M2 macrophage detection kit containing tumor markers and its application

Abstract

The present invention provides an M2 macrophage detection kit containing a tumor marker, wherein the kit comprises magnetic beads combined with an M2 macrophage antibody, magnetic beads combined with an oligonucleotide Oligo(dT), primers for M2 macrophage markers, and primers for tumor cell markers. The present invention distinguishes tumor cells in vivo by enriching M2 macrophages that have engulfed tumor cells in circulating blood, and can further determine the tumor type by using specific tumor cell markers, thereby achieving early screening, early diagnosis, and detection of the entire process of tumor development, and in particular, making it possible to monitor the entire process of tumor development, and can formulate targeted tumor treatment plans after detection, which is beneficial to improving the survival rate of tumor patients.

Description

Technical Field

[0001] The invention belongs to the field of biomedicine and relates to a tumor detection kit, in particular to an M2 macrophage detection kit containing a tumor marker and an application thereof. Background Art

[0002] In the medical field, conducting human tissue biopsy to determine the nature of tumors has become a scientific knowledge known to the society. As the name suggests, biopsy is to obtain living tissue, and then perform pathological sections to determine the nature of the tumor, which has become one of the golden indicators for tumor diagnosis. Pathological sections are also the most effective means of diagnosing tumors, and have always been "favored" by medical workers. At the same time, tissue biopsy also has huge shortcomings, that is, malignant tumor tissue that has been biopsied is very prone to tumor metastasis; visceral tissue that has been biopsied also has emergency situations where bleeding needs to be treated, and the possibility that tumor cells cannot be obtained and a clear diagnosis cannot be made.

[0003] In view of the above problems and defects, researchers have been exploring and seeking better solutions. Liquid biopsy technology, which was rated as one of the "Top Ten Breakthrough Technologies in 2015" by the international medical community, has become a new object of admiration. The so-called liquid biopsy technology is relative to human tissue biopsy technology. Liquid biopsy refers to the technology of analyzing and diagnosing diseases such as cancer by collecting human liquid samples, such as blood, urine, saliva, pleural effusion, cerebrospinal fluid, etc. The currently recognized technical content includes: the detection of tumor cells in venous blood, called CTCs (circulating tumor cells); the detection technology of tumor DNA in circulating blood, called ctDNA (circulating tumor DNA) and exosome detection technology. The advantage of liquid biopsy technology is that it collects venous blood samples, extracts tumor cells and extracted tumor DNA, and then makes a diagnosis. The sample source is easy and the trauma is small, which makes up for the defects and shortcomings of tissue biopsy technology.

[0004] In 1869, Australian pathologist John Ashworth first discovered CTCs. He found tumor cells in the circulating blood during autopsies of deceased cancer patients and speculated that they had an impact on the tumor itself: in 1960, scientists discovered CTC clusters where multiple CTCs gathered together. With the successful development of the Cell Search system in 1994, a large number of clinical experiments have demonstrated the application of CTCs in cancer prognosis and recurrence. With the advancement of single-cell sequencing technology, a large number of studies on CTCs single-cell sequencing have also been carried out. In the future, CTCs and related detection technologies will be used in the formulation of personalized precision medical plans for tumors.

[0005] So far, the advantages of CTCs detection technology are obvious. In 5ml of venous blood of tumor patients, the minimum detection amount of tumor cells reaches 2 (the whole blood volume of the human body is calculated as 5000ml). It is of great significance for early screening and early diagnosis of tumors, as well as detection of the entire process of tumor before and after treatment, drug resistance and distant metastasis.

[0006] However, there are currently several major problems with the detection of CTCs:

[0007] First, the cost is high

[0008] CTCs testing has the best accuracy and effect in detecting a single tumor type. For example, it can now accurately complete the precise detection of breast cancer, ovarian cancer, endometrial cancer, colorectal cancer, and pancreatic cancer. CTCs testing can be gradually developed based on the different genetic variation characteristics of different tumor types. However, each CTCs test can only determine one tumor type. For early screening and early diagnosis, CTCs testing of a single tumor type can only determine or exclude whether it carries the tumor cells, but cannot determine or exclude whether it carries other types of tumor cells. To perform CTCs testing on all tumor types, CTCs testing must be performed one tumor type at a time, which brings a very large economic burden to the tester and is not conducive to the development of early screening and early diagnosis of tumors.

[0009] Second, limited accuracy

[0010] CTCs have high accuracy in detecting tumors originating from epithelial tissues. However, problems with epithelial cell mesenchymalization and epithelial cells insensitive to EpCAM marker protein are prone to a certain false negative rate. Although it is low, it still exists, which brings risks to patient prognosis detection.

[0011] Third, the breadth of treatment is affected

[0012] If personalized therapeutic drugs for different tumor types are developed according to the tumor type, too many types of drugs need to be developed, so it is difficult to design personalized treatment plans for patients. In other words, under the conditions of early screening, early diagnosis, and full monitoring of the tumor development process and the genetic changes of the tumor, it will increase the difficulty of drug development to develop more targeted and more effective personalized treatment plans.

[0013] Therefore, it is urgent to develop a detection solution that can detect multiple tumor types at the same time to reduce the cost of detection and achieve early screening, early diagnosis and full monitoring of the tumor development process. Summary of the invention

[0014] In order to solve the above problems, the purpose of the present invention is to provide an M2 macrophage detection kit containing a tumor marker, which can enrich M2 macrophages that have phagocytosed tumor cells from circulating blood, thereby achieving early screening and early diagnosis of tumor cells.

[0015] Another object of the present invention is to provide a series of M2 macrophage detection kits containing tumor markers of corresponding tumor types. By detecting tumor markers of different tumor types, the specific type of tumor can be identified, thereby analyzing the primary location of the tumor and realizing the whole process of monitoring the tumor development process and genetic changes.

