), NS38 rabbit antibody (1:2000), VP3 rabbit antibody (1:2000), and VP5 rabbit antibody (1:2000). Finally, the images were scanned and photographed using a molecular imaging system.

[0044] The results are as follows Figure 2 As shown, compared with the control group overexpressing the empty FLAG plasmid, CIK cells overexpressing gcARMH3-FLAG showed significantly enhanced lesion severity after GCRV infection (see...). Figure 2 (A) The viral titer increased significantly (see A) Figure 2 (B in the text). The viral titer of the FLAG transfection group was 6.18 Log. 10 PFU / mL ± 0.03 Log 10 PFU / mL; the viral titer of the gcARMH3-FLAG transfection group was 7.69 Log. 10 PFU / mL ± 0.03 Log 10 PFU / mL; the viral titer in the gcARMH3-FLAG transfection group was 32.4 times that of the FLAG transfection group. Furthermore, the expression level of GCRV-related proteins was upregulated with increasing gcARMH3-FLAG expression. Figure 2(C in the text). This result indicates that gcARMH3 promotes GCRV replication and infection.

[0045] Example 3: Interaction and co-localization analysis of grass carp ARMH3 and GCRV-associated viral proteins

[0046] (1) Immunoprecipitation experiment: In this example, CIK cells were arranged in a 4×10⁻⁶ pattern. 6 The number of inoculated individuals was 10 cm. 2 Cell culture dishes were prepared, and after 12 hours, empty FLAG plasmid and gcARMH3-FLAG plasmid prepared in Example 1 were transfected into CIK cells, respectively. An uninfected group (Mock) and a GCRV-infected group were set up. 36 hours after transfection, GCRV-infected cells were added to each well of GCRV-infected cells with 6 mL of serum-free MEM medium (MOI = 1); 6 mL of serum-free MEM medium was added to each well of the uninfected group. Both groups of cells were placed in an incubator at 25°C. The GCRV-infected group was gently shaken 10 cm every 15 minutes. 2 Cells were incubated in cell culture dishes for 1 hour, then the culture medium was removed. After washing the cells with PBS, 8 mL of MEM medium containing 2% FBS was added, and the cells were cultured in a cell culture incubator at 25°C. 18 hours post-infection, cells were collected into 2 mL EP tubes, and 1 mL of IP lysis buffer (ThermoFisher Scientific) containing protease inhibitors was added to lyse the cells. The supernatant was collected, and 200 μL of the supernatant was used for Western blotting to detect the expression of gcARMH3-FLAG and GCRV-related viral proteins. The antibodies used were FLAG mouse antibody (1:5000), NS80 rabbit antibody (1:2000), NS38 rabbit antibody (1:2000), VP3 rabbit antibody (1:2000), and VP5 rabbit antibody (1:2000). Molecular imaging was used to scan and photograph the proteins to confirm their expression. Immunoprecipitation was then performed. 40 μL of commercially available FLAG beads (Sigma) were added to 1.5 mL EP tubes. The FLAG beads were washed twice with pre-chilled PBS, and the remaining lysate was added to the FLAG beads. The tubes were incubated overnight at 4°C with rotation. The next day, the FLAG beads were washed six times with pre-chilled PBS, and then Western blot analysis was performed to detect the enrichment of gcARMH3-FLAG and GCRV-related viral proteins in the incubated FLAG beads. The antibodies used were FLAG mouse antibody (1:5000), NS80 rabbit antibody (1:2000), NS38 rabbit antibody (1:2000), VP3 rabbit antibody (1:2000), and VP5 rabbit antibody (1:2000), which were then scanned and photographed using a molecular imaging system.

