Construction and application of megakaryocyte conditional knockout TYMP gene mouse model

Abstract

The present invention discloses a method for constructing a megakaryocyte conditional knockout TYMP gene mouse model and its application, and relates to the field of biotechnology. The method for constructing a megakaryocyte conditional knockout TYMP gene mouse model is to specifically knock out the megakaryocyte TYMP gene based on the CRISPR / Cas9 system, and the knockout site is the upstream of the second exon sequence and the downstream of the fourth exon sequence of the TYMP gene. The megakaryocyte conditional knockout TYMP gene mouse model constructed by this method can survive for more than five months, and has a good application prospect in screening drugs related to inhibiting platelet activation and studying the molecular mechanism of thrombosis and inflammation-related diseases.

Description

Technical Field

[0001] This invention relates to the field of biotechnology, and in particular to a method for constructing a mouse model of conditional knockout of the TYMP gene in megakaryocytes and its application. Background Technology

[0002] Platelet activation is a crucial factor in thrombosis and many inflammatory diseases, and is closely associated with various conditions such as cerebral infarction, coronary heart disease, malignant tumors, and systemic lupus erythematosus. Previous studies have demonstrated the close relationship between the TYMP gene and platelet activation; however, the function of its gene expression products and the molecular mechanisms underlying thrombosis and inflammatory diseases caused by gene mutations remain unclear. Therefore, using a mouse model with conditional knockout of the TYMP gene in megakaryocytes to study the molecular mechanisms of thrombosis and inflammation-related diseases can provide a theoretical basis for the diagnosis and treatment of these diseases. Summary of the Invention

[0003] This invention aims to address at least one of the technical problems existing in the prior art. To this end, this invention proposes a megakaryocyte conditional knockout TYMP gene mouse model, which shows great promise for screening drugs that inhibit platelet activation and for studying the molecular mechanisms of thrombosis and inflammation-related diseases.

[0004] A first aspect of the present invention provides a method for constructing a mouse model of conditional knockout of the TYMP gene in megakaryocytes, comprising the following steps:

[0005] S1: Design and transcribe gRNA in vitro, and simultaneously modify the TYMP gene with flox to construct Donor DNA;

[0006] S2: After injecting gRNA, Donor DNA and Cas9 protein into mouse zygotes, the zygotes were implanted into the uterus of pseudopregnant mice. The F0 generation mice were then mated with wild-type mice to obtain F1 generation heterozygous mice with conditional knockout of the TYMP gene.

[0007] S3: Then, the F1 generation heterozygous mice with conditional knockout of the TYMP gene were mated to obtain the F2 generation homozygous mice with conditional knockout of the TYMP gene.

[0008] S4: Then, the F2 generation homozygous mice with conditional knockout of the TYMP gene were mated with PF4-Cre mice that specifically expressed Cre in megakaryocytes to obtain F3 generation heterozygous mice with conditional knockout of the TYMP gene in megakaryocytes.

[0009] S5: Then, F3 generation megakaryocyte conditionally knocked-out TYMP gene mice were crossbred to obtain F4 generation megakaryocyte conditionally knocked-out TYMP gene homozygous mice.

[0010] In some embodiments of the present invention, in step S1, the flux modification of the TYMP gene specifically involves inserting LoxP sequences at both ends of the TYMP gene sequence.

[0011] In some preferred embodiments of the present invention, in step S1, the flox modification of the TYMP gene specifically involves inserting LoxP sequences at both ends of the 2nd to 4th exons of the TYMP gene.

[0012] In some embodiments of the present invention, in step S1, the gRNA includes gRNA1 and gRNA2, wherein the sequence of gRNA1 is as shown in SEQ ID NO.1 and the sequence of gRNA2 is as shown in SEQ ID NO.2.

[0013] In some embodiments of the present invention, in step S1, the nucleotide sequence of the Donor DNA in the CRISPR / Cas9 technology is as shown in SEQ ID NO.19.

[0014] In some embodiments of the present invention, the screening method for the mice includes PCR, sequencing, and Southern blot.

[0015] In some embodiments of the present invention, the method for screening the mice includes a PCR method, and the primers used include: F1 / R1, F2 / R2, F3 / R3, F4 / R4 and F5 / R5;

[0016] The F1 sequence is: 5'-GTAACTTACCCCACCCCAGTTCT-3' (SEQ ID NO.3);

[0017] The R1 sequence is: 5'-GTGGATTCGGACCAGTCTGA-3' (SEQ ID NO.4);

[0018] The F2 sequence is: 5'-TTACAGACTGGAGCAATAACTTC-3' (SEQ ID NO.5);

[0019] The R2 sequence is: 5'-CTGAGCGCAGGGCCGTCTAGGTG-3' (SEQ ID NO.6);

[0020] The F3 sequence is: 5'-GATTTGTGAGGTCGAGAAATGGAA-3' (SEQ ID NO.7);

[0021] The R3 sequence is: 5'-TCATTAACTTCTAGGGACGGACC-3 (SEQ ID NO.8);

[0022] The F4 sequence is: 5'-AGTGGTGTCTCAATATCCCTTACA-3' (SEQ ID NO.9);

[0023] The R4 sequence is: 5'-GCACGAAGTTTCTGATATCTGCTTC-3' (SEQ ID NO.10);

[0024] The F5 sequence is: 5'-ATCTGGGTTGAGGGAGTCACTGG-3' (SEQ ID NO.11);

[0025] The R5 sequence is: 5'-GAGTCAGTATGGTTCTGATGGCT-3' (SEQ ID NO.12).

[0026] In some embodiments of the present invention, the amplification program for F1 / R1, F2 / R2, or F3 / R3 is as follows: 94℃ for 3 min; 94℃ for 30 s, 60℃ for 30 s, 65℃ for 180 s, 33 cycles; 65℃ for 10 min.

[0027] In some embodiments of the present invention, the amplification program for F4 / R4 or F5 / R5 is as follows: 94℃ for 3 min; 94℃ for 30 s, 60℃ for 30 s, 72℃ for 35 s, 35 cycles; 72℃ for 5 min.

[0028] In some embodiments of the present invention, the method for screening the mice includes Southern blot, and the probes used include 5' probes and 3' probes;

[0029] The sequence of the 5' probe is shown in SEQ ID NO.21;

[0030] The sequence of the 3' probe is shown in SEQ ID NO.22.