[0016] In order to achieve the above object, the present invention provides an M2 macrophage detection kit containing a tumor marker, the kit comprising:

[0017] Magnetic beads conjugated with M2 macrophage antibodies;

[0018] Magnetic beads bound with oligonucleotide Oligo(dT);

[0019] Primers for M2 macrophage markers;

[0020] Primers for tumor cell markers;

[0021] Wherein, the M2 macrophage marker is one or more of CD163, CD68, and CD204;

[0022] The tumor cell markers are TP53 and P16;

[0023] The CD163 primer sequence is:

[0024] The upstream primer is shown in SEQ ID NO: 1;

[0025] The downstream primer is shown in SEQ ID NO: 2;

[0026] The CD68 primer sequence is:

[0027] The upstream primer is shown in SEQ ID NO: 3;

[0028] The downstream primer is shown in SEQ ID NO: 4;

[0029] The CD204 primer sequence is:

[0030] The upstream primer is shown in SEQ ID NO: 5;

[0031] The downstream primer is shown in SEQ ID NO: 6;

[0032] The P16 primer sequence is:

[0033] The upstream primer is shown in SEQ ID NO: 7;

[0034] The downstream primer is shown in SEQ ID NO: 8;

[0035] The TP53 primer sequence is:

[0036] The upstream primer is shown in SEQ ID NO: 9;

[0037] The downstream primer is shown in SEQ ID NO: 10;

[0038] The M2 macrophage antibodies are anti-CD68 monoclonal antibodies and anti-CD163 monoclonal antibodies.

[0039] The present invention also provides an M2 macrophage detection kit for detecting specific tumor tissues, which further comprises primers of one or more specific tumor cell markers on the basis of the above-mentioned kit.

[0040] Among them, the specific tumor tissues include one or more of lung cancer, liver cancer, gastric cancer, esophageal cancer, nasopharyngeal cancer, pancreatic cancer, colon cancer, bladder cancer, kidney cancer, skin cancer, thyroid cancer, bladder cancer, breast cancer, cervical cancer, ovarian cancer, prostate cancer, malignant glioma, and osteosarcoma.

[0041] Among them, the primers of the specific tumor cell markers include primers of tumor cell markers in lung cancer, liver cancer, gastric cancer, esophageal cancer, nasopharyngeal cancer, pancreatic cancer, colon cancer, bladder cancer, kidney cancer, skin cancer, thyroid cancer, bladder cancer, breast cancer, cervical cancer, ovarian cancer, endometrial cancer, prostate cancer, colorectal cancer, malignant glioma, and osteosarcoma.

[0042] The present invention also provides the use of the above-mentioned kit as a kit for early screening, early diagnosis and full-course monitoring of tumor development.

[0043] Existing CTCs detection cannot enrich epithelial-mesenchymal tumor cells because it uses epithelial cells (such as epithelial cell adhesion molecule EpCAM) as markers. In addition, some epithelial tumor cells do not express or lowly express EpCAM, which affects the enrichment effect of tumor cells.

[0044] The M2 macrophage tumor detection kit provided by the present invention can indirectly detect the presence or absence of tumor cells by detecting, enriching and identifying M2 macrophages, because M2 macrophages can promote the proliferation of various types of tumor cells. This can play an important role in the early screening, early diagnosis and detection of the entire process of tumor development.

[0045] Since the detection of M2 macrophages is equivalent to detecting multiple tumor types at one time, the detection cost is superior to that of CTCs, which can only detect a single tumor type. In the early screening and early diagnosis of tumors, there is no need to check each tumor type one by one, so it can reduce material costs and labor costs, which is conducive to the widespread early screening and early diagnosis of tumors and the detection of the entire process of tumor development. At the same time, the detection accuracy of M2 macrophages is the same as that of CTCs, and the lack of the need to detect epithelial cell markers also makes up for the deficiency of epithelial cells as marker proteins.

[0046] The beneficial effects of the present invention are:

[0047] The M2 macrophage detection kit containing tumor markers provided by the present invention can be used for early screening and early diagnosis of tumors, as well as detection and observation of the entire process of tumor development, especially making it possible to monitor the entire process of tumor development. After detection, targeted tumor treatment plans can be formulated, which will be beneficial to improving the survival rate of tumor patients. BRIEF DESCRIPTION OF THE DRAWINGS

[0048] Figure 1 This is a comparison of the electrophoresis of ovarian cancer cells and M2 macrophages in the patient's circulating blood.

[0049] Figure 2 This is a comparison of the electrophoresis of bladder cancer cells and M2 macrophages in the patient's circulating blood. DETAILED DESCRIPTION

[0050] Classical macrophages (classically activated M1 macrophage, M1), that is, M1 cells. M1 cells are small in size and weak in killing activity in the resting state. After activation, they have the characteristics of increased size, increased lysosomes, and vigorous metabolism. Activated macrophages have enhanced anti-infection and anti-tumor effects. Pathogens, verification stimuli, and cytokines such as IFN-γ can all activate macrophages. Activated macrophages have the ability to release a variety of cytokines and chemokines and act as antigen-presenting cells, participating in the initiation and regulation of immune responses. In fact, different types of cytokines and their combinations can induce activated macrophages with different activation activities and functional characteristics. For example, compared with M1 macrophages, activated macrophages such as IL4 and IL10 have weakened antigen presentation ability, which are called alternatively activated M2 macrophages, that is, M2 macrophages.

[0051] Studies have found that type 2 macrophages (Macrophage, M2) can be detected in the blood of tumor patients. M2 macrophages have a promoting effect on tumor cell proliferation, which is closely related to its epithelial-mesenchymal transition (EMT) and the promotion of tumor stem cell formation. Other studies have found that exosomes derived from lung cancer and breast cancer cells can deliver activated epidermal growth factor receptor (EGFR) to macrophages, thereby reducing the secretion of interferon-β (IFN-β) and reducing the innate immunity of tumor patients through mitogen-activated protein kinase 2 (MEKK2). These studies all suggest that macrophages play different roles in the occurrence and development of tumors.

[0052] The embodiments of the present invention will be described in detail and comprehensively below so that the advantages and features of the present invention can be more easily understood by those skilled in the art, thereby making a clearer and more definite definition of the protection scope of the present invention.

[0053] Materials and Equipment

[0054] 1. RevertAid first Strand cDNA Synthesis Kit was purchased from Invitrogen, catalog number: K1622.

[0055] 2.TRIzol TM Reagent was purchased from Invitrogen, catalog number: 15596018.

[0056] 3.EpCAM monoclonal antibody (catalog number ab20160), HER2 monoclonal antibody (ab16901), MUC1 monoclonal antibody (ab22711), CD68 monoclonal antibody (ab201973), CD163 monoclonal antibody (ab87099), CK19 monoclonal antibody (ab20210), and EGFR monoclonal antibody (ab264540) were all purchased from Abcom.

