Microbial markers for predicting reproductive performance in male ruminants and their applications

Abstract

The present invention proposes a group of microbial markers, which include Ruminococcaceae and / or Saccharimonadaceae. The microbial marker group proposed by the present invention can be used to screen male ruminants with high fertility and prepare a kit for breeding dominant male ruminant varieties.

Description

Technical Field

[0001] The present invention belongs to the field of animal husbandry, and specifically, relates to microbial markers for predicting the reproductive performance of male ruminants and applications thereof, and more specifically, relates to the use of reagents in preparing a kit, the kit, a method for determining the reproductive performance of male ruminants, and a method for breeding male ruminants. Background Art

[0002] my country is a major producer and consumer of animal husbandry, and livestock products such as meat, milk, leather, and wool are important and indispensable resources in my country. In the breeding and selection of ruminants, some farmers or farms select high-quality breeding bulls by observing their body shape and appearance, pedigree selection, and offspring quality to determine their reproductive performance, without precise scientific data and testing indicators to support it.

[0003] At present, some farmers or farms allow breeding bulls to eat concentrated feed without restraint, resulting in overnutrition, excessive fat, and excessive fat deposition, leading to obesity. Obesity is a metabolic disorder that can induce a decrease in the body's reproductive performance.

[0004] Therefore, it is very necessary to develop a method that can accurately and quickly predict the reproductive performance of breeding bulls for efficient breeding. Summary of the invention

[0005] The present invention aims to solve one of the technical problems in the related art at least to a certain extent.

[0006] The present invention provides a method for predicting the reproductive performance of breeding bulls, especially breeding rams. Specifically, the reproductive performance of breeding bulls is comprehensively predicted by detecting relevant indicators in the blood and / or feces of breeding bulls.

[0007] In the first aspect of the present invention, the present invention proposes a group of microbial markers, characterized in that they include: flora of the Ruminococcaceae family and / or flora of the Saccharimonadaceae family. According to an embodiment of the present invention, the above-mentioned microorganisms found in the intestinal contents of male ruminants can effectively determine the reproductive performance of male ruminants, distinguish male ruminants with high reproductive performance and male ruminants with low reproductive performance, especially male ruminants with reduced reproductive performance due to over-fattenting, and can monitor the reproductive performance of male ruminants in real time during animal breeding and fattening, which is beneficial for breeders to find a balance between animal fattening and breeding, guide feeding methods and feed dosage, and at the same time help breeders select high-quality breeding bulls.

[0008] In addition, the biomarkers according to the above embodiments of the present invention may also have the following additional technical features:

[0009] According to an embodiment of the present invention, the flora of the Ruminococcaceae family includes flora selected from the genus Ruminococcus_2 and the genus Ruminococcaceae_NK4A214_group. The inventors have found through extensive research that not only the flora of the Ruminococcaceae and / or Saccharimonadaceae families can be used as microbial markers for predicting the reproductive performance of male ruminants, but also the flora of the genus Ruminococcus_2 and the genus Ruminococcaceae_NK4A214_group of the Ruminococcaceae family flora can be used as microbial markers for determining the reproductive performance of male ruminants.

[0010] In the second aspect of the present invention, the present invention proposes the use of a reagent in the preparation of a kit, the kit is used to determine the reproductive performance of male ruminants, and the reagent is used to detect the microbial markers proposed in the first aspect of the present invention. According to an embodiment of the present invention, the reagent can detect the above-mentioned microbial markers and / or their expression abundance, and is simple to operate and low in cost. According to the expression abundance of Ruminococcaceae, Saccharimonadaceae, Ruminococcus_2 and / or Ruminococcaceae_NK4A214_group detected in the sample being tested, it is possible to distinguish between high-reproductive breeding stock and low-reproductive breeding stock.

[0011] In addition, according to the use of the above embodiment of the present invention, the following additional technical features may also be provided:

[0012] According to an embodiment of the present invention, the reagent is a primer or probe for specifically detecting the microbial marker. According to an embodiment of the present invention, the primer or probe may carry a chemical modification group, such as a fluorescent group, a biotin group, etc., to facilitate the detection and indication of the marker. The probe may be a DNA probe or an RNA probe, which specifically binds to the nucleic acid or protein of the microbial marker, or may be a protein probe, such as an antibody, etc., which binds the antibody to the specific protein of the biomarker to be detected through an immune reaction, and the biomarker is qualitatively or quantitatively detected by qualitative or quantitative detection of the specific protein, such as western blot, immunocoprecipitation, mass spectrometry, etc.

