A method for preparing a human collagen type iii fragment
By constructing a codon-optimized collagen fragment and a recombinant system co-expressing HAC1 in Pichia pastoris, combined with glycine supplementation and a low-salt culture medium, the stability and efficiency of human type III collagen fragment secretion expression in Pichia pastoris were solved, achieving efficient and stable collagen fragment secretion expression.
Patent Information
- Application Number
- CN202610377926.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-03-26
- Publication Date
- 2026-05-26
AI Technical Summary
In the prior art, the expression of human type III collagen fragments in Pichia pastoris during secretion is prone to causing an imbalance between endoplasmic reticulum protein folding and secretion homeostasis due to the high flexibility and complex structure of the protein molecules. This leads to problems such as protein misfolding, intracellular accumulation, low secretion efficiency, and insufficient structural stability.
A recombinant Pichia pastoris expression system was constructed. By optimizing the codons of the gene encoding the human type III collagen fragment and co-expressing the transcriptional regulator HAC1 of the endoplasmic reticulum unfolded protein response pathway, combined with glycine supplementation and low-salt culture medium, the endoplasmic reticulum protein folding and secretion processes were synergistically regulated, thus constructing a multidimensional synergistic expression system.
It significantly improved the correct folding ratio and extracellular accumulation level of collagen fragments, reduced misfolding and intracellular accumulation, enhanced secretion efficiency and structural stability, and achieved efficient and stable secretory expression of collagen fragments. The protein yield can reach 6.55 g/L under 5 L fermenter conditions.
Smart Images

Figure CN122081372A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the fields of microbial fermentation and genetic engineering technology, specifically to a method for preparing human type III collagen fragments. Background Technology
[0002] Collagen is widely used in food, medical, and cosmetic fields. Type III collagen, as the most common type in the human body and frequently used in medical devices, has attracted much attention for its biosynthesis. Traditional methods of obtaining collagen mainly involve acid hydrolysis, alkaline hydrolysis, enzymatic hydrolysis, and chemical synthesis from animal sources. However, these methods all have various problems, such as the risk of viral infections, certain antigenicity, and immune rejection reactions upon entering the body, which limit its further promotion in high-end applications. With the development of genetic engineering technology, the recombinant production of collagen or its functional fragments using microbial expression systems has become an important development direction.
[0003] Pichia pastoris has advantages such as stable expression of recombinant proteins, favorable protein folding and extensive protein modification, and is often used for heterologous expression of animal-derived proteins. It also has strong aerobic growth characteristics, can grow at high density in simple culture media containing only inorganic salts and carbon sources, and has high protein yield. Furthermore, it can efficiently secrete recombinant proteins into the extracellular space, reducing the burden of downstream purification. Therefore, it is considered one of the best hosts for industrial expression.
[0004] However, human type III collagen fragments are typically rich in small-molecule amino acids such as glycine, exhibiting high molecular flexibility and complex conformation. During secretory expression in Pichia pastoris, they can place a significant burden on the endoplasmic reticulum protein folding and secretion system, leading to problems such as protein misfolding, intracellular accumulation, or degradation, resulting in low secretion efficiency and unstable protein quality. These problems are particularly pronounced under high-level expression conditions, severely restricting the large-scale preparation of collagen fragments in the Pichia pastoris system.
[0005] Current technologies addressing collagen expression in Pichia pastoris primarily focus on optimizing single aspects such as expression vector selection, promoter regulation, or fermentation conditions. These approaches fail to address the overall imbalance between endoplasmic reticulum protein folding and secretion homeostasis. Therefore, a recombinant Pichia pastoris system capable of achieving efficient and stable secretory expression of collagen fragments while maintaining structural stability remains lacking. Summary of the Invention
[0006] Objective: The technical problem this invention aims to solve is that, in the prior art, the high flexibility and complex structure of human type III collagen fragments during secretory expression in Pichia pastoris easily lead to imbalances in endoplasmic reticulum protein folding and secretion homeostasis, resulting in protein misfolding, intracellular accumulation, low secretion efficiency, and insufficient structural stability. This invention provides a method for preparing human type III collagen fragments. This invention provides a recombinant Pichia pastoris expression system for efficient and stable secretory expression of human type III collagen fragments and its applications.