[0057] 4. Dynabeads M450 magnetic beads used for binding monoclonal antibodies were selected from Invitrogen, USA M-450Tosylactivated, catalog number 14013, monoclonal antibody labeling amount is 500μL magnetic beads per 100μg antibody.

[0058] 5. Buffer used for magnetic bead labeling: Buffer 1: 0.1M PBS, pH 7.4-8.0 or 0.1M SBB, pH 7.6-9.5; Buffer 2: Ca-free containing 0.1% bovine serum albumin (BSA) and 2mM EDTA 2+ and Mg 2+ Phosphate buffered saline (PBS), pH 7.4.

[0059] 6. mRNA DIRECT TM The kit was purchased from Life Technologies, USA, with the catalog number: 61011.

[0060] 7. Lymphocyte separation medium (Ficoll reagent) was purchased from GE, catalog number 17144002.

[0061] 8. Multiplex PCR Kit (QIAGEN Multiplex PCR Kit) was purchased from QIAGEN, catalog number: 206143.

[0062] 9. BSS buffer (Balanced Salt Solution): Solution A and solution B are mixed in a mass ratio of 1:9, wherein the formula of solution A: contains 1.0g of D-anhydrous D-Glucose, 0.0074g of CaCl2·2H2O, 0.1992g of MgCl2·6H2O, 0.4026g of KCl, and 17.565g of Tris per 1000mL; the formula of solution B: contains 8.19g of NaCl per 1000mL.

[0063] 10. The formula of buffer A is: 10 mM Tris-HCl, pH 7.5; 0.15 M LiCl; 1 mM EDTA; 0.1% LiDS.

[0064] 11. The formula of buffer B is: 10mM Tris-HCl, pH7.5; 0.15M LiCl; 1mM EDTA.

[0065] The 12.2× multiplex PCR mixture contains 5U / μL of HotStarTaq DNA Polymerase.

[0066] 13. Lysis / binding buffer formula: 100 mM Tris-HCl, pH 7.5; 500 mM LiCl; 10 mM EDTA, pH 8; 1% LiDS; 5 mM dithiothreitol.

[0067] 14. Primer synthesis was completed by Beijing Aoke Company.

[0068] 15.Agilent 2100 bioanalyzer was purchased from Agilent Technologies (China) Co., Ltd.

[0069] The M2 macrophage detection kit containing tumor markers provided by the present invention has the same accuracy as the CTCs detection results of a single tumor type when detecting M2 macrophages. The detection process is: using monoclonal antibodies labeled with magnetic powders of M2-specific markers CD68 and CD163, the detection accuracy in a 5ml blood sample is the same as that of CTCs, which can reach 2 cells. After purification, reverse transcription of its RNA is used to identify tumor genes of tumor cDNA to determine that it has engulfed tumor cells.

[0070] When a case report of M2 macrophage and tumor cell markers being positive appears when using the M2 macrophage test, it means that the tester's cells are positive for tumor gene expression, and a tumor type diagnosis can be performed to determine the tissue suffering from the tumor.

[0071] Example 1 Preparation of test samples

[0072] In order to compare the detection sensitivity of the M2 macrophage method and the CTCs method, peripheral blood from ovarian cancer patients was selected as the detection sample.

[0073] 10 ml of peripheral whole blood was randomly collected from two patients diagnosed with ovarian cancer, and each 10 ml of peripheral whole blood was placed in an EDTA anticoagulation blood collection tube and stored at 4°C. Pretreatment was performed within 12 hours.

[0074] Each peripheral whole blood was pre-processed according to the following steps:

[0075] 1. Take 10 ml of the patient's peripheral whole blood and place it in a 15 ml centrifuge tube. Centrifuge at 1900 rpm for 10 minutes to separate the plasma and blood cells.

[0076] 2. Use a 3 ml pipette to carefully aspirate the upper plasma into a 7 ml centrifuge tube and store at -80°C.

[0077] The volume of each tube should not exceed two-thirds of that of a 7 ml centrifuge tube.

[0078] 3. Add an equal volume of BSS buffer to the lower layer of blood cells and mix by pipetting.

[0079] 4. Add lymphocyte separation solution (Ficoll reagent) to a 15 ml centrifuge tube, the volume of which is three quarters of the mixed solution in step 3. Use a 3 ml dropper to slowly add the mixed solution in step 3 to the lymphocyte separation solution along the wall of the 15 ml centrifuge tube to separate the solutions.

[0080] Do not add too quickly to avoid the mixed solution from rushing into the lymphocyte separation solution in the lower layer.

[0081] 5. Centrifuge the 15 ml centrifuge tube in step 4 at 1700 rpm for 30 minutes.

[0082] 6. After centrifugation, the solution is divided into three layers, and the nucleated cells are located between the upper and middle layers. Use a 3ml pipette to carefully aspirate the nucleated cells into a 15ml centrifuge tube (a total of about 2-3ml of liquid), add PBS to 15ml and centrifuge at 1000rpm for 10 minutes.

[0083] 7. Discard the supernatant, resuspend the precipitated nucleated cells with PBS to 4 ml, divide into 2 portions, and obtain 2 mL of nucleated cell suspension each for subsequent detection, or freeze for later use.

[0084] Example 2 Preparation of magnetic beads coated with monoclonal antibodies recognizing M2 macrophages

[0085] 1. Take 500 μl of Dynabeads M450 magnetic beads into a 1.5 ml centrifuge tube and place it on the magnetic bead enrichment rack. Let it stand for 1 minute and discard the clear liquid in the tube with a pipette.

[0086] 2. Remove the 1.5ml centrifuge tube and add 500μl buffer 1 to wash the magnetic beads. Place it on the magnetic bead enrichment rack and let it stand for 1 minute. Use a pipette to discard the clear liquid. Repeat this step 3 times and resuspend the magnetic beads with 500μl buffer 1.

[0087] 3. Add 100 μg of CD68 monoclonal antibody or CD163 monoclonal antibody to the resuspended magnetic beads and incubate at 37°C with gentle tilt rotation for 16-24 hours.

[0088] 4. Place the incubated magnetic beads on the magnetic bead enrichment rack, discard the supernatant, wash the magnetic beads with 500μl buffer 2, place them on the magnetic bead enrichment rack, let them stand for 1 minute, discard the supernatant with a pipette, and add 500μl buffer 2 to resuspend the magnetic beads.

