Real-time fluorescence quantitative PCR detection method for Panax notoginseng virus A

Abstract

The invention provides a real-time fluorescence quantitative PCR detection method for Panax notoginseng A virus. The method uses cDNA of a contaminated material as a template, uses PnVA-cp-F and PnVA-cp-R as primers to perform PCR amplification, obtains a recombinant plasmid standard product pGEM-T-PnVA, prepares recombinant plasmid standards of different concentrations, uses the recombinant plasmid standard product as a template, uses specific primers PnVA-QF and PnVA-QR to perform real-time fluorescence quantitative PCR, and constructs a standard curve with Ct values ​​of the plasmid standards of different concentrations; performs real-time fluorescence quantitative PCR on a sample to be tested under the same conditions, and realizes quantitative detection of Panax notoginseng A virus in the test material by comparing the Ct value with the standard curve; the method has the advantages of being rapid and simple, highly sensitive, highly specific, and the like, solves the defects of existing detection means that are complicated, time-consuming, and have a long cycle, and have certain requirements on the operating laboratory, and has a good application prospect.

Description

Technical Field

[0001] The present invention relates to the field of plant virus molecular detection, and in particular to a real-time fluorescence quantitative PCR detection method for notoginseng A virus. Background Art

[0002] Panax notoginseng Panaxnotoginseng (Burk.) FH Chen] is a perennial medicinal herb of the genus Panax in the Araliaceae family. It has multiple functions such as relieving pain and swelling, stopping bleeding and dispersing blood stasis, anti-cancer, anti-hypertension, improving immunity and protecting cardiovascular and cerebrovascular vessels. It is widely used as a clinical drug and tonic product. Panax notoginseng contains a variety of chemical components, among which Panax notoginseng total saponin is one of the main effective active ingredients, with a content of about 8% to 12%. In addition, Panax notoginseng also contains compounds such as alcohols, flavonoids, nucleosides, alkaloids, proteins, vitamin C, and various inorganic elements such as potassium, magnesium, and calcium, which are the special basis for Panax notoginseng to have multiple functions.

[0003] In recent years, the harm of plant virus diseases in countries around the world has become increasingly serious, and the number of virus species discovered and reported has increased. The detection and identification of plant viruses is the basic work for understanding viral diseases and preventing and controlling viral diseases, and it is also an important part of plant virus taxonomy research. In the early part of the last century, the identification and classification of plant viruses were mainly based on biological traits such as host range, symptoms, and vector transmission methods; later, physical and chemical property analysis and serological techniques were widely used in the identification and classification of plant viruses. With the rapid development of molecular biology, many molecular biology techniques have been applied to the detection and identification of plant viruses, providing rich and reliable technologies for virus classification and identification. In recent years, virus detection technology has continued to develop and progress, and there are more and more methods for diagnosing and detecting plant viruses, forming a systematic system.