[0007] To address the aforementioned technical problems, this invention discloses a method for preparing human type III collagen fragments, including a recombinant Pichia pastoris expression system for efficient secretory expression of human type III collagen fragments and its application. The specific technical solution is as follows: In a first aspect, the present invention provides a method for preparing human type III collagen fragments, comprising the following steps: (1) Construct a recombinant Pichia pastoris expressing the gene encoding a human type III collagen fragment and the gene encoding a transcription factor; the human type III collagen fragment has high structural uniformity and reversible folding characteristics; the transcription factor is used to regulate the endoplasmic reticulum unfolded protein response pathway of Pichia pastoris, alleviate the endoplasmic reticulum stress response caused by high-level expression of collagen fragment, and reconstruct endoplasmic reticulum protein folding and secretion homeostasis.
[0008] (2) The seed culture of the recombinant Pichia pastoris was inoculated into the fermentation medium and cultured until the methanol induction stage. Methanol and glycine were added to continue the fermentation culture to obtain human type III collagen fragments. Methanol was added to induce protein expression and glycine was added to provide collagen synthesis precursors. That is, methanol and glycine were added at the same time during the methanol induction stage to continue the fermentation culture.
[0009] The fermentation medium includes inorganic salts. Through the synergistic effect of the transcriptional regulatory factors and the culture environment, the endoplasmic reticulum protein folding and secretory homeostasis of Pichia pastoris are reconstructed, thereby achieving efficient and stable extracellular secretory expression of human type III collagen fragments.
[0010] The nucleotide sequence of the gene encoding the human type III collagen fragment is shown in SEQ ID NO.1, and the nucleotide sequence of the gene encoding the transcription regulatory factor is shown in SEQ ID NO.2.
[0011] The recombinant Pichia pastoris expresses 1-4 copies of the human type III collagen fragment encoding gene. In some embodiments of the present invention, the recombinant Pichia pastoris expresses 2 copies of the human type III collagen fragment encoding gene.
[0012] The recombinant Pichia pastoris mentioned herein includes Pichia pastoris as the originating strain. Pichia pastoris GS115.
[0013] The human type III collagen fragment encoding gene is expressed using a methanol-inducible promoter, which includes promoter AOX1.
[0014] In some embodiments of the present invention, the human type III collagen fragment encoding gene is expressed using an expression vector, wherein the expression vector includes pPIC9K.
[0015] In some embodiments of the present invention, the recombinant Pichia pastoris is constructed as follows: a codon-optimized human type III collagen fragment encoding gene is introduced into a Pichia pastoris host cell, and a transcription factor encoding gene is co-expressed in the host cell to obtain a recombinant Pichia pastoris capable of stably secreting and expressing collagen fragments. The human type III collagen fragment encoding gene and the transcription factor encoding gene are respectively integrated into or transformed into the host cell.
[0016] The methanol concentration is 0.5%~1% v / v, and the glycine concentration is 10~30 g / L. In some embodiments of the present invention, the methanol concentration is 0.7%~0.8% v / v, and methanol is added every 24 h during the methanol induction phase until the final concentration is 0.75% v / v; the glycine concentration is 20 g / L.
[0017] The inorganic salts include 5-14 g / L KH₂PO₄, 3-8 g / L (NH₄)₂SO₄, 3-10 g / L K₂SO₄, 0.2-0.5 g / L MgSO₄·7H₂O, and 0.01-0.05 g / L CaSO₄·2H₂O. This inorganic salt formulation is for fermenter culture. In some embodiments of the present invention, the inorganic salts include 5.32 g / L KH₂PO₄, 3.2 g / L (NH₄)₂SO₄, 3.68 g / L K₂SO₄, 0.2 g / L MgSO₄·7H₂O, and 0.0184 g / L CaSO₄·2H₂O.