[0031] In some embodiments of the present invention, the method for screening the mice includes Southern blot, wherein the amplification primers for the 5' probe are F6 / R6, and the F6 sequence is: 5'-CCAATTAGCCAGATAGCAGGTGGG-3' (SEQ ID NO.13);

[0032] The R6 sequence is: 5'-TCCAAACCTTGCTCTTACAGGGTCTC-3' (SEQ ID NO.14);

[0033] The amplification primers for the 3' probe used were F7 / R7, and the F7 sequence was: 5'-TTCTGGTCTTCGCAGCTTCAATCCT-3' (SEQ ID NO.15);

[0034] The R7 sequence is: 5'-ATTGGATAGGGTAGGAGGGCTGGAAA-3' (SEQ ID NO. 16).

[0035] In some embodiments of the present invention, the amplification program for F6 / R6 and F7 / R7 is as follows: 94℃ for 3 min; 94℃ for 30 s, 60℃ for 30 s, 72℃ for 35 s, 35 cycles; 72℃ for 5 min.

[0036] In some embodiments of the present invention, when screening F3 or F4 generation mice, the PCR detection primers further include F8 and R8;

[0037] The sequence of F8 is: 5'-GAACGCACTGATTTCGACCA-3' (SEQ ID NO.17);

[0038] The sequence of R8 is: 5'-GCTAACCAGCGTTTTCGTTC-3' (SEQ ID NO.18).

[0039] In a second aspect, the present invention provides the application of a CRISPR / Cas9 system in constructing a mouse model of conditional knockout of the TYMP gene in megakaryocytes, the system comprising Cas9 protein, gRNA1 with the sequence shown in SEQ ID NO. 1, gRNA2 with the sequence shown in SEQ ID NO. 2, and Donor DNA with the sequence shown in SEQ ID NO. 19.

[0040] A third aspect of the present invention provides the application of a megakaryocyte conditional knockout TYMP gene mouse model constructed according to the method of the first aspect of the present invention in screening drugs related to inhibiting platelet activation.

[0041] A fourth aspect of the present invention provides the application of a megakaryocyte conditional knockout TYMP gene mouse model constructed according to the method of the first aspect of the present invention in the study of the molecular mechanisms of thrombosis and inflammation-related diseases.

[0042] In some embodiments of the present invention, the thrombosis and inflammation-related diseases include atherosclerosis, ischemic stroke, deep vein thrombosis, sepsis, and nephrotic syndrome.

[0043] The beneficial effects of this invention are:

[0044] This invention utilizes CRISPR / Cas9 gene editing technology, using gRNA to guide the site-specific cleavage of Cas9 protein and donor DNA, followed by homologous recombination repair. LoxP sites are inserted upstream and downstream of exons 2-4 of TYMP, resulting in a higher targeting success rate. This invention specifically knocks out the TYMP gene in megakaryocytes, leading to a higher survival rate (100%) and a longer survival period (over five months), effectively ensuring the smooth progress of experiments. The conditional TYMP gene knockout mouse model obtained through the megakaryocyte-specific TYMP gene knockout mouse model of this invention shows great promise for screening drugs that inhibit platelet activation and for studying the molecular mechanisms of thrombosis and inflammation-related diseases. Attached Figure Description

[0045] The present invention will be further described below with reference to the accompanying drawings and embodiments, wherein:

[0046] Figure 1 This is a schematic diagram of the design of primers F1, R1, F2, R2, F3 and R3 for mouse genotype PCR identification in this embodiment of the invention.

[0047] Figure 2 This is a schematic diagram of the primers F4, R4, F5 and R5 for PCR identification of mouse genotypes in this embodiment of the invention.

[0048] Figure 3 This is a schematic diagram of the restriction enzyme sites, 5' probe, and 3' probe design for mouse genotype Southern blot identification in this embodiment of the invention.

[0049] Figure 4 The results of F1 / R1 and F2 / R2 amplification of the F1 generation mouse genome are shown in the embodiments of the present invention.

[0050] Figure 5 This is the sequencing result of the F3 / R3 amplification product of the F1 generation mouse genome in an embodiment of the present invention.

[0051] Figure 6 This is the Southern blot result of the F1 generation mouse genotype in this embodiment of the invention. Detailed Implementation

[0052] To enable those skilled in the art to more clearly understand the technical solutions described in this invention, the following embodiments are provided for illustration. It should be noted that the following embodiments do not constitute a limitation on the scope of protection claimed by this invention.

[0053] Unless otherwise specified, the experimental materials and reagents used in the following examples are all consumables and reagents that are routinely available from commercial sources.

[0054] The C57BL6 / N mice and the PF4-Cre mice with megakaryocyte-specific Cre expression in the following examples were provided by Cyagen Biosciences.

[0055] This invention utilizes CRISPR / Cas9 technology to insert LoxP sequences upstream and downstream of exons 2-4 of the TYMP gene, resulting in flop mice with LoxP sites at both ends of exons 2-4 of the TYMP gene. Based on the Cre-LoxP system principle, flop mice are then crossed with PF4-Cre mice, and the elements between the LoxP sites are knocked out using Cre recombinase to obtain megakaryocyte-specific TYMP gene knockout mice.

[0056] Mouse genome extraction method

[0057] 1) Method 1:

[0058] High-purity genomic DNA was obtained using the TaKaRa Mini BEST Universal genomic DNA extraction kit (Ver.5.0_CodeNo.9765). The specific steps are as follows:

[0059] ① Cut off about 3mm of the mouse's tail;

[0060] ② Add 180 μL buffer GL, 20 μL proteinase K, 10 μL RNase A (provided by TaKaRaMini BEST Universal Genomic DNA Extraction Kit) and the mouse tail from step ① to a microcentrifuge tube, and incubate overnight at 56°C;

[0061] ③ Centrifuge the microcentrifuge tube from step ② in a microcentrifuge at 12,000 rpm for 2 min, collect the supernatant and discard the precipitate;

[0062] ④ Add 200 μL of Buffer GB (provided by the TaKaRa Mini BEST Universal Genomic DNA Extraction Kit) and 200 μL of anhydrous ethanol to the supernatant from step ③, mix thoroughly, and then transfer to a centrifuge column (provided by the TaKaRa Mini BEST Universal Genomic DNA Extraction Kit);

[0063] ⑤ Place the centrifuge column in the collection tube, centrifuge at 12,000 rpm for 2 min, and discard the liquid in the collection tube;

[0064] ⑥ Add 500 μL of Buffer WA (provided by TaKaRa Mini BEST Universal Genomic DNA Extraction Kit) to the centrifuge column, centrifuge at 12,000 rpm for 1 minute, and discard the liquid in the collection tube;