[0004] Panax notoginseng is mainly produced in Wenshan Prefecture, Yunnan. With the rapid development of the Panax notoginseng industry in recent years, some problems have also emerged in large-scale production. Among them, the increasingly serious Panax notoginseng virus disease has had a serious impact on the yield and quality of Panax notoginseng. In the relevant reports on Panax notoginseng virus disease, Chen Yanfang et al. identified Panax notoginseng virus disease through host range determination, electron microscopy observation and serological detection (Chen Yanfang, Jin Yu, Li Guifen, et al. Preliminary report on identification of Panax notoginseng virus disease. Plant Quarantine, 2004(04): 212-213). Jin Yu et al. used biological, serological and molecular biological methods to identify the pathogen of Panax notoginseng virus disease (Jin Yu. Preliminary study on the pathogen of Panax notoginseng virus disease. Northeast Agricultural University, 2005). In addition, Yang Xin et al. used PCR / RT-PCR technology to detect and identify viruses in Panax notoginseng leaf samples with suspected viral disease symptoms (Yang Xin, Meng Yu, Li Meirong, et al. Occurrence of Panax notoginseng virus disease in Yunnan and detection of virus species. Acta Phytopathologica Sinica, 2019, 49(04): 456-464). Currently, viruses found to infect Panax notoginseng include Cucumber mosaic virus (CMV), Tomato masaic virus (ToMV), Tomato spotted wiltvirus (TSWV), Panax virus Y (PnVY), Tomato yellow leaf curl China virus (TYLCCNV) and its satellite (Tomato yellow leaf curl China betasatellite, TYLCCNB), Panax notoginseng virus A (PnVA) and Tobacco vein distorting virus (TVDV). In addition, some studies have divided Panax notoginseng infected with virus diseases into seven types: wrinkled type, pitted leaf spot type, chlorotic type, mosaic type, donkey ear type, clump top type, and complex type (Chen Yujun et al. Study on the relationship between Panax notoginseng wrinkled virus disease and environmental factors. Modern Agricultural Science and Technology, 2014, 16: 108-109). After the virus infects Panax notoginseng, the height, stem thickness, leaf length, leaf width, and fresh weight of the diseased plants are significantly reduced, and some Panax notoginseng gardens will be completely destroyed. At present, due to the use of diseased seeds (seedlings) in production, the mixed excavation, transportation and storage of diseased and healthy plants, as well as the small number of existing commercial virus disease agents and poor prevention effects, the harm of Panax notoginseng virus disease is spreading, which has seriously affected the yield and quality of Panax notoginseng.

[0005] Panax notoginseng virus A (PnVA) is a new type of virus discovered in Panax notoginseng in recent years (Guo LF, Yang X, Wu W, et al. Identification and molecular characterization of Panaxnotoginseng virus A, which may represent an undescribed novel species of the genus Totivirus , family Totiviridae[J]. Archives of Virology, 2016, 16(3): 731-734). The above study isolated a double-stranded RNA (dsRNA) from Panax notoginseng. The double-stranded RNA (PN-S) is 5003bp long and has a genome structure similar to that of the Totiviridae virus. The protein encoded by this dsRNA PN-S has a high amino acid homology with the ribonuclease polymerase (RdRp) and coat protein (Cp) of the Totiviridae black raspberry virus F (BrVF). Therefore, it is speculated that the dsRNA PN-S may be the genome of a new type of Totiviridae virus, and then this new virus is named Panax notoginseng A virus (PnVA), and it is believed that PnVA has the same infection ability as other Totiviridae viruses. In addition, PnVA was identified from susceptible Panax notoginseng that showed mosaic symptoms. Since the single source of most Panax notoginseng viruses has not yet been obtained and the conditions for the growth of Panax notoginseng are limited, the verification of the correlation between a single PnVA and the combined infection of multiple viruses with Panax notoginseng symptoms has not yet been completed.

[0006] As a highly sensitive and specific nucleic acid detection method, real-time fluorescence quantitative PCR technology is faster and more accurate than virus isolation and culture and electron microscopy observation, and has been widely used in the diagnosis and prevention and control of plant diseases caused by fungi, bacteria, viruses, nematodes, etc. In addition, when studying the mechanism and occurrence of plant diseases, the dynamic changes in the content of plant viruses in complex environments can also be learned, providing technical support for prevention, early diagnosis and dynamic monitoring. Summary of the invention

[0007] The present invention provides a real-time fluorescence quantitative PCR detection method for Panax notoginseng A virus (PnVA), which can realize the quantitative detection of Panax notoginseng A virus in a test material and has the technical characteristics of short detection time and high sensitivity.

[0008] The real-time fluorescence quantitative PCR detection method of Panax notoginseng A virus of the present invention is as follows:

[0009] (1) Using the cDNA of Panax notoginseng infected with Panax notoginseng virus A as a template, PCR amplification was performed using primers PnVA-cp-F and PnVA-cp-R. After the PCR amplification product was recovered and purified, it was ligated with the pGEM-T vector and transformed into competent Escherichia coli cells. Positive clones were picked to extract plasmids to obtain the pGEM-T-PnVA standard of the recombinant plasmid, wherein the nucleotide sequence of the primer PnVA-cp-F is shown in SEQ ID NO: 1, and the nucleotide sequence of the primer PnVA-cp-R is shown in SEQ ID NO: 2;