[0018] In some embodiments of the present invention, when the fermentation tank culture level is used, the fermentation medium is a modified BSM medium. The modified BSM medium comprises: 40 g / L glycerol, 5.32 g / L KH₂PO₄, 3.2 g / L (NH₄)₂SO₄, 3.68 g / L K₂SO₄, 0.2 g / L MgSO₄·7H₂O, 0.0184 g / L CaSO₄·2H₂O, and 4.35 mL / L PTM₁ trace element solution. The PTM1 trace element solution comprises: FeSO4·7H2O 65.0 g / L, ZnCl2 20.0 g / L, CuSO4·5H2O 6.0 g / L, CoCl2·6H2O 5.0 g / L, MnSO4·H2O 3.0 g / L, Na2MoO4·2H2O 0.2 g / L, H3BO3 0.02 g / L, KI 0.5 g / L, and H2SO4 5.0 mL / L. To achieve low-salt regulation, the BSM modified medium involves simultaneously adjusting the concentrations of all inorganic salt components (KH2PO4, (NH4)2SO4, K2SO4, MgSO4·7H2O, and CaSO4·2H2O) in the BSM medium to 40% of the standard formulation (i.e., each inorganic salt component is prepared at 40% of the standard amount).
[0019] In other embodiments of the invention, when the fermentation level is shake flask fermentation, the inorganic salt is phosphate buffer. Further, the fermentation medium is BMGY medium. After culturing to the methanol induction stage, the medium is replaced with a modified BMGY medium formulation, comprising 10-20 g / L yeast extract, 10-20 g / L peptone, 10-20 g / L YNB, and 4-5 × 10⁻⁶ ppm. -4 The solution consists of g / L biotin, 5-10 g / L methanol, 10-30 g / L glycine, and 30-100 mM phosphate buffer (pH 5.0-6.0). The concentration of the phosphate buffer can be adjusted to 30%-100% of the standard concentration (100 mM), preferably 40 mM (i.e., 40% of the standard concentration), to achieve low-salt regulation.
[0020] The culture temperature during the methanol induction phase is 20–28 °C, and the culture time is 72–120 h. In some embodiments of the present invention, during the methanol induction phase, methanol is added every 24 h to a final concentration of 0.7%–0.8% v / v to induce protein expression.
[0021] The initial pH of the fermentation medium is 5.0 to 6.0. In some embodiments of the present invention, the initial pH of the fermentation medium is 6.0.
[0022] In some embodiments of the present invention, the seed culture of the recombinant Pichia pastoris is inoculated into a fermentation medium and cultured at 28-32 °C until OD. 600 When the value is 200, the methanol induction stage begins.
[0023] In some embodiments of the present invention, the fermentation medium comprises 10-40 g / L glycerol.
[0024] The method described in this invention is applicable to the large-scale production of human type III collagen fragments.
[0025] Beneficial effects: This invention uses Pichia pastoris Pichia pastoris Using GS115 as the expression host, this invention optimizes the codons of the gene encoding human type III collagen fragments and co-expresses HAC1, a transcriptional regulator of the endoplasmic reticulum unfolded protein response pathway, to synergistically regulate the endoplasmic reticulum protein folding and secretion processes. Building upon this modification, the invention further constructs a multidimensional synergistic expression system of "molecular chaperone co-expression - precursor supply - osmotic pressure adaptation regulation" by directionally supplementing the collagen-specific precursor amino acid glycine and synergistically reducing culture medium salt concentration, optimizing induction initiation cell density, and pH fermentation conditions. This reduces the structural instability of collagen fragments during secretion and post-processing, creating an expression system suitable for stable and efficient secretion of collagen fragments. The specific beneficial effects are as follows: (1) This invention, through the synergistic regulation of transcription factor HAC1 and fermentation culture environment, simultaneously acts on two key limiting links in the secretory expression process of collagen fragments: protein folding and secretion homeostasis, significantly improving the correct folding ratio of collagen fragments and their effective accumulation level in the extracellular environment. (2) The present invention can effectively reduce the ineffective consumption of collagen fragments during expression due to misfolding, intracellular accumulation or degradation, and improve the stability of the expression system; (3) Based on the above core system regulation strategy, the structural stability and secretion efficiency of collagen fragments were further improved by low salt conditions and the introduction of exogenous glycine, so that the obtained protein has a high level; (4) The recombinant Pichia pastoris expression system constructed in this invention has a clear genetic background, mild culture conditions, and easy-to-control fermentation process. The protein yield can reach 6.55 g / L under 5 L fermenter conditions, which has good prospects for industrial application. Attached Figure Description
[0026] The present invention will be further described in detail below with reference to the accompanying drawings and specific embodiments, and the advantages of the present invention in the above and / or other aspects will become clearer.
[0027] Figure 1This is a map of the pPIC9K-Pro1 plasmid.