[0065] ⑦ Add 700 μL of Buffer WB (provided by the TaKaRa Mini BEST Universal Genomic DNA Extraction Kit) to the centrifuge column, centrifuge at 12,000 rpm for 1 min, and discard the liquid in the collection tube (Note: Ensure that Buffer WB has been premixed with anhydrous ethanol at a volume ratio of 3:7 before use. Add Buffer WB along the tube wall to wash away any residual salts on the collection tube wall);

[0066] ⑧ Repeat step ⑦;

[0067] ⑨ Place the centrifuge column in the collection tube, centrifuge at 12,000 rpm for 2 minutes, and discard the liquid in the collection tube;

[0068] ⑩ Transfer the centrifuge column to a new 1.5 mL centrifuge tube, add 50-200 μL of sterile water or elution buffer to the center of the column membrane, let stand for 5 min, then centrifuge at 12,000 rpm for 2 min. The elution buffer at the bottom of the 1.5 mL centrifuge tube is the eluted genomic DNA (Note: Preheating the sterile water or elution buffer to 65℃ before use can improve the elution efficiency of genomic DNA).

[0069] Add the elution buffer from step 10 and / or 50–200 μL of sterile water or elution buffer to the center of the column membrane of the centrifuge column. After standing for 5 min, centrifuge at 12,000 rpm for 2 min to increase the DNA yield. The liquid at the bottom of the 1.5 mL centrifuge tube after centrifugation is the mouse genomic DNA.

[0070] Genomic DNA quantification: The genomic DNA obtained by elution can be quantified by electrophoresis.

[0071] 2) Method Two

[0072] A low-cost, crude method for extracting genomic DNA, with the following specific steps:

[0073] ① Cut off 2-5mm of the mouse tail;

[0074] ② Add the mouse tail from step ① and 100 μL of mouse tail digestion buffer to a microcentrifuge tube and incubate overnight at 56°C;

[0075] ③ The microcentrifuge tubes from step ② are incubated at 98°C for 13 minutes to denature proteinase K;

[0076] ④ Centrifuge the microcentrifuge tube at 15,000 rpm for 15 min in a microcentrifuge, and take the supernatant. The supernatant contains the crudely extracted mouse genomic DNA.

[0077] The rat tail digestion buffer contains 50 mM KCl, 10 mM Tris-HCl (pH 9.0), 0.1% Triton X-100, and 0.4 mg / mL proteinase K.

[0078] Construction of a mouse model of conditional knockout of the TYMP gene in megakaryocytes

[0079] (1) Construction and screening of F0 generation mice:

[0080] Based on CRISPR / Cas9 technology, according to the exons encoding the TYMP protein, the upstream of exon 2 and the downstream of exon 4 of the TYMP gene were located and the corresponding gRNAs were designed. No highly homologous sequences to this site will appear at other sites. At the same time, a donor DNA vector containing the LoxP site was designed (the sequence is shown in SEQ ID NO.17).

[0081] The sequence of the TYMP gene gRNA is as follows:

[0082] The recognition sequence upstream of exon 2, gRNA1 (SEQ ID NO.1): 5'-ACTGGAGCAATGGCAGC TCC-3';

[0083] The recognition sequence downstream of exon 4, gRNA2 (SEQ ID NO.2): 5'-CTTTGATCGGGATCGTTA CT-3';

[0084] The sequence of the donor DNA is as follows:

[0085]

[0086]

[0087]

[0088] In this sequence, the bolded portion represents the LoxP site, the underlined portion represents the exon region, the gray background area represents the cKO region, and the italicized portion represents the homologous arm. The homologous arm upstream of exon 2 includes exons 3-5 and the non-coding region of the Odf3b gene, exon 1 and the non-coding region of the Tymp gene, and the non-coding region of exon 2 of the Tymp gene. The homologous arm downstream of exon 4 includes exons 5-9 of the TYMP gene and part of the non-coding region at the 5' end of the Sco2 gene. In the sequence 5'-GTCAGACTGGTCCGAATCCACAGTACTGAATTC-3' following the downstream LoxP site, 5'-GTCAGACTGGTCCGAATCCAC-3' is an additional primer sequence for identification, 5'-AGTACT-3' is an introduced ScaI restriction site, and 5'-GAATTC-3' is an introduced EcoRI restriction site.

[0089]

[0090] gRNA, Donor DNA vector, and Cas9 protein were mixed and injected into fertilized eggs retrieved from pregnant mice. These fertilized eggs were then transplanted into the uterus of pseudopregnant mice to breed F0 generation mice. The genomes of the F0 generation mice were extracted using the mouse genome extraction method described in the above embodiment, and genotyping was performed by PCR and sequencing.

[0091] (2) Breeding and screening of F1 generation mice:

[0092] The F0 generation mice that were identified as positive were crossed with wild-type mice to obtain the F1 generation mice.

[0093] Six mice were born in the F1 generation, designated as 62, 63, 64, 65, 66, and 68. Genotyping was performed using PCR, sequencing, and Southern blot.

[0094] The design diagram of primers F1, R1, F2, R2, F3, and R3 used for PCR identification is shown below. Figure 1 As shown, F1 / R1 is used to amplify the anterior homologous arm of the LoxP fragment to the posterior segment of exon 4 of the TYMP gene (containing the LoxP site) to verify whether the anterior homologous arm of the LoxP fragment and the conditional knockout region of the TYMP gene are correct; F2 / R2 is used to amplify the anterior segment of exon 2 of the TYMP gene (containing the LoxP site) to the posterior homologous arm of the LoxP fragment to verify whether the posterior homologous arm of the LoxP fragment and the conditional knockout region of the TYMP gene are correct; F3 is used for sequencing to verify whether the LoxP site sequence of the anterior segment of exon 2 of the TYMP gene in the fragment amplified by F1 / R1 is correct, and R3 is used for sequencing to verify whether the LoxP site sequence of the posterior segment of exon 4 of the TYMP gene in the fragment amplified by F2 / R2 is correct, to verify whether the LoxP sites at both ends of the target sequence are inserted on the same chromosome. For mice with correct LoxP insertion, the amplified gene sequence length for F1 / R1 was 3.3 kb, and the amplified gene sequence length for F2 / R2 was 3.3 kb. The specific sequences of F1 / R1, F2 / R2, and F3 / R3 are as follows:

[0095] F1: 5'-GTAACTTAACCCCACCCCAGTTCT-3' (SEQ ID NO.3);

[0096] R1: 5'-GTGGATTCGGACCAGTCTGA-3' (SEQ ID NO.4);

[0097] F2: 5'-TTACAGACTGGAGCAATAACTTC-3' (SEQ ID NO.5);

[0098] R2: 5'-CTGAGCGCAGGGCCGTCTAGGTG-3' (SEQ ID NO. 6);

[0099] F3: 5'-GATTTGTGAGGTCGAGAAATGGAA-3' (SEQ ID NO. 7);

[0100] R3: 5'-TCATTAACTTCTAGGGACGGACC-3 (SEQ ID NO.8);

[0101] The PCR reaction systems for F1 / R1 and F2 / R2 are as follows:

[0102]

[0103]

[0104] The PCR amplification program was as follows: 94℃ for 3 min; 94℃ for 30 s, 60℃ for 30 s, 65℃ for 180 s, 33 cycles; 65℃ for 10 min.