[0047] (2) Immunofluorescence experiment: CIK cells were arranged at a density of 2.5 × 10⁻⁶.5 Cells were evenly seeded onto slides in 24-well plates. After 12 hours, empty FLAG plasmid and gcARMH3-FLAG plasmid prepared in Example 1 were transfected into CIK cells. An uninfected group (Mock) and a GCRV-infected group were set up. 36 hours after transfection, 200 μL of GCRV diluted in serum-free MEM medium (MOI=1) was added to each well, and the cells were incubated at 25°C for 1 hour, after which the medium was removed. After washing the cells with PBS, 500 μL of MEM medium containing 2% FBS was added to each well, and the cells were cultured at 25°C. 18 hours after infection, the cells were fixed by adding an appropriate amount of 4% paraformaldehyde to each well and fixing at room temperature for 1 hour. After removing the fixative, the cells were washed three times with PBS, and permeabilized for 10 minutes at room temperature with PBS containing 0.1% Triton X-100. After washing the cells three times with PBS, the cells were blocked in each well with PBS containing 5% BSA at room temperature for 1 hour, followed by washing three times with PBS. Dilute FLAG mouse antibody, NS80 rabbit antibody, or NS38 rabbit antibody with 2.5% BSA in PBST solution at an appropriate ratio and incubate overnight at 4°C. After washing cells three times with PBST, dilute the fluorescent 594-conjugated anti-rabbit IgG (1:500) secondary antibody or the fluorescent 488-conjugated anti-mouse IgG (1:500) secondary antibody with 2% BSA in PBST solution and incubate at room temperature in the dark for 2 hours. After washing cells three times with PBST, mount each slide with 10 μL of mounting medium containing DAPI, taking care to avoid air bubbles, and mount overnight at room temperature in the dark. Finally, observe and photograph using a fluorescence inverted microscope.

[0048] The results are as follows Figure 3 As shown, the results of the immunoprecipitation experiment indicate that gcARMH3-FLAG interacts with the non-structural proteins NS80 and NS38 of GCRV, but does not interact with the structural proteins VP3 and VP5. Figure 3 (A) Immunofluorescence assay results showed that gcARMH3-FLAG exhibited scattered cytoplasmic distribution in the uninfected state of GCRV, but in the infected state of GCRV, gcARMH3-FLAG co-localized with NS80 or NS38 in punctate patterns in the cytoplasm. Figure 3 (B~C in the text). This indicates that gcARMH3 interacts with the non-structural proteins NS80 and NS38 of GCRV.

[0049] Example 4: Analysis of the role of grass carp ARMH3 and its DUF1741 domain in the formation of GCRV virus inclusion bodies

[0050] Based on the protein structure diagram of gcARMH3 in Example 1, this embodiment constructed recombinant plasmids gcARMH3(1-399aa)-FLAG and gcARMH3_DUF1741-FLAG, where gcARMH3(1-399aa) is gcARMH3 without the DUF1741 domain. CIK cells were then cultured at a density of 2.5 × 10⁻⁶ cells / year. 5 Cells were evenly seeded onto slides in 24-well plates. After 12 hours, empty FLAG plasmid and the plasmids gcARMH3-FLAG, gcARMH3(1-399aa)-FLAG, and gcARMH3_DUF1741-FLAG prepared in Example 1 were transfected into CIK cells. 36 hours after transfection, 200 μL of GCRV diluted with serum-free MEM medium (MOI=1) was added to each well, and the cells were incubated at 25°C for 1 hour, after which the medium was removed. After washing the cells with PBS, 500 μL of MEM medium containing 2% FBS was added to each well, and the cells were cultured at 25°C. 18 hours after infection, the cells were fixed by adding an appropriate amount of 4% paraformaldehyde to each well and fixing at room temperature for 1 hour. After removing the fixative, the cells were washed three times with PBS, and PBS containing 0.1% Triton X-100 was added to each well for 10 minutes at room temperature to permeate the cells. After washing cells three times with PBS, each well was blocked for 1 hour at room temperature with PBS solution containing 5% BSA, followed by three more washes with PBS. FLAG mouse antibody, NS80 rabbit antibody, or NS38 rabbit antibody were diluted with PBST solution containing 2.5% BSA at an appropriate ratio and incubated overnight at 4°C. After washing cells three times with PBST, fluorescent 594-conjugated anti-rabbit IgG (1:500) secondary antibody or fluorescent 488-conjugated anti-mouse IgG (1:500) secondary antibody were diluted with PBST solution containing 2% BSA and incubated for 2 hours at room temperature in the dark. After washing cells three times with PBST, each slide was mounted with 10 μL of mounting medium containing DAPI, taking care to avoid air bubbles, and mounted overnight at room temperature in the dark. Finally, the cells were observed and photographed using a fluorescence inverted microscope.

