A method for searching the Alpha satellite DNA sequence in the centromere region of human chromosomes

Abstract

The present invention relates to a method for searching the Alpha satellite DNA sequence in the centromere region of a human chromosome, and belongs to the technical field of molecular bioinformatics. The present invention first uses existing tools to obtain a matching file of the matching situation of a repetitive sequence in each chromosome, and then designs a script, links the script to the matching file, and runs the script in the background to realize automatic statistics of the number of repetitions of the repetitive sequence in each chromosome in the matching file, and judges whether the repetitive sequence is a specific sequence of the target sequence according to the number of repetitions in each chromosome. The present invention does not need to open the matching files for statistical analysis one by one, and only needs to use the designed script to run in the matching file to automatically realize the search for specific repetitive sequences.

Description

Technical Field

[0001] The invention relates to a method for searching the Alpha satellite DNA sequence in the centromere region of human chromosomes, and belongs to the technical field of molecular bioinformatics. Background Art

[0002] Alpha satellite DNA sequences are tandemly arranged DNA sequences with different copies of approximately 170 bp in the centromere of each human chromosome. Specific Alpha satellite DNA sequences are often used to prepare internal reference probes in fluorescent in situ hybridization probe combinations.

[0003] Since the size of human chromosome centromeres ranges from 0.2Mb to 6.2Mb, it is undoubtedly a huge workload to screen out Alpha satellite DNA sequences with good specificity from a large amount of data by relying on traditional biological software and sequence alignment methods. However, there is still no simple method for searching for Alpha satellite DNA sequences specific to the centromere region of human chromosomes. Therefore, it is necessary to conduct a certain degree of research on the search method for specific Alpha satellite DNA sequences. Summary of the invention

[0004] The purpose of the present invention is to provide a method for searching the Alpha satellite DNA sequence in the centromere region of human chromosomes, so as to solve the problem of low efficiency in searching the Alpha satellite DNA sequence specific to the centromere region of human chromosomes.

[0005] In order to solve the above technical problems, the present invention provides a method for searching the Alpha satellite DNA sequence in the centromere region of human chromosomes, the method comprising the following steps:

[0006] 1) Obtain the DNA sequence of the centromere region of the target chromosome and the DNA sequence of the centromere region of 24 chromosomes of the human body;

[0007] 2) extracting the repetitive sequence from the acquired DNA sequence of the centromere region of the target chromosome to obtain the corresponding repetitive sequence;

[0008] 3) Matching and comparing the obtained repetitive sequence with the DNA sequence of the centromere region of the 24 human chromosomes, and obtaining a file containing the matching situation of the repetitive sequence in the centromere region of each of the 24 human chromosomes, which is called a matching file;

[0009] 4) Design a script, link the script to the matching file, and count the number of times the repetitive sequence in the matching file appears in the centromere region of each of the 24 human chromosomes. When the number of repetitions of the repetitive sequence in the DNA sequence of the centromere region of the target chromosome is much greater than the number of repetitions in the DNA sequences of the centromere regions of other chromosomes, it indicates that the repetitive sequence is a target chromosome centromere-specific Alpha satellite DNA repetitive sequence.

[0010] The present invention first uses existing tools to obtain a matching file of the matching situation of the repetitive sequence in each chromosome, then designs a script, links the script to the matching file, and runs the script in the background to realize automatic statistics of the number of repetitions of the repetitive sequence in each chromosome in the matching file, and judges whether the repetitive sequence is a specific sequence of the target sequence according to the number of repetitions in each chromosome. The present invention does not need to open the matching files for statistical analysis one by one, but only needs to use the designed script to run in the matching file to automatically realize the search of specific repetitive sequences.

[0011] Furthermore, the script is implemented using Perl programming language.

[0012] The present invention uses Perl language as a scripting language, does not require a compiler and a linker to run the code, can be directly run in a matching file, implements statistics on the number of repetitions of a repeated sequence, and further improves the search efficiency.

[0013] Furthermore, it is characterized in that, when counting the number of repetitions in step 4), a match with the repetitive sequence greater than a set threshold is recorded as one repetition.

