A gene StZFP2 for inducing resistance to potato black mole and its application

Abstract

The invention provides a potato induced disease resistance gene StZFP2, which is a zinc finger protein gene, which is induced by sodium silicate and belongs to the field of genetic engineering technology. In potato seedlings to which sodium silicate is applied, the zinc finger protein gene StZFP2 is significantly upregulated, the gene is cloned and transferred into potato virus-free tissue culture seedlings, and the potato black mole pathogen (Rhizcotonia solani) is inoculated, the disease resistance of the plant overexpressing the zinc finger protein gene StZFP2 is significantly enhanced, and the ability to remove active oxygen is also better than that of wild-type potatoes, indicating that the zinc finger protein gene StZFP2 provided by the invention can improve the resistance of potatoes to black mole pathogens.

Description

Technical Field

[0001] The invention belongs to the technical field of gene engineering, and in particular relates to a gene capable of improving the ability of potato to resist black mole disease and remove active oxygen, and an application thereof. Background Art

[0002] Potato (Solanum tuberosum L.) is the world's fourth largest food crop, and is loved by people for its extremely high nutritional value and anti-aging functions. Potatoes are widely planted because of their drought resistance, barrenness resistance and high water use efficiency. However, the increasingly severe soil-borne diseases seriously threaten the development of the potato industry, especially potato black mole disease caused by Rhizoctonia sp. infection, which has an adverse effect on the economic benefits and edible value of potatoes and has become one of the main soil-borne diseases in China's potato production. At present, the prevention and control measures for potato black mole disease mainly include biological control, chemical control and agricultural control methods. There is little difference in resistance between varieties, there are few disease-resistant resources, and there are no disease-resistant varieties that can be used.

[0003] Silicon, as the second largest element in the earth's crust, can not only promote plant growth but also increase the broad-spectrum resistance of plants. Studies have shown that silicon can participate in the interaction between plants and pathogens and induce the expression of disease-resistant genes. However, there are no reports on silicon-induced resistance to potato black mole.

[0004] Zinc-finger protein (ZFP) is an important type of transcription factor. It can be divided into subtypes such as C2H2, C3H, and C3HC4 according to the number and order of cysteine ​​and histidine. Among them, C2H2 is also called classical zinc-finger protein, which generally contains a unique and conservative QALGGH sequence. The expression of zinc-finger protein genes increases the resistance of bell pepper plants to Pseudomonas syringae. Silencing zinc-finger protein genes reduces the resistance of pepper plants to Ralstonia solanacearum. Studies on potatoes have found that the expression of zinc-finger protein genes increases the resistance of plants to Phytophthora infestans. There are no reports on this gene in the study of resistance to potato black spot disease. This project has been previously studied by sodium silicate (NaSiO 3 9H 2 O) induced potato tissue culture seedlings, obtained transcriptome by high-throughput sequencing, and screened out genes with significant up-regulation differences in transcriptome data, zinc finger protein gene StZFP2, which was transferred into potatoes. Overexpression of the gene can improve resistance to black mole pathogens. Therefore, it is intended to explore potato black mole resistance genes through sodium silicate induction, explore the mechanism of sodium silicate induction resistance, and provide a theoretical basis for its application. Summary of the invention

[0005] The invention discloses a gene capable of improving potato black mole disease resistance and removing active oxygen and application thereof.

[0006] In order to achieve the above object, the present invention adopts the following technical solution:

[0007] A potato induced disease resistance gene StZFP2, which is a zinc finger protein gene, induced by sodium silicate, and the nucleotide sequence of the gene is shown in SEQ ID NO.1;

[0008]

[0009]

[0010] The use of the potato induced disease resistance gene StZFP2 as described above in potato resistance to black mole disease;

[0011] Preferably, the expression of the potato inducible disease resistance gene StZFP2 is induced by sodium silicate;

[0012] The potato inducible disease resistance gene StZFP2 as described above, the amino acid sequence of the protein encoded by the gene is shown in SEQ ID NO.2;

[0013]

[0014] A biomaterial, which is at least one of the following (1) to (3);

[0015] (1) an expression cassette containing the nucleic acid molecule of the zinc finger protein gene StZFP2;

[0016] (2) a recombinant vector containing the nucleic acid molecule of the expression cassette described in (1);