[0010] (2) preparing a series of recombinant plasmid standard solutions with a concentration gradient, and using the recombinant plasmid standard solutions as templates, using the upstream primer PnVA-QF and the downstream primer PnVA-QR to perform real-time fluorescence quantitative PCR, using the logarithmic value of the copy number concentration of the recombinant plasmid standard as the abscissa and the Ct value as the ordinate to obtain a linear regression equation and establish a standard curve, wherein the nucleotide sequence of the specific primer PnVA-QF is shown in SEQ ID NO:3, and the nucleotide sequence of PnVA-QR is shown in SEQ ID NO:4;

[0011] (3) Extracting total RNA from the sample to be tested, and using the RNA as a template for reverse transcription to obtain cDNA of the sample to be tested, using the cDNA of the sample to be tested as a template, using upstream primer PnVA-QF and downstream primer PnVA-QR for real-time fluorescence quantitative PCR, and substituting the obtained Ct value into the constructed standard curve to achieve quantitative detection of Panax notoginseng A virus in the sample to be tested.

[0012] The reaction system of the real-time fluorescence quantitative PCR is 10 μL of 2×SYBR Green Mix, 7 μL of nuclease-free water, 1 μL of upstream primer PnVA-QF, 1 μL of downstream primer PnVA-QR, and 1 μL of cDNA template.

[0013] The method of the present invention can realize the quantitative determination of Panax notoginseng A virus in the sample to be tested, and the test results can be directly read out by computer software, without the need for gel electrophoresis and imaging detection. In addition, the detection method has the advantages of saving time and high sensitivity, and is suitable for industrial production and market promotion application. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] Figure 1A specific detection diagram of the real-time fluorescence quantitative PCR of the recombinant plasmid pGEM-T-PnVA provided in Example 2 of the present invention, wherein the horizontal axis is the cycle number, the vertical axis is the fluorescence signal intensity, and the curves on the figure are the amplification curves of the pGEM-T-PnVA recombinant plasmid, the pGEM-T-PCV4 (cp gene of ginseng latent virus 4) recombinant plasmid and RNase-Free ddH2O respectively;

[0015] Figure 2 The sensitivity test results of detecting PnVA by conventional PCR using PnVA-QF and PnVA-QR as specific primers; the product size of conventional PCR amplification using PnVA-QF and PnVA-QR as specific primers is 226 bp, where M is DNA ladder marker; 0 is negative control; 9 is 7.19×10 9 copies / μL; 8: 7.19×10 8 copies / μL; 7: 7.19×10 7 copies / μL; 6: 7.19×10 6 copies / μL; 5: 7.19×10 5 copies / μL; 4: 7.19×10 4 copies / μL; 3: 7.19×10 3 copies / μL; 2: 7.19×10 2 copies / μL;

[0016] Figure 3 The sensitivity test result diagram of PnVA analyzed by the detection method provided in Example 2 of the present invention; wherein the horizontal axis is the cycle number and the vertical axis is the fluorescence signal intensity; 8: 7.19×10 8 copies / μ L; 7: 7.19×10 7 copies / μL; 6: 7.19×10 6 copies / μL; 5: 7.19×10 5 copies / μL; 4: 7.19×10 4 copies / μL; 3: 7.19×10 3 copies / μL; 2: 7.19×10 2 copies / μL; 1: 7.19×10 copies / μL; 0: 7.19 copies / μL. DETAILED DESCRIPTION

[0017] The present invention is further described in detail below through the accompanying drawings and examples, but the protection scope of the present invention is not limited to the contents described. The methods in the examples are conventional methods unless otherwise specified, and the reagents used are conventional commercially available reagents or reagents prepared according to conventional methods unless otherwise specified.

[0018] It should be pointed out that in all embodiments and application examples of the present invention, the Panax notoginseng leaves infected with PnVA were collected from the Panax notoginseng planting base in Yanshan County, Wenshan Prefecture, Yunnan Province in April 2021.