[0105] Furthermore, when mouse genomic DNA is impure or there is insufficient PCR extension time, F4 / R4 and F5 / R5 can be used to amplify the mouse genome according to the corresponding systems and procedures. The design diagrams for F4 / R4 and F5 / R5 are shown below. Figure 2 As shown, F4 / R4 is used to amplify a gene fragment containing the upstream LoxP site and the 5' end sequence of exon 2 of the TYMP gene, while F5 / R5 is used to amplify a gene fragment containing the downstream LoxP site and the 5' end sequence of the homologous arm of the LoxP fragment. The specific sequences of F4 / R4 and F5 / R5 are as follows:

[0106] F4: 5'-AGTGGTGTTCCAATATCCCTTACA-3' (SEQ ID NO.9);

[0107] R4: 5'-GCACGAAGTTTCTGATATCTGCTTC-3' (SEQ ID NO. 10);

[0108] F5: 5'-ATCTGGGTTGAGGGAGTCACTGG-3' (SEQ ID NO. 11);

[0109] R5: 5'-GAGTCAGTATGGTTCTGATGGCT-3' (SEQ ID NO. 12);

[0110] For the F4 / R4 amplified allele fragment, the allele length in mice with successful LoxP insertion was 201 bp, in wild-type mice it was 167 bp, and in heterozygous mice it was simultaneously amplified to gene sequences of 167 bp and 201 bp, respectively. For the F5 / R5 amplified allele fragment, the allele length in mice with successful LoxP insertion was 325 bp, in wild-type mice it was 258 bp, and in heterozygous mice it was simultaneously amplified to gene sequences of 325 bp and 258 bp, respectively. Amplification was performed according to the following system and procedure:

[0111] The PCR reaction system is as follows:

[0112]

[0113] The PCR amplification program was as follows: 94℃ for 3 min; 94℃ for 30 s, 60℃ for 30 s, 72℃ for 35 s, 35 cycles; 72℃ for 5 min.

[0114] Furthermore, for further verification, mouse genomic DNA was digested with the ScaI restriction endonuclease, followed by Southern blot detection. The experimental strategy for Southern blot is as follows: Figure 3 As shown, the sequence complementary to the 5' probe is a sequence on the anterior homologous arm of the LoxP fragment, and the sequence complementary to the 3' probe is a sequence on the posterior homologous arm of the LoxP fragment. In wild-type mice, digestion with the ScaI restriction endonuclease yields a gene fragment capable of hybridizing with both the 5' and 3' probes simultaneously. If the LoxP insertion is successful, digestion with the ScaI restriction endonuclease yields two gene fragments capable of hybridizing with the 5' and 3' probes, respectively. The expected length of the corresponding allele fragment obtained after digestion in wild-type mice is 9.16 kb. In mice with successful LoxP insertion, the lengths of the two allele fragments are 4.48 kb (including the sequence complementary to the 5' probe) and 4.77 kb (including the sequence complementary to the 3' probe), respectively.

[0115] Among them, the sequence of the 5' probe is: 5'-CCAATTAGCCAGATAGCAGGTGGGGAAGAGCTTAAGTGGTGATTGGCCTTACCTTGACAAGTGCCGCCTACTGGGACAGCCCTATTTTTCCACTATTCCTAACCGTAATCCTGGACGGTGAACTGTCTCCTCTGTACCTAAGTCCACGCAGGACTGAGGGATAACAGGCTGGAACCG AGCCAGATCCAGAAAACTGGTAAAGGCCCCTGAATTGAATAGGTACTAGACGTGGGCGGGGGAGTGCGGGGTGGGGGGAGTGATTTGTGAGGTCGAGAAATGGAAGCCAGATGGGGTTGGGAATGGGACAGTGCTGGATAGAGAAAAACATGAGACTGGTGAGTGCCAGAGACCCTGTAAGAGCAAGGTTTGGA-3'(SEQ ID NO.21);

[0116] The sequence of the 3' probe is: 5'-TTCTGGTCTTCGCAGCTTCAATCCTCAGTAAGAAGGCCGTGGAGGGACTGTCCACTCTGGTGGTAGATGTTAAGTTTGGGGGAGCTGCAGTCTTCCCAGACCAGGAGAAGGCCCGAGAACTGGCAAAGATGTTGG TGAGCCGTGCTAGGCCACAGTGCCCTTTCTATGAAGGGACATGAGCCTCACATTCCGTCCTATCCCTGCCTCTGCCCACTCAACAGTCCTGGAAGAATAAAACGGCAATTCCTCTTTCCAGCCCTCCTACCCTATCCAAT-3'(SEQ ID NO.22);

[0117] The primer sequences used to amplify the 5' and 3' probes are as follows (F6 / R6 is used to amplify the 5' probe, and F7 / R7 is used to amplify the 3' probe):

[0118] F6: 5'-CCAATTAGCCAGATAGCAGGTGGG-3' (SEQ ID NO. 13);

[0119] R6: 5'-TCCAAACCTTGCTCTTACAGGGTCTC-3' (SEQ ID NO. 14);

[0120] F7: 5'-TTCTGGTCTTCGCAGCTTCAATCCT-3' (SEQ ID NO. 15);

[0121] R7: 5'-ATTGGATAGGGTAGGAGGCTGGAAA-3' (SEQ ID NO. 16).

[0122] Probe labeling was performed using a PCR DIG probe labeling kit (Roche), and the system is as follows:

[0123]

[0124]

[0125] When the forward primer is F6, the reverse primer is R6; when the forward primer is F7, the reverse primer is R7.

[0126] The amplification program was as follows: 95℃ for 3 min; 95℃ for 30 s, 60℃ for 35 s, 72℃ for 30 s, 35 cycles; 72℃ for 5 min.