[0017] (3) a recombinant microorganism containing the nucleic acid molecule of the expression cassette described in (1) or a recombinant microorganism containing the recombinant vector described in (2);

[0018] The biological material as described above, in (1), the expression cassette comprises a zinc finger protein gene StZFP2 nucleic acid molecule and a marker element;

[0019] Preferably, the marking element is an optical marking element;

[0020] More preferably, the optical labeling element is GFP;

[0021] The biological material as described above, in (2), the recombinant vector containing the nucleic acid molecule of the expression cassette of (1) is pCAMBIA1302-StZFP2;

[0022] Preferably, the recombinant expression vector is pCAMBIA1302-35S-StZFP2;

[0023] In the biological material as described above, in (3), the recombinant microorganism containing the nucleic acid molecule of the expression cassette of (1) or the recombinant microorganism containing the recombinant vector of (2) is one or more of a cloning strain, a shuttle strain and an engineered strain;

[0024] Preferably, the cloning strain is DH5α;

[0025] Preferably, the shuttle strain is Agrobacterium;

[0026] A cloning device for zinc finger protein gene StZFP2, comprising amplification primers:

[0027] T-StZFP2-F: 5'-ATGAGTGCCTTAAAAAGAAGCAGAG-3';

[0028] T-StZFP2-R: 5'-AATAAAAATTCTCCAAACAGGAGAT-3';

[0029] Preferably, it also includes one or more of the essential elements of polymerase chain reaction;

[0030] Preferably, the essential elements of the polymerase chain reaction are dNTP, reaction buffer, DNA polymerase or Mg 2+ One or more of;

[0031] The reaction conditions of the cloning device as described above were as follows: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 30 s, annealing at 55°C for 1 min, extension at 72°C for 30 s, 35 cycles, and finally running at 72°C for 10 min;

[0032] Use of the above-mentioned genes, applications, proteins, biological materials, cloning devices and methods in improving the ability of potatoes to remove active oxygen and resist black mole disease;

[0033] Preferably, the black mole disease is potato black mole disease;

[0034] Preferably, the application as described above comprises the following steps:

[0035] Transforming the zinc finger protein gene StZFP2 overexpression vector into Atlantic potato;

[0036] Preferably, the expression of the zinc finger protein gene StZFP2 is induced by sodium silicate.

[0037] In summary, the present invention provides a potato induced disease resistance gene StZFP2, which is a zinc finger protein gene, and the gene is induced by sodium silicate. In potato seedlings to which sodium silicate is applied, the zinc finger protein gene StZFP2 is significantly upregulated in expression. The gene is cloned and transferred into potato tissue culture seedlings, and the potato black mole pathogen (Rhizcotonia solani) is inoculated. The disease resistance of the plant overexpressing the zinc finger protein gene StZFP2 is significantly enhanced, and the ability to remove active oxygen is also better than that of wild-type potatoes, indicating that the zinc finger protein gene StZFP2 provided by the present invention can improve the resistance of potato to black mole pathogens. BRIEF DESCRIPTION OF THE DRAWINGS

[0038] Figure 1 The gene StZFP2 of the present invention is expressed in the potato Atlantic tissue;

[0039] Figure 2 This is the cloning result of the gene StZFP2 of the present invention;

[0040] Figure 3 The expression vector pCAMBIA1302 used in the present invention is identified by single enzyme digestion;

[0041] Figure 4 It is the positive bacterial solution identification of the gene StZFP2 of the present invention;

[0042] Figure 5 This is the screening test of transgenic StZFP2-positive potato of the present invention; A: potato callus tissue, B: potato adventitious bud tissue, C: transgenic StZFP2-positive potato DNA detection, D: transgenic StZFP2-positive potato RNA detection;

[0043] Figure 6 This is an experiment of inoculating transgenic StZFP2 potatoes with Rhizoctonia solani of the present invention; A: pictures of wild-type potatoes and transgenic potatoes without inoculation; B: growth comparison of wild-type potatoes and transgenic potatoes; C: disease index and incidence rate after inoculation; D: pictures after inoculation;

[0044] Figure 7 This is a test of the anti-active oxygen capacity of the transgenic StZFP2 potato of the present invention; A: POD enzyme, B: SOD enzyme, C: APX enzyme, D: CAT enzyme. DETAILED DESCRIPTION