[0089] 5. Rotate the beads at a gentle angle at 4°C for 5 minutes.

[0090] 6. Place the magnetic beads on the magnetic bead enrichment rack, let it stand for 1 minute, discard the supernatant with a pipette, add 500 μl buffer 2 to resuspend the magnetic beads, and store at 4°C.

[0091] For long-term storage, add 5 μl of 2% NaN3 solution.

[0092] Example 3 Enrichment of M2 macrophages and extraction and reverse transcription of mRNA

[0093] 1. Prepare a magnetic bead mixture by mixing the magnetic beads coated with CD68 monoclonal antibody and CD163 monoclonal antibody for enriching M2 macrophages in equal proportions to prepare a magnetic bead mixture.

[0094] 2. Place the magnetic bead mixture on the magnetic bead enrichment rack. After standing for 1 minute, discard the supernatant and add an equal volume of buffer 2 to resuspend the magnetic beads. Place on ice for later use.

[0095] 3. Add the magnetic bead mixture for enriching M2 macrophages to the nucleated cell resuspension prepared in Example 1 at a ratio of 25 μl of the magnetic bead mixture per 1 ml of nucleated cell suspension.

[0096] Since the volume of one portion of nucleated cell suspension prepared in Example 1 is 2 ml, 50 μl of magnetic bead mixture is added accordingly.

[0097] 4. Incubate the nucleated cell resuspension solution with the magnetic bead mixture at 4°C for 30 minutes using a test tube rotating mixer at 10 rpm.

[0098] 5. Place the incubated magnetic beads on a magnetic bead concentrator, let stand for 5 minutes, and discard the clear solution; add 1 ml of buffer 2 to wash the magnetic beads, place them on a magnetic bead concentrator, let stand for 1 minute, and discard the clear solution; repeat the washing of the magnetic beads 3 times; at this time, the M2 macrophages in the sample have been enriched on the magnetic beads.

[0099] The above steps 1-5 are the enrichment stage of M2 macrophages.

[0100] 6. Add 200 μl of cell lysis / binding buffer (Lysis / Binding Buffer) that has been placed at room temperature in advance to the magnetic beads enriched with M2 macrophages. After incubation at room temperature for 2-3 minutes, place it on the magnetic bead enrichment rack, transfer the clear liquid to a new 1.5 ml centrifuge tube, and discard the magnetic beads.

[0101] The above step 6 is the M2 macrophage lysis stage.

[0102] 7. Take mRNA DIRECT TM Kit Oligo(dT) 25 Magnetic beads (referred to as Oligo(dT) 25 Magnetic beads) on a magnetic bead concentrator, discard the supernatant and add cell lysis / binding buffer to resuspend. The ratio of the two is 40μl Oligo(dT) 25 The beads were resuspended in 50 μl of cell lysis / binding buffer.

[0103] 8. Add the Oligo(dT) resuspended in step 7 to the supernatant in step 6.25 Magnetic beads, add Oligo(dT) to every 200μl of supernatant 25 50 μl of magnetic beads were placed on a test tube rotating mixer and incubated at room temperature at 10 rpm for 15 minutes.

[0104] 9. Buffer A and Buffer B are placed at room temperature in advance, and the incubated Oligo(dT) 25 The magnetic beads were placed on a magnetic bead concentrator, and the clear liquid was discarded; then 200 μl of buffer A was added to wash the magnetic beads, and the beads were placed on a magnetic bead concentrator, allowed to stand for 1 minute, and the clear liquid was discarded; then 200 μl of buffer B was added to wash the magnetic beads, and the beads were placed on a magnetic bead concentrator, allowed to stand for 1 minute, and the clear liquid was discarded; finally 100 μl of buffer B was added to wash the magnetic beads, and the beads were placed on a magnetic bead concentrator, allowed to stand for 1 minute, and the clear liquid was discarded.

[0105] 10. Add 50 μl RNase-free ddH2O to wash the magnetic beads, place them on a magnetic bead concentrator, let stand for 1 minute, and discard the clear solution. Resuspend the magnetic beads with 29.5 μl RNase-free ddH2O and transfer them to a PCR tube, place them in a 65°C metal bath and incubate for 5 minutes. Place them on ice for 2 minutes to obtain an mRNA / magnetic bead mixture.

[0106] 11. Reverse Transcription

[0107] RevertAid First Strand cDNA Synthesis Kit was used for reverse transcription reaction, and the reaction system was prepared as shown in Table 1.

[0108] Table 1 Reverse transcription reaction system

[0109]

[0110] RNase-free water was used instead of samples as a negative control.

[0111] After preparing the reverse transcription system, place it in a PCR instrument for reverse transcription reaction. The reaction steps are 37°C for 60 minutes; 4°C for ∞.

[0112] After the reaction is completed, the cDNA samples were stored at -20°C. If long-term storage is required, they can be stored at -80°C.

[0113] Example 4 Preparation of magnetic beads coated with monoclonal antibodies that recognize circulating tumor cells of ovarian cancer

[0114] The other one of the two nucleated cell resuspensions prepared in Example 1 (2 ml) was used for ovarian cancer CTCs detection as an effect control.

[0115] 1. Take 500 μl of Dynabeads M450 magnetic beads into a 1.5 ml centrifuge tube and place it on the magnetic bead enrichment rack. Let it stand for 1 minute and discard the clear liquid in the tube with a pipette.

[0116] 2. Remove the 1.5ml centrifuge tube and add 500μl buffer 1 to wash the magnetic beads. Place it on the magnetic bead enrichment rack and let it stand for 1 minute. Use a pipette to discard the clear liquid. Repeat this step 3 times and resuspend the magnetic beads with 500μl buffer 1.

[0117] 3. Add 100 μg of EpCAM monoclonal antibody, HER2 monoclonal antibody and MUC1 monoclonal antibody to the resuspended magnetic beads and incubate at 37°C with slight tilt rotation for 16-24 hours.

[0118] 4. Place the incubated magnetic beads on the magnetic bead enrichment rack, discard the supernatant, wash the magnetic beads with 500μl buffer 2, place them on the magnetic bead enrichment rack, let them stand for 1 minute, discard the supernatant with a pipette, and add 500μl buffer 2 to resuspend the magnetic beads.