[0127] PCR identification results as follows Figure 4 As shown (A: DNA marker; B: P1 / R1 amplification results of F1 generation mouse genome; C: P2 / R2 amplification results of F1 generation mouse genome; M is marker, WT is wild type).

[0128] Depend on Figure 4 It can be seen that both F1 / R1 and F2 / R2 amplified the genomes of mice 62, 63, 64, 65, 66 and 68, obtaining gene fragments of approximately 3.3kb in size.

[0129] Figure 5 The sequencing results for mouse number 62 show that the sequencing results are correct.

[0130] The sequencing results of mice 63, 64, 65, 66 and 68 were the same as those of mouse 62.

[0131] To further determine whether the targeted gene was correct, Southern blot analysis was performed on the genomic DNA of mice 62, 63, 64, and 68.

[0132] Southern blot analysis results are as follows: Figure 6 As shown (A: Southern blot results of F1 generation mouse genome using 5' probe; B: Southern blot results of F1 generation mouse genome using 3' probe).

[0133] Depend on Figure 6The Southern blot results for mice 62, 63, 64, and 68 all showed bands of approximately 4.48 kb and 4.77 kb in size, indicating that the LoxP site was successfully and correctly inserted into the genomes of mice 62, 63, 64, and 68.

[0134] Therefore, mice 62, 63, 64 and 68 are F1 generation positive mice.

[0135] (3) Breeding of F2 generation mice:

[0136] The F1 generation positive mice were selected and self-crossed to obtain F2 generation homozygous mice with conditional TYMP gene knockout that can be stably inherited. Identification was performed using the same method as described in the previous examples for the F1 generation mice.

[0137] (3) Obtaining megakaryocyte-specific TYMP gene knockout mice:

[0138] F2 generation homozygous mice identified as positive were mated with PF4-Cre mice. Cre recombinase recognized the LoxP site in the F2 generation mouse genome and performed recombination cleavage to obtain F3 generation megakaryocyte conditionally knocked-out TYMP gene heterozygous mice. The mouse genomes were amplified using the F3 / R3, F4 / R4, and F5 / R5 methods described in the above examples to verify the insertion of the LoxP site.

[0139] Specifically, for the gene fragment length obtained by amplifying the mouse genome via F3 / R3, the length was 445 bp in Cre-inactive mice, while no band was observed in mice with successful TYMP gene knockout. For the gene fragment length obtained by amplifying the mouse genome via F4 / R4, the length was 167 bp in wild-type mice, 201 bp in Cre-inactive mice, while no band was observed in mice with successful TYMP gene knockout. For the gene fragment length obtained by amplifying the mouse genome via F5 / R5, the length was 258 bp in wild-type mice, 325 bp in Cre-inactive mice, while no band was observed in mice with successful TYMP gene knockout.

[0140] In addition, Cre transgene activity was detected using primers F8 / R8, the specific sequences of which are as follows:

[0141] F8: 5'-GAACGCACTGATTTCGACCA-3' (SEQ ID NO. 17);

[0142] R8: 5'-GCTAACCAGCGTTTTTCGTTC-3' (SEQ ID NO. 18);

[0143] The Cre gene fragment obtained by F8 / R8 amplification is 204 bp in length.

[0144] The PCR reaction system and amplification procedure for F8 / R8 are the same as those for F4 / R4 in the above examples.

[0145] The F3 generation megakaryocyte conditionally knocked-out TYMP gene heterozygous mice that were identified as positive were self-crossed, and the F4 generation megakaryocyte conditionally knocked-out TYMP gene homozygous mice were obtained by screening according to the screening method of the F3 generation mice.

[0146] The embodiments of the present invention have been described in detail above with reference to the accompanying drawings. However, the present invention is not limited to the above embodiments, and various changes can be made within the scope of knowledge possessed by those skilled in the art without departing from the spirit of the present invention. Furthermore, the embodiments of the present invention and the features thereof can be combined with each other unless otherwise specified.

[0147] sequence list

[0148] <110> Zhujiang Hospital of Southern Medical University

[0149] Southern Medical University

[0150] <120> Construction and application of a mouse model with conditional knockout of the TYMP gene in megakaryocytes.