[0045] The technical solutions in the embodiments of the present invention are described clearly and completely below. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0046] Example 1 Screening of Potato Zinc Finger Protein Gene StZFP2

[0047] After culturing potato black spot pathogen on PSA medium for 5 days, a bacterial cake with a diameter of 10 mm was punched out from the edge of the colony with a cork puncher and inoculated into the center of the PSA plate. After culturing at (25±1)℃ for 7 days, 100 mL of sterile water was added to each culture dish, and the cultured pathogen and the culture medium were poured into a tissue grinder and ground into a concentration of 1×10 7 Mycelium segments / cm 3 Mycelial suspension. After culturing the Atlantic potato virus-free tissue culture seedlings on MS solid medium at a temperature of (25±1)℃ and 16h of light per day for 17-18 days, select the healthy and uniform potato virus-free tissue culture seedlings and transplant them into pots filled with sterile vermiculite after hardening. Water once every 7 days with 500mL of MS nutrient solution each time. Apply sodium silicate (NaSiO 3 9H 2 O), i.e. pouring NaSiO 3 9H 2 O (concentration is 3.02 kg / m 3 ) 500 mL of MS nutrient solution, and at the same time, inoculate the mycelial suspension of potato black mole pathogen to about 3 cm below the base of the aboveground stem of the potato seedlings, and inoculate 3 cm per plant 3 The same method was used to inoculate the bacteria without sodium silicate as the control and cultured in a natural environment. Potato seedlings were randomly selected at 4d, 8d and 12d after inoculation, and transcriptome data were obtained by high-throughput sequencing. The transcriptome data were analyzed and the significantly upregulated zinc finger protein gene StZFP2 was selected. After QPCR verification, subsequent experiments were carried out.

[0048] Example 2 Analysis of the expression level of the potato zinc finger protein gene StZFP2 in different tissues of potato Atlantic

[0049] The experimental materials were potato variety Atlantic virus-free tissue culture seedlings, which were stored in the Plant Pathology Laboratory of Inner Mongolia Agricultural University. The roots, stems and leaves of potato Atlantic were selected to extract total RNA. The Plant RNA Extraction Kit of Baoriyi Biotechnology (Beijing) Co., Ltd. was used for RNA extraction. After RNA extraction, 1% agarose gel electrophoresis was used for integrity detection, and Nanodrop was used to detect RNA concentration and purity. PrimeScript II 1ststrand cDNA synthesis Kit of TaKaRa was used for reverse transcription into cDNA. ABI Quantstudio of Thermo Fisher Scientific (China) Co., Ltd. was used. TMDX quantitative PCR instrument was used for fluorescence quantitative detection, and SYRB Premix Ex Taq (Tli RNaseH Plus) reagent kit of Bio-Rad Biotechnology (Beijing) Co., Ltd. was selected for quantification. The quantitative primers were:

[0050] Q-StZFP2-F:CTTCCCGTCTTTCCAAGCCTTAGG;

[0051] Q-StZFP2-R:TGACCCAAAGAAAACTCCACACCAC.

[0052] Potato EF1α was used as the internal reference gene and primers were designed:

[0053] EF1αF: CAAGGATGACCCAGCCAAG;

[0054] EF1αR:TTCCTTACCTGAACGCCTGT.

[0055] The gene expression levels were calculated using the 2-ΔΔCT method.

[0056] like Figure 1 As shown, the fluorescence quantitative results showed that the gene StZFP2 was expressed at the highest level in the leaves of potato Atlantic, followed by the stems, and the lowest level in the roots.

[0057] Example 3 Construction of potato zinc finger protein gene StZFP2 and expression vector

[0058] RNA was extracted using the Plant RNA Extraction Kit from Bio-Technology (Beijing) Co., Ltd. The cDNA was reverse transcribed using the PrimeScript II 1st strand cDNA synthesis Kit from TaKaRa. The polymerase chain reaction was performed using a 9700 PCR instrument from Thermo Fisher Scientific, and the amplification was performed using the Easy Taq DNA Polymerase Kit from TaKaRa. The amplification primers were:

[0059] T-StZFP2-F: 5'-ATGAGTGCCTTAAAAAGAAGCAGAG-3';

[0060] T-StZFP2-R: 5'-AATAAAAATTCTCAAAACAGGAGAT-3'.