[0028] Figure 2 This is a map of the pGAPZA-HAC1 plasmid.
[0029] Figure 3 The image shows the SDS-PAGE analysis of yeast fermentation supernatant. Lane M represents protein maker, and lane 1 represents type III collagen produced by fermentation of strain GS115-Pro1-1x.
[0030] Figure 4 The collagen production of strains GS115-Pro1-2x and H4-Pro1-2x was carried out in a 5 L fermenter.
[0031] Figure 5 The effect of adding different concentrations of precursor glycine on the collagen production of recombinant bacteria.
[0032] Figure 6 The effect of adding different salt concentrations on collagen production of strain H4-Pro1-2x.
[0033] Figure 7 The effects of different salt concentrations, expression of molecular chaperones, and addition of precursor glycine on collagen production in recombinant bacteria were investigated.
[0034] Figure 8 The effect of initial cell density on collagen production by strain H4-Pro1-2x. Detailed Implementation
[0035] The technical solution of the present invention will be further described below with reference to the accompanying drawings and specific embodiments. Unless otherwise specified, the experimental methods described in the following embodiments are conventional methods; the reagents and materials described are commercially available unless otherwise specified. In the following embodiments, unless otherwise specified, all percentages refer to g / mL.
[0036] In the following examples, the transformant screening medium consisted of 2% peptone, 1% yeast extract, 2% glucose, 2% agar powder, 0.01% bleomycin or 0.3% genimycin (G418).
[0037] In the following examples, the LB medium consisted of 1% peptone, 0.5% yeast extract, 1% sodium chloride, 0.01% bleomycin or 0.01% ampicillin, with 2% agar powder added to the solids.
[0038] In the following examples, the YPG culture medium consists of 1% yeast extract, 2% peptone, and 2% glycerol.
[0039] The BMGY fermentation medium consisted of 1% yeast extract, 2% peptone, 100 mM potassium phosphate buffer (pH 6.0), 1.34% YNB, and 4 x 10⁻⁶ ppm. -5 % Biotin, 2% Glycerin.
[0040] The BMMY induction medium consisted of 1% yeast extract, 2% peptone, 100 mM potassium phosphate buffer (pH 6.0), 1.34% YNB, and 4 x 10⁻⁶ ppm. -5 % Biotin, 0.75% Methanol.
[0041] The BSM culture medium (g / L) contains: glycerol 40, KH2PO4 13.3, (NH4)2SO4 8.0, K2SO4 9.2, MgSO4·7H2O 0.5, CaSO4·2H2O 0.046, and PTM1 trace element solution 4.35 mL / L.
[0042] The optimized fermenter culture medium (g / L) consisted of: glycerol 40, KH2PO4 5.32, (NH4)2SO4 3.2, K2SO4 3.68, MgSO4·7H2O 0.2, CaSO4·2H2O 0.0184, and PTM1 trace element solution 4.35 mL / L.
[0043] The PTM1 trace element solution is composed of: FeSO4·7H2O 65.0 g / L, ZnCl2 20.0 g / L, CuSO4·5H2O 6.0 g / L, CoCl2·6H2O 5.0 g / L, MnSO4·H2O 3.0 g / L, Na2MoO4·2H2O 0.2 g / L, H3BO3 0.02 g / L, KI 0.5 g / L, and H2SO4 5.0 mL / L.
[0044] Except for the antibiotic resistance solution, YNB, methanol, biotin, glycine, and PTM1 trace element solution, which require filtration sterilization, all other components of the culture medium were sterilized at 115 °C for 20 min.
[0045] In the following examples, the protein concentration of the human type III collagen was detected as follows: After fermentation, the fermentation broth was centrifuged at 8000 rpm for 10 min to remove the bacterial cells. The fermentation supernatant was collected as the test sample, and the protein concentration was determined using the Bradford method. Bovine serum albumin (BSA) was used as a standard to prepare a series of standard solutions with concentrations of 0, 25, 125, 250, 500, 750, and 1000 μg / mL. 4 μL of each concentration standard solution was added to each well of a 96-well plate, followed by 200 μL of Coomassie brilliant blue staining solution. After gentle mixing, the plate was incubated at room temperature for 5 min, and the absorbance (OD) at 595 nm was measured using a microplate reader. 595 Each concentration was measured three times and the average was taken. The values were plotted with protein content on the x-axis and OD on the y-axis. 595 A standard curve was plotted with the values on the ordinate. 4 μL of the fermentation supernatant was taken and processed using the same method to determine the OD. 595 The value is used to calculate the collagen content in the sample based on the standard curve.