[0151] <160> twenty two

[0152] <170> SIPOSequenceListing 1.0

[0153] <210> 1

[0154] <211> 20

[0155] <212> DNA

[0156] <213> Artificial Sequence

[0157] <400> 1

[0158] actggagcaa tggcagctcc 20

[0159] <210> 2

[0160] <211> 20

[0161] <212> DNA

[0162] <213> Artificial Sequence

[0163] <400> 2

[0164] ctttgatcgg gatcgttact 20

[0165] <210> 3

[0166] <211> twenty three

[0167] <212> DNA

[0168] <213> Artificial Sequence

[0169] <400> 3

[0170] gtaacttacc ccaccccagt tct 23

[0171] <210> 4

[0172] <211> 20

[0173] <212> DNA

[0174] <213> Artificial Sequence

[0175] <400> 4

[0176] gtggattcgg accagtctga 20

[0177] <210> 5

[0178] <211> twenty three

[0179] <212> DNA

[0180] <213> Artificial Sequence

[0181] <400> 5

[0182] ttacagactg gagcaataac ttc 23

[0183] <210> 6

[0184] <211> twenty three

[0185] <212> DNA

[0186] <213> Artificial Sequence

[0187] <400> 6

[0188] ctgagcgcag ggccgtctag gtg 23

[0189] <210> 7

[0190] <211> twenty four

[0191] <212> DNA

[0192] <213> Artificial Sequence

[0193] <400> 7

[0194] gatttgtgag gtcgagaaat ggaa 24

[0195] <210> 8

[0196] <211> twenty three

[0197] <212> DNA

[0198] <213> Artificial Sequence

[0199] <400> 8

[0200] tcattaactt ctagggacgg acc 23

[0201] <210> 9

[0202] <211> twenty four

[0203] <212> DNA

[0204] <213> Artificial Sequence

[0205] <400> 9

[0206] agtggtgtct caatatccct taca 24

[0207] <210> 10

[0208] <211> 25

[0209] <212> DNA

[0210] <213> Artificial Sequence

[0211] <400> 10

[0212] gcacgaagtt tctgatatct gcttc 25

[0213] <210> 11

[0214] <211> twenty three

[0215] <212> DNA

[0216] <213> Artificial Sequence

[0217] <400> 11

[0218] atctgggttg agggagtcac tgg 23

[0219] <210> 12

[0220] <211> twenty three

[0221] <212> DNA

[0222] <213> Artificial Sequence

[0223] <400> 12

[0224] gagtcagtat ggttctgatg gct 23

[0225] <210> 13

[0226] <211> twenty four

[0227] <212> DNA

[0228] <213> Artificial Sequence

[0229] <400> 13

[0230] ccaattagcc agatagcagg tggg 24

[0231] <210> 14

[0232] <211> 26

[0233] <212> DNA

[0234] <213> Artificial Sequence

[0235] <400> 14

[0236] tccaaacctt gctcttacag ggtctc 26

[0237] <210> 15

[0238] <211> 25

[0239] <212> DNA

[0240] <213> Artificial Sequence

[0241] <400> 15

[0242] ttctggtctt cgcagcttca atcct 25

[0243] <210> 16

[0244] <211> 26

[0245] <212> DNA

[0246] <213> Artificial Sequence

[0247] <400> 16

[0248] attggatagg gtaggagggc tggaaa 26

[0249] <210> 17

[0250] <211> 20

[0251] <212> DNA

[0252] <213> Artificial Sequence

[0253] <400> 17

[0254] gaacgcactg atttcgacca 20

[0255] <210> 18

[0256] <211> 20

[0257] <212> DNA

[0258] <213> Artificial Sequence

[0259] <400> 18

[0260] gctaaccagc gttttcgttc 20

[0261] <210> 19

[0262] <211> 4888

[0263] <212> DNA

[0264] <213> Artificial Sequence

[0265] <400> 19

[0266] cccataggca ggtactaccc agaacgcgcg agaaatgtga cgtaccccag cgctcctcgg 60

[0267] cataccatcg ctccccgaaa ctggggcatc ctcgcaaagc aagaaacccc aggtgaggcc 120

[0268] tcaagggctg gatccagcac tagggacctt cctatacccc aacccgcagt ctgccgtaaa 180

[0269] ggcaaggaga ttggaccatt ggacctcttg ctgactcctc cttaggccct gggtcctaca 240

[0270] ccgtgccttc gctcttgggc tcacgagtca taagcaaagt ctcagcccca acttactcca 300

[0271] tctacagccg cagccctgtg ggcagctgct tcgaggacct cagcaaggtg gggaagggtc 360

[0272] tgcccgctgc atatgcagtc cctagtagtc aagagagtct gtgacgttgg gggtggtgca 420

[0273] gaactccagg cacctcacca ctcaggaaac tgaggcagga gttcaaagcc ggcctggggt 480

[0274] acatagtgag atttagctt gaggaaaaaaaaaaaaaaaaaaaat cagctca caggaacag 540

[0275] aggctgtacc cagcacccat cctgtcctcc ttagacccca ggcctgtg cctaccacgt 600

[0276] agtgaatcct atgatctaca agactcgagc cccgcagttc acgatgctgg ggaggactct 660

[0277] gccaccccga gagaacacca agaagccagg acctgcatcc tacagcgtgg acaaggtggt 720

[0278] ctggagtcga gggtcaaggg gcaggggatg agggactgag gtctaggca tggtcaag 780

[0279] tccccaggga aatggcatcc ctgtatgaag ccgaacagct ggctcggtaa ggtcagccctc 840

[0280] gtctccccga cccgcagcac cggaagcctt gtggctggag cttcgggatc agacactcag 900

[0281] actacctagc cccatgata cagtaccacg tggacgactg atgcctgcaa gcacgcgcgc 960

[0282] acaggctctg gttgtttac ttaagcttt ctaagtcagt gctgtgtgtc tctctttctt 1020

[0283] tctccgaagc gggcaggag gggtggggga gggaggacg aggtgagttc gagcattgat 1080

[0284] tgtctcagtg gtatctgaac ctagagatct gtcgcttgcc tagagatctg tcgcacagga 1140

[0285] caagcagtgc tcgggaccca tagataccaa gaccccaggg aactgggcag agcgaactcc 1200

[0286] ggtccggagc gctgtaaccc gacccttaaa ggtcctggca atgccaatta gccagatagc 1260

[0287] aggtggggaa gagcttaagt ggtgattggc cttaccttga caagtgccgc ctactgggac 1320

[0288] agccctattt ttccactatt cctaaccgta atcctggacg gtgaactgtc tcctctgtac 1380

[0289] ctaagtccac gcaggactga gggataacag gctgggaaccg agccagatcc agaaaactgg 1440

[0290] taaaggcccc tgaattgaat aggtactaga cgtgggcggg ggagtgcggg gtggggggag 1500

[0291] tgatttgtga ggtcgagaaa tggaagccag atggggttgg gaatgggaca gtgctggata 1560

[0292] gagaaaaaca tgagactggt gagtgccaga gaccctgtaa gagcaaggtt tggacaagtg 1620

[0293] accatggatt caaagacctg gatggggtgg aggtggggag ttccagtggt gtctcaatat 1680

[0294] cccttacaga ctggagcaat aacttcgtat agcatacatt atacgaagtt atatggcagc 1740

[0295] tccagggaca ccacctccct cggcctcagg gggaggaggt ggggagccca ggcagctgcc 1800

[0296] tgagctgatc cgcctgaagc gagatggagg gcatctgaga gaagcagata tcagaaactt 1860

[0297] cgtgcacgcg gtgatagatg gaagagcaca ggacacacaa attggtgtgt ggtaactaga 1920