[0019] Example 1: Obtaining Panax notoginseng A virus recombinant plasmid standard

[0020] Primer Primer5.0 software was used to design specific amplification primers for the coat protein (cp) gene of Panax notoginseng virus (PnVA) for the preparation of plasmid standards, labeled as PnVA-cp-F (gatgtaccaatttgtacctgc) and PnVA-cp-R (cctccatagccatactctcct). In addition, the specific primers were synthesized by Kunming Qingke Biotechnology Co., Ltd. Total RNA was extracted from the leaves of Panax notoginseng infected with Panax notoginseng virus A. The leaves were ground into powder with liquid nitrogen and then transferred into a centrifuge tube. Total RNA was extracted using the guanidine isothiocyanate method. The first-chain cDNA was synthesized using reverse transcriptase M-MLV (promega) with total RNA as a template. The reaction system and operation process were as follows: 5 μg of total RNA was taken, 50 ng of oligo (dT), 2 μL of dNTP (2.5 mMeach), and DEPC water were added in sequence to a reaction volume of 14.5 μL; after mixing, the mixture was heated at 70°C for denaturation for 5 min and then quickly cooled on ice for 5 min, and then 4 μL of 5×First-stand buffer, 0.5 μL RNasin (200 U), and 1 μL of M-MLV (200 U) were added in sequence, mixed and centrifuged for a short time, warmed at 42°C for 1.5 h, and then taken out and heated at 70°C for 10 min to terminate the reaction. After the first-chain cDNA was synthesized, it was stored at -20°C for later use.

[0021] Primers PnVA-cp-F and PnVA-cp-R were used to amplify the cDNA of the diseased Panax notoginseng leaves by PCR. After the amplified product was subjected to 1.2% agarose gel electrophoresis, a DNA gel recovery kit was used to excise and recover the specific band that met the target fragment size (665bp), purified, connected to the pGEM-T vector, and transformed into Escherichia coli DH5α competent cells. Positive clones were selected for culture, plasmids were extracted using a small amount extraction kit, and then sequenced and digested to obtain recombinant plasmid standards; the OD260 / OD280 ratio of the recombinant plasmid standard was between 1.8-2.0, with high purity, so the prepared standard curve can more accurately reflect the relationship between the Ct value and the starting template concentration.

[0022] Example 2: Establishment of a fluorescent quantitative PCR detection system for Panax notoginseng virus A

[0023] The mass concentration of the recombinant plasmid standard was converted into the copy number concentration according to the molecular weight of the recombinant plasmid standard. The formula used was copies / μL = (ng / μL × 10 -9 )×(6.02×10 23 ) / (DNA length×660) (Cheng Shengqun et al. Establishment and application of universal detection system of potato S virus RT-qPCR. Acta Agriculturae Boreali-Sinica, 2020, 35(6):187-194). Then, the pGEM-T-PnVA recombinant plasmid standard prepared in Example 1 of the present invention was diluted to 7.19×10 9 Copies / μL~7.19×10 1 100 copies / μL, with a total of 9 concentration gradients. Real-time fluorescence quantitative PCR was performed using the above-mentioned gradient-diluted recombinant plasmid standard as a template and PnVA-QF (tttcccaccggtcacttaat) and PnVA-QR (gtgtccgtgcgtgttgcttc) as primers. The reaction system of real-time fluorescence quantitative PCR was: 2×SYBR Green Mix 10μL, nuclease-free water 7μL, upstream primer PnVA-QF 1μL, downstream primer PnVA-QR 1μL, cDNA template 1μL. The amplification program was: pre-denaturation at 94℃ for 2min; denaturation at 94℃ for 5s, 60℃ for 30s, collecting fluorescence signals at 60℃, for a total of 40 cycles; melting curve analysis (60-95℃). After the reaction was completed, the standard curve was automatically generated using the analysis software. The concentration of PnVA recombinant plasmid was 7.19 × 10 2 ~7.19×10 9 When the Ct value was 0.01447 / μL, there was a good linear relationship between the Ct value and the logarithm of the PnVAcp gene recombinant plasmid copy number concentration. The correlation coefficient (R 2) reached 0.996, the amplification efficiency (E) was 105.5%, and the linear equation was y = -3.550 log(x) + 40.704; wherein, the logarithmic value of the copy number concentration of the recombinant plasmid standard was the x-axis, and the Ct value was the y-axis.