[0051] The results are as follows Figure 4 As shown, immunofluorescence results indicated that, compared to the FLAG empty plasmid control group, gcARMH3-FLAG overexpression promoted the expression of viral inclusion body forming proteins NS80 and NS38, and gcARMH3_DUF1741-FLAG overexpression had the same effect as normal ARMH3 overexpression. However, gcARMH3(1-399aa)-FLAG overexpression did not promote viral inclusion body formation. This suggests that grass carp ARMH3 promotes viral replication and infection by inducing the formation of GCRV viral inclusion bodies; and that ARMH3's function in promoting GCRV replication depends on its DUF1741 domain.

[0052] Example 5: Gene editing of ARMH3 in grass carp and identification of chimeric positive fish

[0053] This embodiment utilizes CRISPR / Cas9 technology to... gcARMH3 Edited and identified by PCR sequencing gcARMH3 Knock out chimeric positive fish. The specific procedure is as follows:

[0054] (1) According to gcARMH3 Gene nucleotide sequence predicted on the ZIFIT website gcARMH3 The target site was identified and primers for sgRNA transcription template were designed.

[0055] The target site sequence is 5'-GGAAGTTGGAGTCTCTGGATGGG-3' (SEQ ID NO.2), and the primer information for constructing the sgRNA transcription template is as follows.

[0056] gRNA-F1 (gRNA2):

[0057] GTAATACGACTCACTATA GGAAGTTGGAGTCTCTGGATG TTTTAGAGCTAGAAATAGC(SEQ IDNO.3);

[0058] gRNA-F2 (gRNA3):

[0059] GTAATACGACTCACTATA GGAAGGGAAGTTGGAGTCTCT TTTTAGAGCTAGAAATAGC(SEQ IDNO.4);

[0060] gRNA-R: AAAAAAAAGCACCGACTCGGTGCCAC (SEQ ID NO.5), the target sequence was constructed into the sgRNA expression template by PCR.

[0061] (2) After PCR product recovery and purification, sgRNA was transcribed using the MEGAshortscript™ Kit (Invitrogen™, #AM1354) according to the instructions. After obtaining the transcription product, sgRNA was extracted using LiCl (final concentration 2.5 nmol). After the concentration was measured, the sgRNA was aliquoted and stored at -80℃. The nucleotide sequence of the obtained sgRNA is as follows:

[0062] GUAAUACGACUCACUAUA GGAAGUUGGAGUCUCUGGAUG UUUUAGAGCUAGAAAUAGC (SEQ ID NO. 6).

[0063] The underlines in SEQ ID NO.3, SEQ ID NO.4, and SEQ ID NO.6 are to highlight the target site sequence location.

[0064] (3) Use Xba pGH7(T7:zCas9-UTRglobin) (from the National Zebrafish Resource Center, CZRC Catalog ID:CZP4) was linearized using an I endonuclease and digested in a PCR instrument at 37°C for 4 hours. A small amount of the digestion product was taken for agarose gel electrophoresis. After confirming complete linearization, the Cas9 linearized product was directly recovered.

[0065] (4) Linearized Cas9 was transcribed in vitro using the T7 mMESSAGE mMACHINE® Kit (Invitrogen™, #AM1345). After obtaining the transcription product, the Cas9 transcription product was extracted using LiCl (final concentration of 2.5 nmol). After the concentration was measured, the product was aliquoted and stored at -80°C to obtain the mRNA of Cas9 protein.

[0066] (5) In the in vitro sgRNA cleavage experiment, grass carp tail fins were collected, and the genome of wild-type grass carp was extracted using the alkaline lysis method. Using the genome as a template, PCR amplification was performed using primers ARMH3-F and ARMH3-R. Each 50 μL reaction system contained: 4 μL of genome, 2 μL of ARMH3-F, 2 μL of ARMH3-R, 1 μL of dNTP mix, 0.5 μL of Ex Taq, 5 μL of 10×Ex Taq Buffer, and 35.5 μL of sterile water. The PCR amplification conditions were: 95℃ pre-denaturation for 3 min, 95℃ denaturation for 30 s, 56℃ annealing for 30 s, 72℃ extension for 1 min, 38 cycles, and then a final extension at 72℃ for 10 min. A 455 bp fragment was obtained after PCR amplification. This PCR product was recovered, and the concentration of the recovered product should be greater than 100 ng / μL.