[0119] 5. Rotate the beads at a gentle angle at 4°C for 5 minutes.

[0120] 6. Place the magnetic beads on the magnetic bead enrichment rack, let stand for 1 minute, discard the clear solution with a pipette, add 500 μl buffer 2 to resuspend the magnetic beads, and store at 4°C.

[0121] For long-term storage, add 5 μl of 2% NaN3 solution.

[0122] Example 5 Enrichment of ovarian cancer circulating tumor cells and extraction and reverse transcription of mRNA

[0123] 1. Prepare a magnetic bead mixture by mixing the magnetic beads coated with EpCAM monoclonal antibody, HER2 monoclonal antibody and MUC1 monoclonal antibody for enriching circulating tumors in equal proportions to prepare a magnetic bead mixture.

[0124] 2. Place the magnetic bead mixture on the magnetic bead enrichment rack. After standing for 1 minute, discard the supernatant and add an equal volume of buffer 2 to resuspend the magnetic beads. Place on ice for later use.

[0125] 3. Add the magnetic bead mixture for enriching ovarian cancer circulating tumor cells to the nucleated cell resuspension prepared in Example 1, at a ratio of 25 μl of the magnetic bead mixture per 1 ml of the nucleated cell suspension.

[0126] Since the volume of one portion of nucleated cell suspension prepared in Example 1 is 2 ml, 50 μl of magnetic bead mixture is added accordingly.

[0127] 4. Incubate the nucleated cell resuspension solution with the magnetic bead mixture at 4°C for 30 minutes using a test tube rotating mixer at 10 rpm.

[0128] 5. Place the incubated magnetic beads on a magnetic bead concentrator, let stand for 5 minutes, and discard the clear solution. Add 1 ml of buffer 2 to wash the magnetic beads, place them on a magnetic bead concentrator, let stand for 1 minute, and discard the clear solution. Repeat the washing of the magnetic beads 3 times. At this point, the ovarian cancer cells in the sample have been enriched on the magnetic beads.

[0129] The above steps 1-5 are the enrichment stage of circulating tumor cells.

[0130] 6. Add 200 μl of cell lysis / binding buffer (Lysis / Binding Buffer) that has been placed at room temperature in advance to the magnetic beads that have been enriched with ovarian cancer circulating tumor cells. After incubation at room temperature for 2-3 minutes, place it on the magnetic bead enrichment rack, transfer the clear liquid to a new 1.5 ml centrifuge tube, and discard the magnetic beads.

[0131] The above step 6) is the circulating tumor cell lysis stage.

[0132] 7. Take mRNA DIRECT TM Kit Oligo(dT) 25 Magnetic beads (referred to as Oligo(dT) 25 Magnetic beads) on a magnetic bead concentrator, discard the supernatant and add cell lysis / binding buffer to resuspend. The ratio of the two is 40μl Oligo(dT) 25 The beads were resuspended in 50 μl of cell lysis / binding buffer.

[0133] 8. Add the resuspended Oligo(dT) from step 7 to the supernatant from step 6. 25 Magnetic beads, add Oligo(dT) to every 200μl of supernatant 25 50 μl of magnetic beads were placed on a test tube rotating mixer and incubated at room temperature at 10 rpm for 15 minutes.

[0134] 9. Buffer A and Buffer B are placed at room temperature in advance, and the incubated Oligo(dT) 25 The magnetic beads were placed on a magnetic bead concentrator, and the clear liquid was discarded; then 200 μl of buffer A was added to wash the magnetic beads, and the beads were placed on a magnetic bead concentrator, allowed to stand for 1 minute, and the clear liquid was discarded; then 200 μl of buffer B was added to wash the magnetic beads, and the beads were placed on a magnetic bead concentrator, allowed to stand for 1 minute, and the clear liquid was discarded; finally 100 μl of buffer B was added to wash the magnetic beads, and the beads were placed on a magnetic bead concentrator, allowed to stand for 1 minute, and the clear liquid was discarded.

[0135] 10) Add 50 μl RNase-free ddH2O to wash the magnetic beads, place them on a magnetic bead concentrator, let stand for 1 minute, and discard the supernatant. Resuspend the magnetic beads with 29.5 μl RNase-free ddH2O and transfer them to a PCR tube, place them in a 65°C metal bath and incubate for 5 minutes. Place them on ice for 2 minutes to obtain an mRNA / magnetic bead mixture.

[0136] 11) Reverse transcription,

[0137] RevertAid First Strand cDNA Synthesis Kit was used for reverse transcription reaction, and the reaction system was prepared as shown in Table 2.

[0138] Table 2 Reverse transcription reaction system

[0139]

[0140]

[0141] RNase-free water was used to replace the mRNA / magnetic bead mixture as a negative control.

[0142] After preparing the reverse transcription system, place it in a PCR instrument for reverse transcription reaction. The reaction steps are 37°C for 60 minutes; 4°C for ∞.

[0143] After the reaction is completed, the cDNA samples were stored at -20°C. If long-term storage is required, they can be stored at -80°C.

[0144] Example 6 Multiplex PCR

[0145] Multiplex PCR amplification was performed on the cDNA of M2 macrophages prepared in Example 3 and the cDNA of ovarian cancer cells prepared in Example 5 to compare the detection effects.

[0146] The primers CD163 and CD68 for M2 macrophage markers and the primers P16, TP53, EpCAM, HER2, MUC1, WT1, PAX8 for tumor cell markers were selected and the internal standard primer ACTIN was added for multiple PCR amplification. In order to reduce the interference between primers in multiple PCR amplification, three pairs of primers and one pair of internal standard primers were selected to form a reaction system, and the primers were divided into three groups: Group 1 (EpCAM, HER2, MUC1, ACTIN), Group 2 (WT1, P16, PAX8, ACTIN) and Group 3 (CD163, CD68, TP53, ACTIN). The primer sequences of M2 macrophage markers and tumor cell markers are shown in Table 3.

[0147] Table 3 Primer sequences for multiplex PCR reactions of M2 macrophage markers and tumor cell markers

[0148]

[0149]

[0150] The above three sets of primers were used for multiple PCR reactions with cDNA of M2 macrophages from peripheral whole blood of two patients (patient 1 and patient 2) and cDNA of ovarian cancer tumor cells. The multiplex PCR amplification system is shown in Table 4.