[0298] ccccaacacc ccttccagct gccccatacg cacctcaggg atccacagta ccccaccacc 1980

[0299] atcacggccc cagaaaactc agactgcgtg aacacctcgc tcattgtatc catacttagg 2040

[0300] ggccatgcta atggccattc ggctgcaggg aatgaaccta gaagagacat ctgtgctgac 2100

[0301] tcgggccctt gcagagtctg ggcagcaact ggagtggccc aaagcctggc accagcagct 2160

[0302] tgttgacaaa cactccacag gaggtgtggg tgacaaggtt agcctggttc tggcacctgc 2220

[0303] cctggctgca tgcggctgta aggttagtga ccacgtcctc tacagacctc tgacccgctc 2280

[0304] acaggaacct ccaaccctcc agcctggctc aaagctctca aagacaaaat ccagggcagt 2340

[0305] cccatcgctc aatacacaaa ttccaccatg gagtagagtt gcctctgtac ccaagaggac 2400

[0306] cctttaagag ctagcaggcc ccacaaagaa agagcggggc cttcctcttc ctgtccttca 2460

[0307] gacttgggcc ccagatgagt gtgtgccaac tcctgaccta ctgacaaact gctcccacca 2520

[0308] agtacagttt atcttccttt ccaccaattg ggcaccctca ttaactgttt aaaagactct 2580

[0309] aaaatagccg ggcgtggtgg cgcacgcctt taatcctagc acttgggagg cagaggcagg 2640

[0310] cggatttctg agttctaggc cagcctggtc tacaaagtga gttccaggac agccagacct 2700

[0311] acacagagaa accctgtctc gaaaaaccaa aaaaaaaaaa aaaaaaaaaa aaaaagactc 2760

[0312] taaaatataa ctgctttttt aaaagtaatt tcatatgagg ataggatagg ttcttagtag 2820

[0313] aggataggta aaatgaggtt aagggcctgc gtgggggcag tcagcatccc tctccaccag 2880

[0314] gtgccaatga tcagcggccg cagtctggga cacacagggg gcacactgga tagctgga

[0315] tcgattcctg ggttcggtgt cacccagagc ccagagcagg tacaggtggg ccactaactg

[0316] atcaatgatc tgggttgagg gagtcactgg cccgaatcac aggatgatca atggacaggt

[0317] 3120. snow snow snow snow snow snow snow snow snow

[0318] ataggcctgg agtcatcgag agaactttga tcgggatcgt ataacttcgt atagcataca

[0319] ttatacgaag ttatgtcaga ctggtccgaa tccacagtac tgaattctac ttgggaacag

[0320] ggagaagcca ctgattagct ggtacgcatt aatgtgtctg tcataactaa tcgggatcct

[0321] tggtaggtta gccatcagaa ccatactgac tctcgctggc catgttttga acttctgttg

[0322] 3420. ggtcagtggt cagggccagt gggtgggtcc gtccctagaa gttaatgaag gtgtctgagc

[0323] agatgctgca catccttgag gaagtcggct gctgcattgt cggccagagt gcaaagctgg

[0324] ttcctgctga tgggatcctg tatgctgcac gagatgtgac agccactgtg gacagtgtcc 3540

[0325] cactcattac aggtgacctg aaacggggta ccctgactga cagacagtcc gctaggcact 3600

[0326] gccgcttttc tcagagaggc aactcttcct gtgcccaagt ataccctggg atgatgtttc 3660

[0327] tggtcttcgc agcttcaatc ctcagtaaga aggccgtgga gggactgtcc actctggtgg 3720

[0328] tagatgttaa gtttggggga gctgcagtct tcccagacca ggagaaggcc cgagaactgg 3780

[0329] caaagatgtt ggtgagccgt gctaggccac agtgcccttt ctatgaaggg acatgagcct 3840

[0330] cacattccgt cctatccctg cctctgccca ctcaacagtc ctggaagaat aaaacggcaa 3900

[0331] ttcctctttc cagccctcct accctatcca atcaaagctg tcctgactgc ggacctgggg 3960

[0332] aaatcctcca cagaaccccc gccacttagg gcaaccaacc agaacacccc catcccctct 4020

[0333] gaggcctggc agtgttggtt tctgatctct aacctaagcc tttactgaca ccttaaccca 4080

[0334] gggacagcag gtatgggatt tgataatgcc ggatactgaa taatgcctcc ccaggttaga 4140

[0335] gtgggagtga gcctggggct gaaggtcgcc gcagccctga ccgccatgga taaccctctg 4200

[0336] ggccgcagcg tgggccatac cctggaggtg gaagaagcgt tgctttgcct ggatggtgcg 4260

[0337] gggccgccgg atctgcggga cctggtcatt aggctaggtg agagggctgg agttaagacc 4320

[0338] accagtttgt atgccaggag ctctcaatcc ctgcagcttc tgagctccac cccgcccgcc 4380

[0339] agcaggaggc gccattcttt ggattagcgg acaggcggaa acacaagacc aaggcgccgc 4440

[0340] ccgagtggcc gcggcgttgg atgacggctc cgcgcggcgc cgcttccagc tgatgctttc 4500

[0341] ggcgcagggc gtggaccccg gcctagctaa agcattgtgc tccgggagcc ccacgcaacg 4560

[0342] ccggcagctg ctgcctcacg cccgagagca agaggagctg ctcgcaccgg cagacggtga 4620

[0343] gaccggatat caacggcacc agatcccacc cacttcctct cccgatcttt cctggtcctg 4680

[0344] gcacgtgcct ccagtaggtt ctcagtgtcc accctctccc ttaggcattg ttgagtgcgt 4740

[0345] ccgagcgctg ccgctggccc gtgtgctgca cgacctcgga gccggacgca gccgagcggg 4800

[0346] gcagccgatc agaccgggag tgggtgccga ggtactggtc gacgtgggcc agtgtttgtc 4860

[0347] ccgaggtaag cgctgtctgg aatccata 4888

[0348] <210> 20

[0349] <211> 1428

[0350] <212> DNA

[0351] <213> Artificial Sequence

[0352] <400> 20

[0353] atggcagctc cagggacacc acctccctcg gcctcagggg gaggaggtgg ggagcccagg 60

[0354] cagctgcctg agctgatccg cctgaagcga gatggagggc atctgagaga agcagatatc 120

[0355] agaaacttcg tgcacgcggt gatagatgga agagcacagg acacacaaat tggtgtgtgg 180

[0356] taactagacc ccaacacccc ttccagctgc cccatacgca cctcagggat ccacagtacc 240

[0357] ccaccaccat cacggcccca gaaaactcag actgcgtgaa cacctcgctc attgtatcca 300

[0358] tacttagggg ccatgctaat ggccattcgg ctgcagggaa tgaacctaga agagacatct 360

[0359] gtgctgactc gggcccttgc agagtctggg cagcaactgg agtggcccaa agcctggcac 420

[0360] cagcagcttg ttgaaaca ctccacagga ggtgtgggtg acaaggttag cctggttctg 480

[0361] gcacctgccc tggctgcatg cggctgtaag gttagtgacc acgtcctcta cagacctctg 540

[0362] acccgctcac aggaacctcc aaccctccag cctggctcaa agctctcaaa gacaaaatcc 600

[0363] agggcagtcc catcgctcaa tacacaaatt ccaccatgga gtagagttgc ctctgtaccc 660

[0364] aagaggaccc tttaagagct agcaggcccc acaaagaaag agcggggcct tcctctcttcct 720

[0365] gtccttcaga cttgggcccc agatgagtgt gtgccaactc ctgacctact gacaaactgc 780

[0366] tcccaccaag tacagtttat cttcctttcc accaattggg caccctcatt aactgtttaa 840

[0367] aagactctaa aatagccggg cgtggtggcg cacgccttta atcctagcac ttgggaggca 900

[0368] gaggcaggcg gatttctgag ttctaggcca gcctggtcta caaagtgagt tccaggacag 960

[0369] ccagacctac acagagaaac cctgtctcga aaaaccaaaa aaaaaaaaaa aaaaaaaaaa 1020