[0014] The present invention sets a threshold value and only counts sequences whose matching degree is greater than the set threshold value, so that sequences that meet the conditions can be quickly found from the matching files, further improving the statistical efficiency.

[0015] Furthermore, the set threshold is 85%.

[0016] The present invention sets the threshold value to 85% so that the statistical results can meet the specific requirements.

[0017] Furthermore, before comparing the obtained repetitive sequence with the DNA sequences of the centromere regions of the 24 human chromosomes, the DNA sequences of the centromere regions of the 24 human chromosomes need to be merged, and the obtained repetitive sequence is compared with the merged sequence.

[0018] In order to facilitate unified matching and avoid opening each chromosome sequence separately, the chromosome sequences are merged into one database to improve the efficiency of matching and comparison.

[0019] Furthermore, in step 2), when performing repetitive sequence processing, the DNA sequence in the centromere region of the target chromosome needs to be divided into several short sequences.

[0020] The present invention takes into account the limitation of data length of the online website used in the extraction of repeated sequences and divides the target chromosome sequence into multiple short sequences to meet the requirements of the repeated sequence extraction website.

[0021] Furthermore, the method also includes converting the statistical results of step 4) into a table to achieve an intuitive display of the statistical results.

[0022] In order to intuitively display the search results, the present invention copies the statistical results after the script is run into a table, and intuitively displays the statistical results in the table, which is convenient for staff to intuitively view. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 It is a flow chart of the method for searching the Alpha satellite DNA sequence in the centromere region of human chromosomes of the present invention;

[0024] Figure 2 Schematic diagram of the download process of the UCSC website in an embodiment of the present invention;

[0025] Figure 3-a is a schematic diagram of an interface of an online website used in an embodiment of the present invention;

[0026] Figure 3-b Schematic diagram of the repetitive sequence extracted in the embodiment of the present invention;

[0027] Figure 4 is an interface display diagram of the Tbtools tool used in the embodiment of the present invention;

[0028] Figure 5 is a display diagram of the matching file obtained in an embodiment of the present invention;

[0029] Figure 6-a This is the result of labeling the Alpha satellite DNA sequence in the centromere region of chromosome 4 with a fluorescent probe and a gene probe;

[0030] Figure 6-b This is the result of labeling the Alpha satellite DNA sequence in the centromere region of chromosome 6 with a fluorescent probe and a gene probe;

[0031] Figure 6-c This is the result of labeling the Alpha satellite DNA sequence in the centromere region of chromosome 20 with fluorescent probe and gene probe. DETAILED DESCRIPTION

[0032] The specific implementation of the present invention will be further described below in conjunction with the accompanying drawings.

[0033] The present invention aims at the problem that the matching files obtained by traditional software are relatively large, generally reaching several GB, and contain a lot of information. It takes a certain amount of time to open them, and after opening, the repetition of the repetitive sequence in each chromosome is determined by manual statistics, which is inefficient and prone to errors. To this end, a method for searching the Alpha satellite DNA sequence in the centromere region of human chromosomes is provided, which belongs to the technical field of molecular bioinformatics. The present invention first uses existing tools to obtain a matching file of the matching situation of the repetitive sequence in each chromosome, and then designs a script, links the script to the matching file, and runs the script in the background to realize automatic statistics of the number of repetitions of the repetitive sequence in each chromosome in the matching file, and judges whether the repetitive sequence is a specific sequence of the target sequence based on the number of repetitions in each chromosome. The specific implementation process of this method is as follows Figure 1 As shown, the specific implementation process is as follows.

[0034] 1. Obtain the DNA sequence of the centromere region of the target chromosome and the DNA sequence of the centromere region of the 24 chromosomes of the human body.

[0035] The present invention uses chromosome 6 as the target chromosome, and obtains a total of 4.1Mb of DNA sequence in the centromere region of chromosome 6. The present invention can obtain the above sequence through the UCSC website; similarly, using the website, the present invention also downloads the DNA sequence of the centromere region of 24 chromosomes. The user interface of the UCSC website is as follows Figure 2 shown.

[0036] 2. Merge the obtained DNA sequences of the centromere regions of 24 human chromosomes.