[0046] Example 1 Construction of a recombinant Pichia pastoris expression system This embodiment illustrates a method for constructing a recombinant Pichia pastoris expression system for efficient secretory expression of human type III collagen fragments.
[0047] Pichia pastoris ( Pichia pastoris Using GS115 as the host strain, the Pro1 gene encoding the human type III collagen fragment was optimized based on the codon bias of Pichia pastoris. The optimized nucleotide sequence is shown in SEQ ID NO.1. The Pro1 gene was inserted into the multiple cloning site of the Pichia pastoris expression vector pPIC9K, using the following restriction enzyme sites: Hind III and BamH I. Obtain the recombinant plasmid pPIC9K-Pro1 (e.g.) Figure 1 (As shown). The recombinant plasmid pPIC9K-Pro1 utilizes... Xba I. Restriction endonucleases were linearized and transformed into the expression host strain, Pichia pastoris. Pichia pastoris GS115 was spread on MD plates and incubated at 30 °C for 2–3 days. His... + The transformants were further screened for multi-copy integration transformants on YPD plates containing G418 (0.5, 1, 2, 4 mg / mL) to obtain single-copy (GS115-Pro1-1x), double-copy (GS115-Pro1-2x), and quadruple-copy (GS115-Pro1-4x) strains.
[0048] Using recombinant Pichia pastoris strains with different copy numbers obtained above as hosts, the transcriptional regulator HAC1 of the endoplasmic reticulum unfolded protein response pathway was co-expressed to regulate the expression of genes related to endoplasmic reticulum protein folding and secretion, thereby alleviating the endoplasmic reticulum stress response induced by high-level collagen fragment expression. The HAC1 gene is derived from Pichia pastoris. Pichia pastoris The GS115 genome. The HAC1 gene contains intronic structures at the genomic level; its mature mRNA requires post-transcriptional processing, and it contains an intron at position 28-33 of its 5' end. Nhe I site. Based on the aforementioned gene structural characteristics, the main portion of HAC1 was amplified using HAC1-F-1st and HAC1-R-1st, and then HAC1-F- EcoR I and HAC1-R- Not The remaining sequence was spliced together, and the complete coding sequence was obtained by segmented amplification and splicing, as shown in SEQ ID NO.2. The gene shown in SEQ ID NO.2 was inserted into the multiple cloning site of the intracellular expression vector pGAPZA, using the following restriction enzyme sites: EcoR I and Not I. Obtain the recombinant plasmid pGAPZA-HAC1 (e.g., ...) Figure 2 (As shown). The recombinant plasmid pGAPZA-HAC1 utilizes Sac I. Restriction endonucleases were linearized and transformed into recombinant bacteria GS115-Pro1-1x, GS115-Pro1-2x, and GS115-Pro1-4x. Transformants were selected using 0.1 g / L bleomycin selection medium plates and incubated at 25 °C for 3–5 days until growth. Colony PCR was performed using primers HAC1-F / R to verify the transformations, yielding engineered strains H4-Pro1-1x, H4-Pro1-2x, and H4-Pro1-4x co-expressing HAC1. The primer sequences used are shown below (5'–3'): HAC1-F-1st: ATGCCCGTAGATTCTTCTCATAAGACAGCTAGTCCACTTCCACCTCGTAAA AGAG; HAC1-R-1st: CATTTAAATCAAATGCATTAGCGGTAAATGGTGCTGCTGGATGATGCAACCGATTCG; HAC1-F- EcoR I:GGAATTCATGCCCGTAGATTCTTCTCATAAG; HAC1-R- Not I: TAGTTTAGCGGCCGCCTATTCCTGGAAGAATACAAAGTCATTTAAATCAAATGCATTAG; HAC1-F: CTATTTCAATCAATTGAACAACTAT; HAC1-R:GCATTCTGACATCCTCTTGA.
[0049] Example 2: Recombinant Pichia pastoris secretes and expresses a human type III collagen fragment. This embodiment illustrates the effect of the recombinant Pichia pastoris expression system on the secretion and expression of human type III collagen fragments under fermentation conditions.