[0067] ARMH3-F: GAAGACCCTACTAAGAACAATCCT (SEQ ID NO. 7); ARMH3-R: ATTTTGCAGATTCTTCAAGGTGTA (SEQ ID NO. 8).

[0068] (6) Prepare a 10 μL reaction system: 0.5 μL of Cas 9 protein, 0.25 μL of sgRNA, 3 μL of PCR product, 1 μL of 10×Buffer and 5.25 μL of DEPC water; mix well and place in a PCR instrument at 37℃ for 1 h and at 80℃ for 5 min.

[0069] (7) Detect the bands after the reaction using 1.5% agarose nucleic acid gel.

[0070] (8) In the process gcARMH3 During gene editing, the synthesized sgRNA and Cas9 mRNA were diluted with DEPC water to 120 ng / μL and 600 ng / μL, respectively. After dilution, they were mixed at a volume ratio of 1:1 to make the final concentrations of sgRNA and Cas9 60 ng / μL and 300 ng / μL, respectively.

[0071] (9) The diluted sgRNA and Cas9 mixture was injected into the animal pole of grass carp embryos in the 1-2 cell stage using a microinjector (Eppendorf) at a dose of 2 nL / egg.

[0072] (10) After the injection, wild-type grass carp embryos and F0 generation grass carp embryos injected with ARMH3sgRNA-Cas9 mixture were placed in an embryo incubation cycle device for incubation. After all the grass carp fry hatched 4 days after fertilization, the fry were transferred to an economic fish farming system with a stocking density of 200 fish / tank. Sufficient live brine shrimp were fed twice a day.

[0073] (11) When the juvenile fish have grown for about a month, the tail fins of all F0 generation grass carp are collected. The genome of the tail fins of F0 generation grass carp is then extracted by alkaline lysis method. The sgRNA target site is amplified using ARMH3-F (SEQ ID NO.7) and ARMH3-R (SEQ ID NO.8). The amplified products are then sent to the company for sequencing.

[0074] Selected gcARMH3 The target site sequences gRNA2 and gRNA3 are both located in exon 4 ( Figure 5 (A) In vitro cleavage experiments showed that both gRNA2 and gRNA3 could cleave... gcARMH3 ( Figure 5 (B in the original text), but when knocked out in grass carp, gRNA2 knockout efficiency was higher than gRNA3 knockout efficiency. For all gcARMH3 Analysis of the sequencing results of gene-edited fish revealed that approximately 40.37% of the sequencing results showed a double peak (…). Figure 5 The values ​​(C~D) indicate that the mutation efficiency of ARMH3-gRNA2 is 40.37%. Tail-by-tail identification was performed using PCR sequencing to screen grass carp with the mutation effect. ARMH3 The chimera was knocked out for subsequent infection experiments.

[0075] Example 6: Effect of ARMH3 gene editing in grass carp on the survival of juvenile fish infected with GCRV-II

[0076] (1) Wild grass carp and identified ARMH3 F0 generation knockout chimera grass carp juveniles (grass carp fertilized eggs source: Yulin Fishery, Guangxi) were placed in cement ponds for breeding, ensuring the oxygenation of the breeding water and feeding them 3 times a day.

[0077] (2) When the grass carp grow to about 5 months old, randomly catch 120 wild grass carp and 120 ARMH3 F0 knockout chimeric grass carp, put them in a packing bag, add an appropriate amount of culture water and sufficient oxygen, and then seal it.

[0078] (3) Place the grass carp in the system for a week and observe its health status at any time.

[0079] (4) After confirming that the grass carp have no stress or symptoms, add 150L of culture water to 6 glass tanks in advance, and equip each glass tank with 2 aeration devices; set the air conditioning temperature in the fish room to 28℃.

[0080] (5) Place the virus stock solution, along with the filling bottle, into water at 28°C for 2 hours to rehydrate. Dilute the rehydrated virus stock solution 800 times with aerated water to prepare the working solution for soaking the virus, and control the water temperature at 28°C.