[0037] To facilitate subsequent search and comparison, the present invention needs to merge the acquired DNA sequences of the centromere regions of 24 human chromosomes. In this embodiment, the Tbtools tool is downloaded and installed (https: / / download.csdn.net / download / dingbp / 10700820), and the tool is used to merge the centromere DNA sequences of 24 chromosomes into a new database named "1-Y".

[0038] 3. Obtain repeating sequences.

[0039] The DNA sequence of the centromere region of the target chromosome is subjected to repeated sequence analysis to obtain the corresponding repeated sequence (Masked Regions). The repeated sequence analysis of the present invention is implemented using an online website (https: / / www.girinst.org / censor / index.php), such as Figure 3-aAs shown, since the online website has a maximum long data transmission limit, the present invention first divides the target sequence before uploading it to the website. According to the maximum long data transmission limit, the target sequence is divided into several short sequences and uploaded separately. Through the above online website, the present invention obtains the result of the repeated sequence of the target chromosome (No. 6) as shown in FIG. Figure 3-b shown.

[0040] 4. Compare and analyze the obtained repetitive sequence with the DNA sequence of the centromere region of 24 human chromosomes to obtain the corresponding matching file.

[0041] In this embodiment, the Tbtools tool is used to perform sequence alignment on the repeated sequence (Masked Regions) obtained in step 3 and the new database "1-Y" obtained in step 2. The application interface of the Tbtools tool is as follows: Figure 4 As shown in the figure, the output file is "123". When the Tbtools tool is matching, the generated file is generally large, reaching several GB, which contains the alignment of the repetitive sequence in the centromere region DNA sequence of the 24 chromosomes of the human body, such as Figure 5 Show.

[0042] 5. Use the script to organize and select the data of the file obtained in step 4 to realize the search for the Alpha satellite DNA sequence in the centromere region of human chromosomes.

[0043] Since the obtained matching file is relatively large, it takes a certain amount of time to open the file directly. In order to improve efficiency, the present invention designs a script, which needs to be run under Perl software, and implements the analysis and statistics of the file with the file name in the script by the Perl program through the script command. The script is directly linked to the above matching file, and by running the script, it is not necessary to open the matching file, and it can be directly run in the background, so that the matching file can be automatically counted.

[0044] The present invention uses a script to count the number of times the repetitive sequence in the obtained matching file appears in the centromere region of each of the 24 human chromosomes, so as to determine whether the repetitive sequence is the target chromosome centromere-specific Alpha satellite DNA repetitive sequence. When performing the repetition count, the repetitive sequence matching degree greater than the set threshold is recorded as a repetition, wherein the set threshold can be determined according to the actual situation, and the set threshold in this embodiment is 85%.

[0045] The script constructed in this example is as follows, wherein the input file name is "123", the output file name is "123result.txt", and 85 represents a sequence matching degree of 85% (experiments have verified that sequences with a matching degree higher than 85% can effectively hybridize).

[0046] In order to avoid the compilation and linking process of the program, the present invention adopts Perl language as the scripting language, and the specific implementation code is as follows:

[0047]

[0048] The final statistical results can be obtained through the above script. The output file after the script is run is in txt format. In order to intuitively display the statistical results, the present invention copies the results into an excel table. The results are shown in Table 1.

[0049] Table 1

[0050]

[0051] The total category in Table 1 is the name of the repeated sequence, the horizontal column is the name of the chromosome 1-Y, and the other values ​​are the number of times the sequence is repeated on the chromosome with a matching degree greater than 85%.

[0052] From the sequence alignment results, it can be seen that the sequence hg38_dna FRAGMENT 428655->428822 has 1578 repeats on chromosome 6 and less than or equal to 3 repeats on chromosomes 1 / 3 / 12 / 20. Therefore, in theory, it can be determined that the sequence is the chromosome 6 centromere-specific Alpha satellite DNA repeat sequence.