[0061] The reaction conditions were as follows: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 30 s, annealing at 55°C for 1 min, extension at 72°C for 30 s, 35 cycles, and finally running at 72°C for 10 min. PCR products were detected by 1% agarose gel electrophoresis.

[0062] Cut the gel under UV light, use Tiangen agarose gel (DNA) purification kit to recover, and use Nanodr op to detect its concentration and purity. After completion, take 4μL of the above DNA solution, add 1μL pMD19-T vector and 5μL Solution (containing ligase) to mix, and react at 16℃ for 30min. After the reaction is completed, add 100μL DH5α competent cells to the above solution, ice bath for 30min, heat at 42℃ for 45s, and then place on ice for 2min. Add 900μL SOC medium to the transformed competent cells, culture at 37℃ for 90min, apply to LB medium containing ampicillin (Amp) and invert overnight culture. After culture, select single colonies for culture and use bacterial liquid PCR to verify whether the target fragment is successfully inserted. The target band can be amplified by bacterial liquid PCR for double-end sequencing, sequencing primers StZFP2-F and StZFP2-R to verify whether the cloning is successful.

[0063] The potato gene StZFP2 fragment has a full length of 498 bp, and its sequence is shown in SEQ ID NO.1. The encoded protein contains 165 amino acids, and its sequence is shown in SEQ ID NO.2.

[0064] The results showed that the potato zinc finger protein gene StZFP2 was successfully linked to the cloning vector pMD19-T (Figure 2).

[0065] Example 4 Transfer to potatoes and functional verification

[0066] 1 Overexpression vector construction

[0067] Target gene amplification: According to the map of the vector pCAMBIA1302-35S, NacoⅠ was designed as the insertion site and primers were synthesized. The primer sequences were:

[0068] StZFP2-F:5'-agctcggtacccgggATGAGTGCCTTAAAAAGAAGCAGAG-3';

[0069] StZFP2-R:5'-aggtcgactctagagTCAAATAAAAATTCTCAAAACAGGA-3'

[0070] PCR reaction procedure: 94℃ pre-denaturation for 5min; 94℃ denaturation for 30s, 55℃ annealing for 30s, 70℃ extension for 1min, 35 cycles; 72℃ extension for 10min. PCR products were electrophoresed on 1% agarose gel at 100V for 30min. The electrophoresis results were recorded by photography and observed under ultraviolet light. The target band was quickly cut out. The DNA was recovered using Tiangen agarose gel (DNA) purification kit.

[0071] The pCAMBIA 1302 expression vector was digested with the restriction endonuclease NacoI from TaKaRa, and the integrity of the digested product was detected by 1.0% agarose gel electrophoresis ( Figure 3 ). The DNA was recovered using Tiangen agarose gel purification kit.

[0072] Reaction system (10 μL):

[0073]

[0074] Reaction procedure: 30°C for 3h.

[0075] Establishing In-Fusion Reaction System

[0076] Reaction system (10 μL):

[0077]

[0078]

[0079] Reaction procedure: 50℃ for 30min. Please refer to the enclosed instruction manual for specific operation.

[0080] Pick a single colony into 2 mL LB (Amp) liquid medium and culture at 37°C, 180 rpm for 12 hours. Perform PCR on the bacterial solution, and the fragment size is about 498 bp ( Figure 4 ).

[0081] The plasmid was extracted from the bacteria using the Plasmid Extraction Kit (PD103-2) from Tiangen Biochemical Technology (Beijing) Co., Ltd. For specific operations, refer to the attached instructions.

[0082] 2 Potato transformation

[0083] 1) Agrobacterium transformation

[0084] Take out the Agrobacterium GV3101 from the -80℃ freezer and place it on ice to dissolve for 30 minutes. Add 10μL of recombinant plasmid DNA, flick to mix, and let it stand on ice for 10 minutes. Place it in liquid nitrogen for 5 minutes. Quickly place it in a 37℃ metal bath for 5 minutes, and then quickly place it on ice for 1 minute. Add 500μL LB culture medium and culture it at 28℃, 180rpm for 2 hours. Centrifuge it at 4000rpm for 5 minutes. Keep 100μL of supernatant, suspend the precipitate, spread it on LB (Kan) culture medium, and culture it at 28℃ overnight. Pick a single white colony into 1mL LB (Kan) liquid culture medium and culture it at 28℃, 180rpm overnight.