[0370] aaagactcta aaatataact gcttttttaa aagtaatttc atatgaggat aggataggtt 1080

[0371] cttagtagag gataggtaaa atgaggttaa gggcctgcgt gggggcagtc agcatccctc 1140

[0372] tccaccaggt gccaatgatc agcggccgca gtctgggaca cacagggggc acactggata 1200

[0373] agctggaatc gattcctggg ttcggtgtca cccagagccc agagcaggta caggtgggcc 1260

[0374] actaactgat caatgatctg ggttgaggga gtcactggcc cgaatcacag gatgatcaat 1320

[0375] ggacaggtta tttatctggg tcactaatga gagagaacat tgactattca aaaggtcatt 1380

[0376] ggttgtaaat aggcctggag tcatcgagag aactttgatc gggatcgt 1428

[0377] <210> 21

[0378] <211> 371

[0379] <212> DNA

[0380] <213> Artificial Sequence

[0381] <400> 21

[0382] ccaattagcc agatagcagg tggggaagag cttaagtggt gattggcctt accttgacaa 60

[0383] gtgccgccta ctgggacagc cctatttttc cactattcct aaccgtaatc ctggacggtg 120

[0384] aactgtctcc tctgtaccta agtccacgca ggactgaggg ataacaggct ggaaccgagc 180

[0385] cagatccaga aaactggtaa aggcccctga attgaatagg tactagacgt gggcggggga 240

[0386] gtgcggggtg gggggagtga tttgtgaggt cgagaaatgg aagccagatg gggttgggaa 300

[0387] tgggacagtg ctggatagag aaaaacatga gactggtgag tgccagagac cctgtaagag 360

[0388] caaggtttgg a 371

[0389] <210> 22

[0390] <211> 275

[0391] <212> DNA

[0392] <213> Artificial Sequence

[0393] <400> 22

[0394] ttctggtctt cgcagcttca atcctcagta agaaggccgt ggagggactg tccactctgg 60

[0395] tggtagatgt taagtttggg ggagctgcag tcttcccaga ccaggagaag gcccgagaac 120

[0396] tggcaaagat gttggtgagc cgtgctaggc cacagtgccc tttctatgaa gggacatgag 180

[0397] cctcacattc cgtcctatcc ctgcctctgc ccactcaaca gtcctggaag aataaaacgg 240

[0398] caattcctct ttccagccct cctaccctat ccaat 275

Claims

1. A method for constructing a mouse model of conditional knockout of the TYMP gene in megakaryocytes, characterized in that, Includes the following steps: S1: Design and transcribe gRNA in vitro, and simultaneously modify the TYMP gene with flox to construct Donor DNA; S2: After injecting gRNA, Donor DNA and Cas9 protein into mouse zygotes, the zygotes were implanted into the uterus of pseudopregnant mice. The F0 generation mice were then mated with wild-type mice to obtain F1 generation heterozygous mice with conditional knockout of the TYMP gene. S3: Then, the F1 generation heterozygous mice with conditional knockout of the TYMP gene were mated to obtain the F2 generation homozygous mice with conditional knockout of the TYMP gene. S4: Then, the F2 generation homozygous mice with conditional knockout of the TYMP gene were mated with PF4-Cre mice that specifically expressed Cre in megakaryocytes to obtain F3 generation heterozygous mice with conditional knockout of the TYMP gene in megakaryocytes. S5: Then, F3 generation megakaryocyte conditionally knocked-out TYMP gene mice were crossbred to obtain F4 generation megakaryocyte conditionally knocked-out TYMP gene homozygous mice.

2. The construction method according to claim 1, characterized in that, In step S1, the flux modification of the TYMP gene specifically involves inserting LoxP sequences at both ends of the TYMP gene sequence.

3. The construction method according to claim 2, characterized in that, In step S1, the flux modification of the TYMP gene specifically involves inserting LoxP sequences at both ends of exons 2-4 of the TYMP gene.

4. The construction method according to claim 3, characterized in that, In step S1, the gRNA includes gRNA1 and gRNA2; wherein the sequence of gRNA1 is shown in SEQ ID NO.1 and the sequence of gRNA2 is shown in SEQ ID NO.

2.

5. The construction method according to claim 3, characterized in that, In step S1, the nucleotide sequence of the Donor DNA is shown in SEQ ID NO.

19.

6. The construction method according to claim 1, characterized in that, The screening method for the mice includes PCR, and the primers used include: F1 / R1, F2 / R2, F3 / R3, F4 / R4 and F5 / R5; The F1 sequence is shown in SEQ ID NO.3; the R1 sequence is shown in SEQ ID NO.4; the F2 sequence is shown in SEQ ID NO.5; the R2 sequence is shown in SEQ ID NO.6; the F3 sequence is shown in SEQ ID NO.7; the R3 sequence is shown in SEQ ID NO.8; the F4 sequence is shown in SEQ ID NO.9; the R4 sequence is shown in SEQ ID NO.10; the F5 sequence is shown in SEQ ID NO.11; and the R5 sequence is shown in SEQ ID NO.

12.

7. The construction method according to claim 1, characterized in that, The screening method for the mice included Southernblot, using probes including 5' and 3' probes; The sequence of the 5' probe is shown in SEQ ID NO.21; The sequence of the 3' probe is shown in SEQ ID NO.

22.

8. The application of a CRISPR / Cas9 system in constructing a mouse model of conditional knockout of the TYMP gene in megakaryocytes, characterized in that, The system comprises Cas9 protein, gRNA1 with the sequence shown in SEQ ID NO.1, gRNA2 with the sequence shown in SEQ ID NO.2, and Donor DNA with the sequence shown in SEQ ID NO.

19.

9. The application of the megakaryocyte conditional knockout TYMP gene mouse model constructed according to any one of claims 1-7 in screening drugs related to inhibiting platelet activation.

10. The application of the megakaryocyte conditional knockout TYMP gene mouse model constructed according to any one of claims 1-7 in the study of the molecular mechanisms of thrombosis and inflammation-related diseases.