[0053] Through the above process, the present invention can obtain the specific repeat sequences of chromosomes 6, 4 and 20 respectively:

[0054] Chromosome 6 Alpha satellite DNA sequence:

[0055] TGTAGTATTTCCAAGCGGATATTTGGAACGCCTTGAAGCGTATGGTAGAAAAGGAAATATCTTTCCATAAAACCTAGACAGAACCCATCTCAGAAACGACTTTGTGATGTCTGCATTGAACTCACAGAGTTGAACATTTCTCTTGATAGAGCAGTTTTGAAACCCTCT

[0056] Chromosome 4 Alpha satellite DNA sequence:

[0057] CTGCACTACCAGGAAGTGGACATTTCGAGCGCTTTGAGGCTTATGGTGAAAAAGGAAATATCTTCTCATAAAAACCAGAAAGAAGCGTTCTCAGAAACTTCTTTGTGTTGTGTGTACTCATGTAACAGTGTTGAACCATCCTTTTGACAGAGCAGTTTTGAAACAATCTTT

[0058] Chromosome 20 Alpha satellite DNA sequence:

[0059] GGATGTTTCGATTGAAGTCCCAGTGTTGAACATTCCCTTTTATAGAGCAGGTTGGAAACACTCTTTCTGCATTCCCTGGAAGTGGACATTTAGAGCGCTTTCAGGACGACGGTGAAAATGGAAATATCTTCCAAGAAAATCTAGATAGAA

[0060] In order to verify the effectiveness of the search method of the present invention, the chromosome centromere-specific Alpha satellite DNA repeat sequences found were fluorescently labeled and subjected to in situ hybridization experiments, taking the specific repeat sequences of chromosomes 4, 6 and 20 found as examples. The experimental process is as follows:

[0061] I. Fluorescent labeling:

[0062] ① Submit the found Alpha satellite DNA sequence to a gene synthesis company for cloning into the pUC57 vector;

[0063] ②Synthesize upstream and downstream primers. The upstream primer sequence is: CCTTATCCGGTAACTATCGTCT; the downstream primer sequence is: TGTTCTTCTAGTGTAGCCGTA. (Note: This sequence is the pUC57 vector sequence, which is used to amplify and insert the Alpha satellite DNA repeat sequence)

[0064] ③Use the cloned plasmid as a template for PCR labeling. The labeling system is as follows:

[0065]

[0066] After the PCR reaction is completed, the Alpha satellite DNA probe solution is obtained.

[0067] II. Preparation of probe working solution

[0068] Take 1 μL Alpha satellite DNA probe solution, 1 ul gene probe solution, 1 ul Cot-1 DNA, and 7 ul hybridization buffer, mix well and centrifuge to prepare the probe working solution.

[0069] Note: The selected gene probe is the gene probe on the same chromosome as the corresponding Alpha satellite DNA probe, which serves as a control probe; Cot-1 DNA is used to block nonspecific hybridization.

[0070] III. Fluorescence in situ hybridization (FISH)

[0071] 1. Take a clean slide;

[0072] 2. After resuspending the cells, take 5 μl of the suspension and drop it onto a glass slide, and let it dry at room temperature;

[0073] 3. Use a 10× objective lens to observe the cell density under a phase contrast microscope. The cells should not overlap and the number of cells in a single field of view should be between 100 and 200.

[0074] 3.1 If the cell density and number are appropriate, proceed to step 4;

[0075] 3.2 If cells overlap, add appropriate fresh fixative to dilute the cell suspension;

[0076] 3.3 If the cell density is low, centrifuge at 2000rpm for 5 minutes, carefully remove an appropriate amount of supernatant, mix well, take another 3μl suspension to make a slide, dry the slide, and observe;

[0077] 4. Observe under a phase contrast microscope. If there are too many cell fragments, pretreatment is required and the appropriate hybridization area should be selected.

[0078] Slide pretreatment:

[0079] Place the dropped cell sheet in a 60°C environment and bake for 20-30 minutes.

[0080] ① After baking, place the slide in 2×SSC at room temperature and soak for 10 minutes;

[0081] ② Then soak in 70%, 85%, and 100% ethanol at room temperature for 2 minutes to dehydrate;

[0082] ③. Take out the slide and let it dry at room temperature.

[0083] Denaturation and hybridization of samples and probes (be careful to avoid light):

[0084] ①. Take out the probe, mix well and centrifuge, add 10ul of probe to the hybridization area, cover with a coverslip, and seal along the edge of the coverslip with sealing glue. Make sure to seal completely to avoid evaporation of the hybridization solution.