[0050] Single colonies of the recombinant Pichia pastoris strains GS115-Pro1-1x, GS115-Pro1-2x, GS115-Pro1-4x, H4-Pro1-1x, H4-Pro1-2x, and H4-Pro1-4x obtained in Example 1 were inoculated into 5 mL of YPG liquid medium and cultured at 30 ℃ and 200 rpm for 36 h to obtain seed culture. 1 mL of seed culture was added to 50 mL of BMGY fermentation medium and cultured at 30 ℃ and 180 rpm for 24 h. The precipitate was collected by centrifugation at 7000 rpm for 3 min, washed twice with pre-cooled sterile water, and then resuspended in 20 mL of BMMY induction medium. Expression was induced at 25 ℃ for 96 h, with 0.75% v / v methanol added every 24 h during induction. After induction, the fermentation broth was centrifuged at 8000 rpm for 10 min, and the fermentation supernatant was collected for SDS-PAGE analysis. The fermentation results of strain GS115-Pro1-1x are as follows: Figure 3 As shown, a single, clear target protein band appeared in the fermentation supernatant, indicating that the constructed recombinant Pichia pastoris can effectively secrete human type III collagen fragments into the extracellular culture medium.
[0051] Next, the protein concentration of the fermentation supernatant was measured to further compare the effects of gene copy number and HAC1 co-expression on collagen expression levels. The results are shown in Table 1. The results showed that in the GS115-Pro1 group without HAC1 co-expression, collagen production increased slowly from 0.115 g / L to 0.129 g / L as the copy number increased from one copy to four copies, with a limited increase. However, in the H4-Pro1 group with HAC1 co-expression, the expression levels at each copy number were significantly higher than those in the corresponding GS115-Pro1 group. The H4-Pro1-2x strain had the highest expression level, reaching 0.236 g / L, approximately 1.98 times higher than the GS115-Pro1-2x strain (0.119 g / L). These results indicate that simply increasing the copy number has a limited effect on promoting expression, while co-expression of HAC1 can effectively overcome the expression bottleneck. The H4-Pro1-2x strain with two copies of Pro1 and HAC1 co-expression is the optimal genetically modified combination at the shake-flask level in this system.
[0052] Table 1. Collagen production of strains with different copy numbers at the shake-flask level.
[0053] To further verify the expression performance of the described expression system under large-scale culture conditions, strains GS115-Pro1-2x and H4-Pro1-2x obtained from shake-flask screening were scaled up in a 5 L fermenter. The fermentation process followed the standard Pichia pastoris high-density fermentation procedure, consisting of three stages: glycerol batch culture, glycerol fed-batch culture, and methanol induction, as detailed below: (1) Glycerol batch culture stage: The seed culture obtained above was inoculated into a 5 L fermenter containing 3 LBSM medium at an inoculation rate of 10% (v / v). The initial culture temperature was 30 ℃, and the pH was controlled at 5.5 by automatic addition of ammonia water. The dissolved oxygen (DO) was maintained above 20% by linkage between the stirring speed and the aeration rate. This stage of culture lasted for about 20-24 h until the initial glycerol in the medium was completely depleted, which was manifested by a sudden increase in dissolved oxygen value (DO rebound), marking the end of the glycerol batch culture stage; (2) Glycerol-feeding culture stage: After the glycerol is depleted, start adding a 50% (w / v) glycerol feed solution containing 12 mL / L PTM1 trace element solution, at a feed rate of 10-15 mL / L / h, and continue culturing for about 4-6 h to achieve high-density cell accumulation. During this stage, maintain the temperature at 30 ℃, pH 5.5, and DO above 20%. When the cell OD... 600 When the dissolved oxygen level reaches 200, stop feeding glycerol and starve the culture for 30-60 minutes. After the dissolved oxygen level rises again, start the methanol induction phase. (3) Methanol induction phase: After stopping glycerol feeding, 100% methanol containing 12 mL / L PTM1 trace element solution was added to induce expression. A low methanol flow rate (approximately 1 mL / L / h) was used initially to allow the cells to adapt, followed by adding methanol every 24 h to a final concentration of 0.75% (v / v), maintaining DO above 20%. The induction temperature was adjusted to 25 ℃, and the pH was controlled at 6.0. Protein expression was measured every 24 h during induction, with a total induction time of 72–96 h.