[0151] Table 4 Multiplex PCR reaction system

[0152]

[0153] The primer mixture was a mixture of the required primers in equal volume ratios, and RNase-free water was used instead of sample cDNA as a negative control.

[0154] The multiplex PCR reaction program is shown in Table 5:

[0155] Table 5 Multiplex PCR reaction program

[0156]

[0157] The amplified product can be stored at 4°C. If long-term storage is required, store it at -20°C or -80°C.

[0158] The PCR products were analyzed using an Agilent bioanalyzer. Figure 1As shown, bands 1-6 are the reaction results of peripheral whole blood samples taken from patient 1, bands 1-3 are multiplex PCR reactions of cDNAs enriched in ovarian cancer circulating tumor cells, band 1 is reacted with primers of group 1 (EpCAM, HER2, MUC1, ACTIN), band 2 is reacted with primers of group 2 (WT1, P16, PAX8, ACTIN), and band 3 is reacted with primers of group 3 (CD163, CD68, TP53, ACTIN). Bands 4-6 are multiplex PCR reactions of cDNAs enriched in M2 macrophages, band 4 is reacted with primers of group 1 (EpCAM, HER2, MUC1, ACTIN), band 5 is reacted with primers of group 2 (WT1, P16, PAX8, ACTIN), and band 6 is reacted with primers of group 3 (CD163, CD68, TP53, ACTIN). Bands 7-12 are the reaction results of the peripheral whole blood sample taken from patient 2. Bands 7-9 are multiplex PCR reactions for cDNA of enriched ovarian cancer circulating tumor cells. Band 7 was reacted with primers of group 1 (EpCAM, HER2, MUC1, ACTIN), band 8 was reacted with primers of group 2 (WT1, P16, PAX8, ACTIN), and band 9 was reacted with primers of group 3 (CD163, CD68, TP53, ACTIN). Bands 10-12 are multiplex PCR reactions for cDNA of enriched M2 macrophages. Band 10 was reacted with primers of group 1 (EpCAM, HER2, MUC1, ACTIN), band 11 was reacted with primers of group 2 (WT1, P16, PAX8, ACTIN), and band 12 was reacted with primers of group 3 (CD163, CD68, TP53, ACTIN).

[0159] from Figure 1 As can be seen, all results contain ACTIN bands, indicating that the multiplex PCR amplification reaction was successful. As can be seen from bands 3 and 9, when ovarian cancer cells were enriched by the CTC method, the markers of M2 macrophages could be obtained, indicating that M2 macrophages did engulf ovarian cancer cells. Therefore, the presence of ovarian cancer cells can be detected whether M2 macrophages or ovarian cancer cells are enriched. For the same patient, whether the CTC method or the M2 macrophage enrichment method is used, when PCR is performed using tumor markers of ovarian cancer cells, the results are consistent, indicating that M2 macrophages and CTCs have the same detection accuracy, so primers for M2 macrophages combined with tumor markers of ovarian cancer cells can be used to identify ovarian cancer.

[0160] During the operation, the CD163 primer or the CD68 primer can also be replaced with a CD204 primer: an upstream primer such as SEQ ID NO: 5: GACGTTGGGGAGATGAGGAG and a downstream primer such as SEQ ID NO: 6: TCTGTGTCCATGAGGTTGGC for identification.

[0161] However, when only the M2 macrophage markers CD163, CD68, CD204, and the universal tumor markers TP53 and P16 are used instead of specific ovarian cancer tumor markers, it is possible to identify that the test sample contains tumor cells. Figure 1 Middle bands 3, 6, 9, and 12 have great application value in the early screening and diagnosis of tumors. For general testers, there is no need to enrich and test each tumor type separately, which saves a lot of manpower and material resources.

[0162] Example 7 Multiplex PCR of M2 macrophages and bladder cancer CTCs

[0163] Peripheral whole blood was collected from a bladder cancer patient, and two nucleated cell suspensions (2 ml) were prepared using the method used in Example 1. One nucleated cell suspension was treated using the methods of Examples 2 and 3 to obtain cDNA of M2 macrophages, and the other nucleated cell suspension was treated using the methods of Examples 4 and 5, wherein the monoclonal antibodies for ovarian cancer (EpCAM monoclonal antibody, HER2 monoclonal antibody, and MUC1 monoclonal antibody) in step 3 of Example 2 were replaced with monoclonal antibodies for bladder cancer (CK19 monoclonal antibody, EpCAM monoclonal antibody, EGFR monoclonal antibody) to obtain cDNA of bladder cancer cells.

[0164] Then, the cDNA of M2 macrophages and the cDNA of bladder cancer cells were amplified by multiplex PCR to compare the detection effects.

[0165] The primers for bladder cancer cell markers used were EpCAM, CK7, CK19, UCA1, GATA3, THBD, EGFR-1, and the internal standard primer ACTIN was added for multiplex PCR amplification. In order to reduce the interference between primers in multiplex PCR amplification, the primers were divided into two groups: Group 1 (EpCAM, CK7, CK19, UCA1, ACTIN) and Group 2 (THBD, GATA3, EGFR-1, ACTIN). The primer sequences of tumor cell markers are shown in Table 6.

[0166] Table 6 Primer sequences for multiplex PCR reaction of bladder cancer tumor cell markers

[0167]

[0168]

[0169] The multiplex PCR reaction system was as shown in Table 4 of Example 6, and the reaction procedure was as shown in Table 5.

[0170] The PCR products were analyzed using an Agilent bioanalyzer. Figure 2 As shown, band 1 and band 2 are multiplex PCR reactions of cDNA of enriched bladder cancer circulating tumor cells from bladder cancer patients, band 1 is reacted with primers of group 1 (EpCAM, CK7, CK19, UCA1, ACTIN), band 2 is reacted with primers of group 2 (THBD, GATA-3, EGFR, ACTIN), band 3 and band 4 are multiplex PCR reactions of cDNA of enriched M2 macrophages, band 3 is reacted with primers of group 1 (EpCAM, CK7, CK19, UCA1, ACTIN), band 4 is reacted with primers of group 2 (THBD, GATA-3, EGFR, ACTIN).