[0085] Take 1 mL of the shaken bacterial solution and inoculate it into 50 mL of LB (Kan+Rif) liquid culture medium, and culture it at 28°C and 180 r / min for 5 to 6 hours. When the OD 600nm value is about 0.5, the next step of the experiment can be carried out.

[0086] The bacterial solution was transferred to a 50 mL centrifuge tube, centrifuged at 6000 r / min for 15 min, the supernatant was discarded, and MS liquid culture medium was added in a ratio of 1:1 to the centrifuge tube for resuspending to obtain Agrobacterium transformation solution for use.

[0087] 2) Pre-culture of stem segments and leaves

[0088] From the Atlantic virus-free test tube seedlings of potato cultured for 28 days, cut the stem segments without axillary buds of 0.5 cm to 1 cm in length aseptically, and cut off some leaf tips to keep the strong leaves with petioles. Transfer the stem segments and leaves into the prepared MS medium respectively. Place 20 stem segments and 15 leaves in each culture dish. The experiment was repeated 3 times, the culture temperature was 23℃ to 25℃, and the pre-culture was 2 days.

[0089] 3) Infection and co-cultivation of explants with Agrobacterium strains

[0090] Transfer all the prepared bacterial solution containing the target gene to a sterile 250mL Erlenmeyer flask, put in the pre-cultured potato stem segments and leaves, and try to cover the explants with the bacterial solution. The infection time is 5 minutes. During the soaking process, gently shake the flask clockwise to make it evenly contacted. Then pour out the MS culture medium, use sterile filter paper to absorb the excess bacterial solution, place it on the solid MS culture medium, seal it with a sealing film, and culture it at 28°C for 2 days.

[0091] 4) Regeneration and screening of transformed plants

[0092] The explants were taken out after 2 days of co-cultivation, washed three times with sterile water, each time for 9 minutes, and the excess water was absorbed with sterile filter paper. The explants were placed in callus medium supplemented with 50 mg / mL genta and 50 mg / mL Tim for culture at 25°C for 14 days.

[0093] The explants that generated callus tissue were transferred to an adventitious bud differentiation medium supplemented with 50 mg / mL genta and 50 mg / mL Tim for further cultivation, and the bud differentiation and contamination of the medium were observed.

[0094] When the explants grow new buds of about 1 cm to 2 cm, cut them off and transfer them to a rooting medium containing 50 mg / mL genta and 50 mg / mL Tim. Observe the growth of the buds. If there is contamination, transfer the medium in time. Culture for about 1 to 2 weeks. If the rooting is successful, it is preliminarily identified as the gene overexpression transformed plant ( Figure 5 ).

[0095] 5) Screening of genetically modified potatoes

[0096] The total DNA of the proposed transgenic potato plants was extracted using the plant DNA extraction kit of Bio-Rad Biotechnology (Beijing) Co., Ltd., and specific primers were designed according to the GFP region of the expression vector pCAMBIA1302:

[0097] 1302-GFP-F:AGTAAAGGAGAAGAACTTTTCACTGGA;

[0098] 1302-GFP-R:TTTGTATAGTTCATCCATGCCATGTGT.

[0099] The proposed transgenic plants were verified by PCR using DNA as template and 1302-GFP-F and 1302-GFP-R as primers ( Figure 5 ).

[0100] Total RNA was extracted from the pseudo-transgenic plants and non-transgenic Atlantic plants obtained above using the Plant RNA Extraction Kit. The expression level of the gene StZFP2 in the pseudo-transgenic plants and the control Atlantic plants was quantitatively analyzed by real-time fluorescence ( Figure 5 ).

[0101] 6) Transgenic plants transferred to soil cultivation

[0102] The transgenic potato Atlantic virus-free tissue culture seedlings cultured in MS medium at 4000 lx and 25°C for 30 days were hardened and transplanted into pots (the pots were disinfected with 1 / 1000 potassium permanganate) filled with sterile vermiculite:sterile soil (volume ratio 1:1) and cultured in an incubator (12000 lx, 22-25°C, 60% humidity) for 15 days.

[0103] The potato black mole bacteria cultured at 28°C for 5 days were minced together with the culture medium using a tissue grinder, and then diluted to a mycelial suspension by adding 100 mL of distilled water to each culture dish. The detection bacterial count was 10 7 / mL mycelium segment. 3mL of pathogen inoculum was inoculated around the base of the underground stem. Samples were collected on the 0th, 4th, 8th, and 12th day after inoculation to investigate the disease and quantify the change trend of pathogens in the plants. The activity of plant antioxidant enzymes was measured to quantify the change trend of related disease resistance genes in the plants and the change in the number of pathogens.