[0081] (6) The amount of working solution to be used was determined based on the total weight of the experimental fish. The ratio of the amount of working solution to the total weight of the experimental fish was 40:1. Wild-type grass carp and ARMH3 F0 knockout chimeric grass carp were immersed in the virus-soaking working solution for 60 minutes, ensuring sufficient dissolved oxygen.

[0082] (7) After soaking, take out the experimental fish and put them into the prepared clean water along with the net to wash away the adhering virus liquid. Then put the experimental fish into the breeding pond and keep the water temperature at around 28℃ throughout the process.

[0083] (8) During the challenge period, feed appropriate extruded feed according to the feeding situation of the experimental fish. It is best to finish it within half an hour, and remove any uneaten feed in time.

[0084] (9) Observe the fish's survival status and disease symptoms twice a day, morning and evening. Remove dead fish in time and count the number of dead grass carp in each group until there are no more dead fish. Calculate the daily survival rate and plot the survival curve.

[0085] The results are as follows Figure 6As shown, after GCRV-II immersion infection, wild-type grass carp began to die in large numbers from day 2, reaching a peak mortality rate on day 4, with a total of 108 fish dying by day 10, a mortality rate of 94.74% and a survival rate of only 5.26%; thereafter, the mortality rate stabilized and stopped decreasing. ARMH3 F0 knockout chimera grass carp began to die sporadically from day 3, reaching a peak mortality rate on day 10; from day 15, the mortality rate stabilized and stopped decreasing. The number of surviving wild-type grass carp in the three groups were 1, 0, and 5 respectively, totaling 6 surviving fish; the number of surviving ARMH3 F0 knockout chimera grass carp in the three groups were 14, 13, and 17 respectively, totaling 44 surviving fish. Compared with the wild-type grass carp population, the survival rate of ARMH3 F0 knockout chimera grass carp after GCRV-II infection increased by 33.34%.

[0086] It should be noted that when numerical ranges are involved in this invention, it should be understood that both endpoints of each numerical range and any value between the two endpoints can be selected. Since the steps and methods used are the same as in the embodiments, preferred embodiments are described here to avoid redundancy. Although preferred embodiments of the invention have been described, those skilled in the art, once they understand the basic inventive concept, can make other changes and modifications to these embodiments. Therefore, the appended claims are intended to be interpreted as including the preferred embodiments as well as all changes and modifications falling within the scope of this invention.

[0087] Obviously, those skilled in the art can make various modifications and variations to this invention without departing from its spirit and scope. Therefore, if these modifications and variations fall within the scope of the claims of this invention and their equivalents, this invention also intends to include these modifications and variations.

Claims

1. The application of ARMH3 inhibitors in the preparation of antiviral drugs for fish or the creation of fish germplasm resistant to hemorrhagic diseases, characterized in that, The amino acid sequence of the ARMH3 is shown in SEQ ID NO.1; the ARMH3 inhibitor is a CRISPR / Cas9 formulation that inhibits ARMH3 expression; the CRISPR / Cas9 formulation is sgRNA; the sgRNA sequence is shown in SEQ ID NO.6; the virus is a reovirus.

2. The application according to claim 1, characterized in that, The antiviral agent is used to inhibit reovirus replication or inhibit reovirus infection.

3. A method for creating grass carp germplasm resistant to hemorrhagic disease, characterized in that, Using the gene encoding ARMH3 as the target site, CRISPR / Cas9 gene editing technology is used to knock out the gene encoding ARMH3 in grass carp to obtain grass carp germplasm resistant to hemorrhagic disease; the method includes the following steps: mixing Cas9 protein with sgRNA targeting the gene encoding ARMH3, injecting it into the fertilized eggs or gonadal cells of the target fish, and screening individuals with the knockout gene encoding ARMH3 in the F0 generation by genotyping, which are the grass carp resistant to hemorrhagic disease; the sgRNA sequence is shown in SEQ ID NO.

6.

4. The method according to claim 3, characterized in that, The hemorrhagic disease is caused by reovirus infection.

Citation Information

Patent Citations

  • Statla gene deletion type zebra fish

    CN105594664A

  • Application of grass carp PI4KB as target molecule in preparation of anti-hemorrhagic disease and / or fast-growing grass carp

    CN118252124A