[0054] The results show that, Figure 4 As shown, under the above optimized conditions, the H4-Pro1-2x strain achieved a collagen yield of 1.70 g / L in a 5 L fermenter, which is about 7.20 times higher than the shake flask level (0.236 g / L).
[0055] Example 3: Effects of culture medium conditions and environment on the expression of human type III collagen fragments This example, based on Example 2, further investigates the effects of adding glycine to the culture medium and adjusting the salt concentration on collagen expression. The culture medium was BSM medium, and the recombinant strain was cultured in a 5L fermenter. Unless otherwise specified, the culture method was the same as the standard Pichia pastoris high-density fermentation process in Example 2. The specific experimental setup is as follows: (1) Optimization of amino acid supplementation Given that glycine constitutes the highest proportion of the amino acid composition of human type III collagen Pro1, this invention used H4-Pro1-2x as the fermentation host to investigate the effect of exogenous glycine addition on expression levels. The effect of glycine concentration on collagen expression was further investigated at the 5 L fermenter level. Using H4-Pro1-2x as the fermentation host, 0, 10, 20, and 30 g / L of glycine were added during the methanol induction phase, with other culture conditions the same as in Example 2. The results are as follows: Figure 5 As shown, the expression effect was optimal with the addition of 20 g / L glycine, with collagen production reaching 2.35 g / L, approximately 1.38 times higher than the group without glycine. This indicates that exogenous supplementation with glycine, a characteristic precursor amino acid of collagen, can effectively promote the synthesis and accumulation of the target protein.
[0056] (2) Optimization of culture medium salt concentration To investigate the effect of osmotic pressure on collagen expression, this invention, while keeping other components constant, adjusted the concentrations of inorganic salt components (including KH₂PO₄, (NH₄)₂SO₄, K₂SO₄, MgSO₄·7H₂O, and CaSO₄·2H₂O) in the BSM medium to 50%, 40%, and 30% of the concentrations described in Example 2, respectively. Using H₄-Pro1-2x as the fermentation host, expression was induced according to the method in Example 2. The results are as follows... Figure 6 As shown, appropriately reducing the salt concentration is beneficial to improving collagen expression levels: the 40% salt concentration group showed the best expression effect, with a yield of 2.62 g / L, which is about 1.54 times higher than the standard salt concentration group (1.70 g / L); the 50% salt concentration group also showed a significant improvement; however, the yield decreased in the 30% salt concentration group. The results indicate that moderately reducing osmotic pressure helps improve the expression efficiency of recombinant proteins, but excessively low salt concentration is detrimental to cell stability and product accumulation. In this system, a 40% salt concentration is the optimal choice.
[0057] (3) Validation of the multidimensional synergistic expression system Based on the single-factor optimization described above, this invention further investigates the synergistic effect of "co-expression of transcriptional regulatory factors - glycine supplementation - low-salt regulation," i.e., a multidimensional synergistic expression system. The following experimental groups were set up: H4-Pro1-2x strain: This strain expresses two copies of Pro1 protein and co-expresses HAC1. The fermentation process of this strain is carried out under 40% salt concentration with the addition of 20.0 g / L glycine. This fermentation medium is the optimized fermenter medium. GS115-Pro1-2x strain: This strain expresses two copies of Pro1 protein and does not co-express HAC1. The fermentation process of this strain is carried out with 20.0 g / L glycine added under 40% salt concentration conditions as a control.
[0058] Both groups underwent expression induction according to the method in Example 2. The results are as follows: Figure 7 As shown, under optimized conditions of 40% salt concentration and 20 g / L glycine addition, the H4-Pro1-2x strain achieved a yield of 5.24 g / L, which is approximately 3.08 times higher than the basic fermentation conditions (the yield of H4-Pro1-2x under standard fermentation conditions in Example 2 was 1.70 g / L). In contrast, the control group GS115-Pro1-2x only achieved a yield increase of approximately 1.95 times under the same optimized conditions. Furthermore, compared to the GS115-Pro1-2x strain, the multidimensional synergistic expression system showed a 6.16-fold increase in yield, significantly higher than the sum of individual optimization strategies. These results fully demonstrate that the "molecular chaperone co-expression-precursor supply-osmotic pressure adaptation regulation" multidimensional synergistic expression system constructed in this invention has a significant synergistic effect, enabling efficient and stable secretory expression of human type III collagen fragments.