[0085] ② Place the slide on the hybridizer and perform denaturation hybridization according to the set program (recommended: denaturation at 82℃ for 6 minutes and hybridization at 40℃ overnight).

[0086] Wash after hybridization (avoid light):

[0087] 1. 30 minutes before washing, place the prepared washing solution I in a water bath and preheat to 72±1℃.

[0088] 2. After taking out the slide from the hybridizer and removing the sealing glue, soak the slide in the washing solution II at room temperature for 10 minutes to remove the cover glass (do not remove the cover glass directly with tweezers).

[0089] 3. Place the slides in 72±1℃ washing solution I for 2 minutes.

[0090] 4. Take out the slide and place it in washing solution II at room temperature for 2 minutes.

[0091] 5. After taking out the slides, soak them in 70% and 85% ethanol solutions for 2 minutes respectively, and dry them at room temperature.

[0092] 6. DAPI staining and sealing: Add 10 μl of DAPI counterstaining solution to the sliced ​​tissue, avoid bubbles, cover with a coverslip, paint the edge of the coverslip with nail polish, and incubate in a dark place at -20°C for 10-20 minutes.

[0093] 7. Microscopic examination: Store the slices in a dark place. For long-term storage, store at -20℃ and count under a fluorescence microscope.

[0094] The experimental results are as follows Figure 6-a , 6-b and 6-c, where Figure 6-a This is the result of labeling the Alpha satellite DNA sequence in the centromere region of chromosome 4 with a fluorescent probe and a gene probe. Figure 6-b This is the result of labeling the Alpha satellite DNA sequence in the centromere region of chromosome 6 with a fluorescent probe and a gene probe. Figure 6-c The result diagram of the fluorescent probe and gene probe labeling of the Alpha satellite DNA sequence in the centromere region of chromosome 20. This shows that the specific repetitive sequence found by the method of the present invention meets its biological requirements, and shows that the present invention can not only quickly search for specific repetitive sequences, but also the specific repetitive sequences found are accurate.

Claims

1. A method for searching the Alpha satellite DNA sequence in the centromere region of human chromosomes, characterized in that: The method comprises the following steps: 1) obtaining the DNA sequence of the centromere region of the target chromosome and the DNA sequence of the centromere region of 24 human chromosomes, and merging the obtained DNA sequences of the centromere region of the 24 human chromosomes; 2) extracting the repetitive sequence from the acquired DNA sequence of the centromere region of the target chromosome to obtain the corresponding repetitive sequence; 3) Matching and comparing the obtained repetitive sequence with the merged DNA sequences of the centromere regions of the 24 human chromosomes, and obtaining a file containing the matching conditions of the repetitive sequence in the centromere regions of the 24 human chromosomes, which is called a matching file; 4) Design a script, link the script to the matching file, and count the number of times the repetitive sequence in the matching file appears in the centromere region of each of the 24 human chromosomes. When the number of repetitions of the repetitive sequence in the DNA sequence of the centromere region of the target chromosome is much greater than the number of repetitions in the DNA sequence of the centromere region of other chromosomes, it indicates that the repetitive sequence is a target chromosome centromere-specific Alpha satellite DNA repetitive sequence; when counting the number of repetitions, a repetitive sequence with a matching degree greater than a set threshold is recorded as 1 repetition.

2. The method for searching the Alpha satellite DNA sequence in the centromere region of human chromosomes according to claim 1, characterized in that: The script is implemented using the Perl language.

3. The method for searching the Alpha satellite DNA sequence in the centromere region of human chromosomes according to claim 1, characterized in that: The set threshold is 85%.

4. The method for searching the Alpha satellite DNA sequence in the centromere region of human chromosomes according to claim 1, characterized in that: In the step 2), when performing repetitive sequence processing, the DNA sequence in the centromere region of the target chromosome needs to be divided into several short sequences.

5. The method for searching the Alpha satellite DNA sequence in the centromere region of human chromosomes according to claim 1, characterized in that: The method also includes converting the statistical results of step 4) into a table to achieve an intuitive display of the statistical results.

Images