[0171] from Figure 2 As can be seen, all results contain ACTIN bands, indicating that the multiplex PCR reaction was successful. For the same patient, whether the CTC method or the M2 macrophage enrichment method was used, when the tumor markers of bladder cancer cells were used for PCR, the results were consistent, indicating that M2 macrophages and CTCs have the same detection accuracy, and primers for M2 macrophages combined with tumor markers of bladder cancer cells can be used to identify bladder cancer.

[0172] Example 8 Detection of other tumor tissues

[0173] In addition, the M2 macrophage detection kit containing tumor markers provided by the present invention can also be used to detect other tumor tissues, including but not limited to the following tumor tissues:

[0174] 1. Endometrial cancer was detected using tumor markers PAX8 and ER primers combined with ACTIN. The primer sequences are shown in Table 7.

[0175] Table 7 Primer sequences for multiplex PCR reaction of endometrial cancer tumor cell markers

[0176]

[0177]

[0178] 2. Pancreatic cancer was detected using tumor markers EpCAM, CEACAM5, and MUC16 primers combined with ACTIN. The primer sequences are shown in Table 8.

[0179] Table 8 Primer sequences for multiplex PCR reaction of pancreatic cancer tumor cell markers

[0180]

[0181] 3. Breast cancer was detected using tumor markers EpCAM, HER2, and MUC1 primers combined with ACTIN. The primer sequences are shown in Table 9.

[0182] Table 9 Primer sequences for multiplex PCR reaction of breast cancer tumor cell markers

[0183]

[0184] 4. Colorectal cancer was detected using tumor markers EpCAM, CEA, EGFR-2 primers combined with ACTIN. The primer sequences are shown in Table 10.

[0185] Table 10 Primer sequences for multiplex PCR reaction of colorectal cancer tumor cell markers

[0186]

[0187]

[0188] 5. Pancreatic cancer was detected using tumor markers EpCAM, CA9, CD44, PAX8 primers combined with ACTIN. The primer sequences are shown in Table 11.

[0189] Table 11 Primer sequences for multiplex PCR reaction of pancreatic cancer tumor cell markers

[0190]

[0191] In the above embodiments, the specific tumor tissue can be detected by changing the tumor marker of the specific tissue in combination with the M2 macrophage detection kit. In addition to the above disclosed tumor markers, other tumor cell markers can also be used to determine the source of the tumor cells, or other methods (such as sequencing, etc.) can also be used to determine the source of the tumor cells.

[0192] It can be seen from the above examples that the M2 macrophage tumor detection kit provided by the present invention has the following advantages compared with the existing CTCs detection:

[0193] 1. By detecting a type of cell called M2 macrophages, early diagnosis and screening of tumors can be performed, as well as monitoring of their changes and progression throughout the entire process. Compared with the original CTCs test, the cost of testing can be greatly reduced. The original CTCs test required testing of each tumor type one by one, but now only one test is required, which improves the test efficiency and saves costs.

[0194] 2. The monitoring indicators throughout the entire process of tumor occurrence and development are clearer, especially the detection of genetic changes before and after treatment is more specific.

[0195] 3.M2 macrophages provide a new target for tumor detection and treatment.

[0196] 4. The emergence of new detection targets and new technologies provides new opportunities and possibilities for the development of new anti-tumor drugs.

[0197] The M2 macrophage tumor detection kit provided by the present invention changes the previous detection mode of detecting a specific tumor cell to determine whether a patient has cancer. The present invention first determines whether the patient carries tumor cells by detecting M2 macrophages, and then detects the tissue type of the tumor cells as needed. This has great application value for early tumor screening and diagnosis in the early stages of tumor cell development, especially when tumor tissue blocks are difficult to directly observe, and can improve the survival rate of tumor patients through early detection and early treatment.