[0059] (4) Optimization of initial pH during fermentation and initial strain concentration during induction phase To investigate the regulatory effect of initial pH on expression kinetics, based on the optimized culture conditions (40% salt concentration, 20 g / L glycine supplementation, engineered strain H4-pro1-2x), BSM medium was prepared in a 5 L fermenter with initial pH values of 3.0, 4.0, 5.0, and 6.0. The results showed that an initial pH in the neutral to slightly acidic range (5.0-6.0) was conducive to efficient collagen expression and accumulation. The pH 6.0 group exhibited the best expression effect, with a collagen yield of 6.55 g / L; the pH 5.0 group was second best; the pH 4.0 group showed delayed expression and weak overall intensity; and the pH 3.0 group showed almost no detectable target protein band, suggesting that protein expression and secretion are limited under extremely acidic conditions.
[0060] To evaluate the effect of different cell densities at the induction initiation on collagen expression, three induction initiation OD groups were set up in a 5L fermenter based on the optimized conditions described above (40% salt concentration, 20 g / L glycine addition, initial fermentation pH 6.0, engineered strain H4-pro1-2x). 600 Values: approximately 100, 200, and 300. Results show ( Figure 8 ), OD 600 The highest yield was observed in group 200, with a final yield of 6.55 g / L, demonstrating good expression initiation rate and peak accumulation ability. OD 600 In group 100, due to low cell concentration during induction, expression initiation was delayed and accumulation was slow, resulting in a final yield of 5.21 g / L; OD 600 Although the 300 groups started earlier, the increase in expression level was limited, and the final yield was 6.02 g / L. It is speculated that the excessively high induction density may have caused metabolic load or oxygen limitation.
[0061] This invention provides a method for preparing human type III collagen fragments. Many methods and approaches exist for implementing this technical solution; the above description is merely a preferred embodiment. It should be noted that those skilled in the art can make various improvements and modifications without departing from the principles of this invention, and these improvements and modifications should also be considered within the scope of protection of this invention. All components not explicitly stated in this embodiment can be implemented using existing technologies.
Claims
1. A method for preparing human type III collagen fragments, characterized in that, Includes the following steps: (1) Construct a recombinant Pichia pastoris expressing the gene encoding a human type III collagen fragment and the gene encoding a transcriptional regulatory factor; (2) The seed culture of the recombinant Pichia pastoris was inoculated into the fermentation medium and cultured until the methanol induction stage. Methanol and glycine were added to continue the fermentation culture to obtain human type III collagen fragments. The fermentation medium includes inorganic salts.
2. The method according to claim 1, characterized in that, The nucleotide sequence of the gene encoding the human type III collagen fragment is shown in SEQ ID NO.1, and the nucleotide sequence of the gene encoding the transcription regulatory factor is shown in SEQ ID NO.
2.
3. The method according to claim 1, characterized in that, The recombinant Pichia pastoris expressed 1-4 copies of the gene encoding a human type III collagen fragment.
4. The method according to claim 1, characterized in that, The recombinant Pichia pastoris mentioned above, whose originating strain includes Pichia pastoris. Pichia pastoris GS115.
5. The method according to claim 1, characterized in that, The gene encoding the human type III collagen fragment was expressed using a methanol-inducible promoter.
6. The method according to claim 5, characterized in that, The methanol-induced promoter includes promoter AOX1.
7. The method according to claim 1, characterized in that, The concentration of methanol added is 0.5%~1% v / v, and the concentration of glycine added is 10~30 g / L.
8. The method according to claim 1, characterized in that, The inorganic salts include 5~14 g / L KH2PO4, 3~8 g / L (NH4)2SO4, 3~10 g / L K2SO4, 0.2~0.5 g / L MgSO4·7H2O and 0.01~0.05 g / L CaSO4·2H2O.
9. The method according to claim 1, characterized in that, The culture temperature for the methanol induction phase is 20~28℃, and the culture time is 72~120 h.
10. The method according to claim 1, characterized in that, The initial pH of the fermentation medium is 5.0~6.0.