[0104] like Figure 6 As shown, the results showed that the disease resistance of transgenic StZFP2 potatoes was significantly better than that of wild-type potatoes.

[0105] like Figure 7 As shown, the results showed that the activity of antioxidant enzymes in transgenic StZFP2 potatoes was significantly better than that in wild-type potatoes.

[0106] The various embodiments in this specification are described in a progressive manner, and each embodiment focuses on the differences from other embodiments. The same or similar parts between the various embodiments can be referenced to each other.

[0107] The above description of the disclosed embodiments enables one skilled in the art to implement or use the present invention. Various modifications to the above embodiments will be apparent to one skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the present invention. Therefore, the present invention will not be limited to the embodiments shown herein, but rather to the widest scope consistent with the principles and novel features disclosed herein. Sequence Listing <110> Inner Mongolia Agricultural University <120> A gene StZFP2 for inducing resistance to potato black mole and its application <160> 2 <170> SIPOSequenceListing 1.0 <210> 1 <211> 498 <212> DNA <213> Artificial Sequence <400> 1 atgagtgcct taaaaagaag cagaggagag gatgtgctag tggaagcaga ggccatggct 60 aactgcgcct taatgctttt gtctcgtttc aacaccaaca actcatcaga tcatcatcat 120 attaatgatt ttgaatgcaa gacttgcaat aaacgcttcc cgtctttcca agccttaggc 180 ggtcatcgtg caagtcataa taaaaagcca agattactcg gagagtttct tgttcaaacc 240 aacaaaaaga acaagatgca taaatgctct atttgtggtg tggagttttc tttgggtcaa 300 gccttaggag ggcacatgag gcgtcatcgc gatgaaatta ataaaacgtc gaggatgata 360 ccagtgttga cgaagtcgaa tagcagcaag aggatttttt gtttggactt aaatttaacc 420 cctcgtgatg ataatgttga tttcaagtta tggccaaccg caccaattgc atctcctgtt 480 ttgagaattt ttatttga 498 <210> 2 <211> 165 <212> PRT <213> Artificial Sequence <400> 2 Met Ser Ala Leu Lys Arg Ser Arg Gly Glu Asp Val Leu Val Glu Ala 1 5 10 15 Glu Ala Met Ala Asn Cys Ala Leu Met Leu Leu Ser Arg Phe Asn Thr 20 25 30 Asn Asn Ser Ser Asp His His His Ile Asn Asp Phe Glu Cys Lys Thr 35 40 45 Cys Asn Lys Arg Phe Pro Ser Phe Gln Ala Leu Gly Gly His Arg Ala 50 55 60 Ser His Asn Lys Lys Pro Arg Leu Leu Gly Glu Phe Leu Val Gln Thr 65 70 75 80 Asn Lys Lys Asn Lys Met His Lys Cys Ser Ile Cys Gly Val Glu Phe 85 90 95 Ser Leu Gly Gln Ala Leu Gly Gly His Met Arg Arg His Arg Asp Glu 100 105 110 Ile Asn Lys Thr Ser Arg Met Ile Pro Val Leu Thr Lys Ser Asn Ser 115 120 125 Ser Lys Arg Ile Phe Cys Leu Asp Leu Asn Leu Thr Pro Arg Asp Asp 130 135 140 Asn Val Asp Phe Lys Leu Trp Pro Thr Ala Pro Ile Ala Ser Pro Val 145 150 155 160 Leu Arg Ile Phe Ile 165

Claims

1. An application of overexpressing potato induced disease resistance gene StZFP2 in potato resistance to black mole disease; the expression of potato induced disease resistance gene StZFP2 is induced by sodium silicate; The nucleotide sequence of the potato inducible disease resistance gene StZFP2 is shown in SEQ ID NO.1; The potato induced disease resistance gene StZFP2 is a zinc finger protein gene StZFP2.

2. The use according to claim 1, characterized in that Improving the ability of potatoes to scavenge reactive oxygen species includes the following steps: The overexpression vector of the zinc finger protein gene StZFP2 is transferred into Atlantic potato.

Images