[0024] The copy number concentration of the recombinant plasmid standard showed a good linear relationship with the Ct value, and the correlation coefficient (R 2 ) reached 0.996, the amplification efficiency (E) was 105.5%, and the linear equation was y = -3.550log(x) + 40.704; wherein, the logarithmic value of the copy number concentration of the recombinant plasmid standard was the x-axis, and the Ct value was the y-axis.

[0025] In addition, in order to verify the effect of the real-time fluorescence quantitative PCR detection method provided by the present invention, the following experimental analysis was performed:

[0026] Specificity analysis

[0027] The recombinant plasmids pGEM-T-PnVA and pGEM-T-PCV4 (cp gene of ginseng latent virus 4) were prepared as templates according to the method of Example 1, and RNase-free ddH2O was used as a blank control. The established qPCR detection system for Panax notoginseng virus A was used for analysis. The results are shown in Figure 1 As shown in the figure, only the qPCR sample with pGEM-T-PnVA as the template has an obvious amplification curve, and the melting curve is a single peak. The control virus (pGEM-T-PCV4) and the blank control have no obvious peaks, indicating that the real-time fluorescence quantitative PCR established in this study has the specificity to detect PnVA.

[0028] Sensitivity comparison

[0029] The pGEM-T-PnVA plasmid (recombinant plasmid standard) provided in Example 2 of the present invention was diluted 10-fold to 7.19×10 9 ~7.19×10 0 The concentration gradient of 10 copies / μL was then used as a template, and RNase-free water (RNase-Free ddH2O) was used as a blank control for conventional PCR and real-time fluorescence quantitative PCR detection. Figure 2 The results showed that the detection limit of conventional PCR was 10 4 copies / μL. Figure 3 The results showed that the detection limit of real-time fluorescence quantitative PCR was 10 2 (CTvalue≤30) copies / μL, it can be seen that the sensitivity of real-time fluorescence quantitative PCR is 100 times that of conventional PCR.

[0030] Repeatability analysis

[0031] Select 7.19×10 9 -7.19×10 4 The recombinant plasmid standard with 6 dilutions of 10 copies / μL was used as a template for intra-group (three replicates of the same qPCR experiment) and inter-group (three qPCR experiments) real-time fluorescence quantitative PCR reactions, and the standard deviation (SD) and coefficient of variation (cv) of the Ct value were used as the judgment criteria. The analysis results are shown in Table 1. The maximum coefficient of variation of the intra-group replicates of the established qPCR system was 1.68%, and the maximum coefficient of variation of the inter-group replicates was 4.21% (Table 1), indicating that the established qPCR system has good repeatability.

[0032] Table 1 Repeatability analysis of real-time fluorescence quantitative PCR

[0033] .

[0034] Practical Example 3: Detection of Panax notoginseng virus A in diseased Panax notoginseng leaves in the field

[0035] 15 susceptible Panax notoginseng leaves were tested using the method of Example 2 of the present invention. Real-time fluorescence quantitative PCR was performed under the same amplification conditions as in Example 2. The obtained Ct value was compared with the standard curve. The analysis results are shown in Table 2. The detection rate of PnVA in the test samples was 100%, and the Ct value was 19.86-24.92. The detection results of the normally growing (healthy) Panax notoginseng leaves and the blank control were all negative, indicating that this method can be used for the detection of PnVA in Panax notoginseng virus disease samples.

[0036] Table 2 The test results of the present invention on 15 Panax notoginseng virus disease leaves

[0037]

[0038] Among them, in Table 2, "+" is positive, and "-" is negative; "Positive control" is the positive control, using pGEM-T-PnVA plasmid (recombinant plasmid standard) as the template for qPCR; "CK" is the blank control, using RNase-free water as the template for qPCR; "The virus-free plants" are normally growing (healthy) Panax notoginseng.