[0198] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several modifications or changes can be made without departing from the principle of the present invention. Such modifications or changes should also be regarded as covered by the protection scope of the present invention. SEQUENCE LISTING <110> Niu Gang Tan Huanran <120> M2 macrophage detection kit containing tumor markers and its application <130> DEMO <160> 48 <170> PatentIn version 3.3 <210> 1 <211> 19 <212> DNA <213> Artificial sequence <400> 1 tctggcttga cagcgtttc 19 <210> 2 <211> 18 <212> DNA <213> Artificial sequence <400> 2 gtgtttgttg cctggatt 18 <210> 3 <211> 18 <212> DNA <213> Artificial sequence <400> 3 cgcagcacag tggacatt 18 <210> 4 <211> 18 <212> DNA <213> Artificial sequence <400> 4 aggccaagaa ggatcagg 18 <210> 5 <211> 20 <212> DNA <213> Artificial sequence <400> 5 gacgttgggg agatgaggag 20 <210> 6 <211> 20 <212> DNA <213> Artificial sequence <400> 6 tctgtgtcca tgaggttggc 20 <210> 7 <211> 20 <212> DNA <213> Artificial sequence <400> 7 tctgagaaac ctcgggaaac 20 <210> 8 <211> 18 <212> DNA <213> Artificial sequence <400> 8 ctcgcaagaa atgcccac 18 <210> 9 <211> twenty two <212> DNA <213> Artificial sequence <400> 9 gcagtcagat cctagcgtcg ag 22 <210> 10 <211> twenty two <212> DNA <213> Artificial sequence <400> 10 ttcatctgga cctgggtctt ca 22 <210> 11 <211> 18 <212> DNA <213> Artificial sequence <400> 11 tgagcgagtg agaaccta 18 <210> 12 <211> 18 <212> DNA <213> Artificial sequence <400> 12 cacaacaatt ccagcaac 18 <210> 13 <211> 18 <212> DNA <213> Artificial sequence <400> 13 aggagtgcgt ggaggaat 18 <210> 14 <211> 18 <212> DNA <213> Artificial sequence <400> 14 agtgggtgca gttgatgg 18 <210> 15 <211> 20 <212> DNA <213> Artificial sequence <400> 15 gcaccgacta ctaccaagag 20 <210> 16 <211> 19 <212> DNA <213> Artificial sequence <400> 16 aaggaaatgg cacatcact 19 <210> 17 <211> 18 <212> DNA <213> Artificial sequence <400> 17 agtccgccat cacaacat 18 <210> 18 <211> 20 <212> DNA <213> Artificial sequence <400> 18 tggtacaata attccatccc 20 <210> 19 <211> 18 <212> DNA <213> Artificial sequence <400> 19 gaagcaatag ccgaggaa 18 <210> 20 <211> 20 <212> DNA <213> Artificial sequence <400> 20 tgtagaaaga gccaagcaaa 20 <210> twenty one <211> 19 <212> DNA <213> Artificial sequence <400> twenty one gaaatcgtgc gtgacatta 19 <210> twenty two <211> 18 <212> DNA <213> Artificial sequence <400> twenty two aggcagctcg tagctctt 18 <210> twenty three <211> 18 <212> DNA <213> Artificial sequence <400> twenty three ccactactac acgaccat 18 <210> twenty four <211> 17 <212> DNA <213> Artificial sequence <400> twenty four cagcgtactg atttcct 17 <210> 25 <211> 20 <212> DNA <213> Artificial sequence <400> 25 gccagcctca gcttaatcca 20 <210> 26 <211> 20 <212> DNA <213> Artificial sequence <400> 26 ccctgttgct aagccgatga 20 <210> 27 <211> 20 <212> DNA <213> Artificial sequence <400> 27 accaggaact catgagcgtg 20 <210> 28 <211> 20 <212> DNA <213> Artificial sequence <400> 28 ctggagaagc tcagggcatt 20 <210> 29 <211> 20 <212> DNA <213> Artificial sequence <400> 29 cacagaaggc agggagtgtg 20 <210> 30 <211> 20 <212> DNA <213> Artificial sequence <400> 30 cgagctgttc ttggggaagt 20 <210> 31 <211> 18 <212> DNA <213> Artificial sequence <400> 31 gtggacccgt gcttcaga 18 <210> 32 <211> 18 <212> DNA <213> Artificial sequence <400> 32 cgatgtccgt gcagatga 18 <210> 33 <211> 20 <212> DNA <213> Artificial sequence <400> 33 gtcgggctct ggaggaaaag 20 <210> 34 <211> 20 <212> DNA <213> Artificial sequence <400> 34 cataaccagc cacctcctgg 20 <210> 35 <211> twenty two <212> DNA <213> Artificial sequence <400> 35 ttgctatgtt actaagcgtg ag 22 <210> 36 <211> twenty two <212> DNA <213> Artificial sequence <400> 36 ggtgctataa taaacccttg ac 22 <210> 37 <211> 16 <212> DNA <213> Artificial sequence <400> 37 gaagaacagc ggactc 16 <210> 38 <211> 16 <212> DNA <213> Artificial sequence <400> 38 ataggctctt gcgtca 16 <210> 39 <211> 18 <212> DNA <213> Artificial sequence <400> 39 aaaacggctc tgatacct 18 <210> 40 <211> twenty one <212> DNA <213> Artificial sequence <400> 40 tgggtgctga gttgatgatg t 21 <210> 41 <211> twenty two <212> DNA <213> Artificial sequence <400> 41 ctgctcacag cctcacttct aa 22 <210> 42 <211> twenty three <212> DNA <213> Artificial sequence <400> 42 gggtagcttg ttgagttcct att 23 <210> 43 <211> 19 <212> DNA <213> Artificial sequence <400> 43 gaccgtttgg gagttgatg 19 <210> 44 <211> 19 <212> DNA <213> Artificial sequence <400> 44 gggcgactat ctgcgtcta 19 <210> 45 <211> 20 <212> DNA <213> Artificial sequence <400> 45 tacagctgaa cttccgagcg 20 <210> 46 <211> 20 <212> DNA <213> Artificial sequence <400> 46 ctaggctcca gtctcggcta 20 <210> 47 <211> twenty one <212> DNA <213> Artificial sequence <400> 47 tggcagcccc gattatttac a 21 <210> 48 <211> 20 <212> DNA <213> Artificial sequence <400> 48 gctttctcca tctgggccat 20

Claims

1. An M2 macrophage detection kit containing a tumor marker, characterized in that: The kit includes: Magnetic beads conjugated with M2 macrophage antibodies; Magnetic beads bound to oligonucleotide Oligo(dT); primers for M2 macrophage markers; primers for tumor cell markers; Wherein, the M2 macrophage markers are two of CD163, CD68, and CD204; The tumor cell markers are TP53 and P16; Described CD163 primer sequence is: The upstream primer is shown in SEQ ID NO: 1; The downstream primer is shown in SEQ ID NO: 2; The CD68 primer sequence is: The upstream primer is shown in SEQ ID NO: 3; The downstream primer is shown in SEQ ID NO: 4; The CD204 primer sequence is: The upstream primer is shown in SEQ ID NO: 5; The downstream primer is shown in SEQ ID NO: 6; The P16 primer sequence is: The upstream primer is shown in SEQ ID NO: 7; The downstream primer is shown in SEQ ID NO: 8; The TP53 primer sequence is: The upstream primer is shown in SEQ ID NO: 9; The downstream primer is shown in SEQ ID NO: 10; The M2 macrophage antibodies are anti-CD68 monoclonal antibodies and anti-CD163 monoclonal antibodies.

2. An M2 macrophage detection kit for detecting specific tumor tissues, characterized in that: The kit according to claim 1 further comprises primers for one or more specific tumor cell markers.

3. The M2 macrophage detection kit for detecting specific tumor tissues according to claim 2, wherein: The specific tumor tissues include one or more of lung cancer, liver cancer, gastric cancer, esophageal cancer, nasopharyngeal cancer, pancreatic cancer, colon cancer, bladder cancer, kidney cancer, skin cancer, thyroid cancer, breast cancer, cervical cancer, ovarian cancer, endometrial cancer, prostate cancer, colorectal cancer, malignant glioma, and osteosarcoma.

4. The M2 macrophage detection kit for detecting specific tumor tissues according to claim 2, wherein: The primers for the specific tumor cell markers include primers for tumor cell markers in lung cancer, liver cancer, gastric cancer, esophageal cancer, nasopharyngeal cancer, pancreatic cancer, colon cancer, bladder cancer, kidney cancer, skin cancer, thyroid cancer, breast cancer, cervical cancer, ovarian cancer, endometrial cancer, prostate cancer, colorectal cancer, malignant glioma or osteosarcoma.

5. Use of the kit according to any one of claims 1 to 4 in the preparation of a kit for early screening, early diagnosis and full-course monitoring of tumor development.

Images