[0039] In summary, compared with the prior art, the detection method provided by the present invention has the advantages of high specificity and sensitivity, good repeatability, no pollution, and short time consumption. The embodiment of the present invention designs and synthesizes specific primers according to the sequence of the PnVAcp gene, and generates recombinant plasmids as standard products to construct a standard curve, establishes a real-time fluorescence quantitative PCR method for the targeted detection of PnVA in Panax notoginseng samples, and realizes the quantitative detection of PnVA. In addition, the test results can be directly obtained by the software without the need for PCR post-processing; the method specifically detects PnVA, and has no specific amplification of ginseng latent virus 4 and RNase-Free ddH2O; the method has good stability, with the maximum coefficient of variation of intra-group repetitions of 1.68%, and the maximum coefficient of variation of inter-group repetitions of 4.21%; it can detect a minimum of 10 2 The sensitivity of the recombinant plasmid is 100 times that of conventional PCR technology. The establishment of this method will provide a reliable technical means for further studying the infection, proliferation, distribution and temporal changes of PnVA, and lay the foundation for the development of a multiple quantitative detection system for Panax notoginseng virus. Sequence Listing <110> Kunming University of Science and Technology <120> Real-time fluorescence quantitative PCR detection method for Panax notoginseng virus A <160> 4 <170> SIPOSequenceListing 1.0 <210> 1 <211> twenty one <212> DNA <213> Artificial <400> 1 gatgtaccaa tttgtacctg c 21 <210> 2 <211> twenty one <212> DNA <213> Artificial <400> 2 cctccatagc catactctcc t 21 <210> 3 <211> 20 <212> DNA <213> Artificial <400> 3 tttcccaccg gtcacttaat 20 <210> 4 <211> 20 <212> DNA <213> Artificial <400> 4 gtgtccgtgc gtgttgcttc 20

Claims

1. A real-time fluorescence quantitative PCR detection method for Panax notoginseng virus, characterized in that The following steps are involved: (1) Using the cDNA of Panax notoginseng infected with Panax notoginseng virus A as a template, PCR amplification was performed using primers PnVA-cp-F and PnVA-cp-R. After the PCR amplification product was recovered and purified, it was ligated with the pGEM-T vector and transformed into competent Escherichia coli cells. Positive clones were picked to extract plasmids to obtain the recombinant plasmid standard pGEM-T-PnVA, wherein the nucleotide sequence of primer PnVA-cp-F is shown in SEQ ID NO: 1, and the nucleotide sequence of primer PnVA-cp-R is shown in SEQ ID NO: 2; (2) preparing a series of recombinant plasmid standard solutions with a concentration gradient, and using the recombinant plasmid standard solutions as templates, using upstream primers PnVA-QF and downstream primers PnVA-QR to perform real-time fluorescence quantitative PCR, using the logarithmic value of the copy number concentration of the recombinant plasmid standard as the abscissa and the Ct value as the ordinate to obtain a linear regression equation and establish a standard curve, wherein the nucleotide sequence of the upstream primer PnVA-QF is shown in SEQ ID NO:3, and the nucleotide sequence of the downstream primer PnVA-QR is shown in SEQ ID NO:4; (3) Extracting total RNA from the sample to be tested, and using the RNA as a template for reverse transcription to obtain cDNA of the sample to be tested, using the cDNA of the sample to be tested as a template, using upstream primer PnVA-QF and downstream primer PnVA-QR for real-time fluorescence quantitative PCR, and substituting the obtained Ct value into the constructed standard curve to achieve quantitative detection of Panax notoginseng A virus in the sample to be tested.

2. The real-time fluorescence quantitative PCR detection method for Panax notoginseng virus according to claim 1, characterized in that: The reaction system of real-time fluorescence quantitative PCR was 10 μL of 2×SYBR Green Mix, 7 μL of nuclease-free water, 1 μL of upstream primer PnVA-QF, 1 μL of downstream primer PnVA-QR, and 1 μL of cDNA template.

Images