[0013] According to an embodiment of the present invention, the primers for specifically detecting the microbial marker have the following nucleotide sequences: upstream sequence of the first pair of primers: 5'-TAAACTCCTTTTATAAGGGACGAACTAA-3' (SEQ ID NO: 1), downstream sequence of the first pair of primers: 5'-GCCTCTACATCACTCAAGCTCGAT-3' (SEQ ID NO: 2);

[0014] According to an embodiment of the present invention, the primers for specifically detecting the microbial marker have the nucleotide sequences as follows: the upstream sequence of the second pair of primers: 5'-AACTCATAAACTGCATTTGAAACTGTACT-3' (SEQ ID NO: 3), the downstream sequence of the second pair of primers: 5'-AGCGTCAGTTGCTGTCCAGTAGAC-3' (SEQ ID NO: 4).

[0015] According to an embodiment of the present invention, the microbial markers can be qualitatively or quantitatively detected by using the first pair of primers or the second pair of primers for PCR or quantitative PCR, wherein the first pair of primers is used for the detection of Ruminococcus_2, and the second pair of primers is used for the detection of Ruminococcaceae_NK4A214_group. When the above primers are used for PCR detection, if the target band can be detected by gel electrophoresis, it is an indication that the animal to be tested has normal reproductive performance. If the target band cannot be detected, or the target band is weak or the expression level is low, the reproductive performance of the animal to be tested is low and it is not suitable to be kept as breeding stock, wherein the target band size is 100 to 250 bp, specifically, the target band size is 215 bp and 136 bp.

[0016] In a third aspect of the present invention, a kit is provided for determining the reproductive performance of male ruminants. According to an embodiment of the present invention, the kit contains reagents for detecting the microbial markers provided in the first aspect of the present invention. The kit can detect male ruminants simply and efficiently, and can monitor the reproductive capacity of male ruminants in real time during the breeding process of breeders, so as to adjust the feeding method, feed formula and guide the selection of breeding bulls.

[0017] In addition, the kit according to the above embodiment of the present invention may also have the following additional technical features:

[0018] According to an embodiment of the present invention, the reagent is a primer or probe for specifically detecting the microbial marker. According to an embodiment of the present invention, the primer or probe may carry a chemical modification group, such as a fluorescent group, a biotin group, etc., to facilitate the detection and indication of the marker. The probe may be a DNA probe or an RNA probe. In addition, the kit may also include reagents for detecting specific proteins, such as antibodies, etc., which bind the antibodies to the specific proteins of the biomarkers to be detected through immune reactions, and the biomarkers are qualitatively or quantitatively detected by qualitative or quantitative detection of the specific proteins, such as western blot, immunocoprecipitation, mass spectrometry, etc.

[0019] According to an embodiment of the present invention, the primers have the nucleotide sequences as follows: the upstream sequence of the first pair of primers: 5'-TAAACTCCTTTTATAAGGGACGAACTAA-3' (SEQ ID NO: 1), the downstream sequence of the first pair of primers: 5'-GCCTCTACATCACTCAAGCTCGAT-3' (SEQ ID NO: 2).

[0020] According to an embodiment of the present invention, the primers have the nucleotide sequences as follows: the upstream sequence of the second pair of primers: 5'-AACTCATAAACTGCATTTGAAACTGTACT-3' (SEQ ID NO: 3), the downstream sequence of the second pair of primers: 5'-AGCGTCAGTTGCTGTCCAGTAGAC-3' (SEQ ID NO: 4).

[0021] According to an embodiment of the present invention, the microbial markers can be qualitatively or quantitatively detected by using the first pair of primers or the second pair of primers for PCR or quantitative PCR, wherein the first pair of primers is used for the detection of Ruminococcus_2, and the second pair of primers is used for the detection of Ruminococcaceae_NK4A214_group. When the above primers are used for PCR detection, if the target band can be detected by gel electrophoresis, it is an indication that the animal to be tested has normal reproductive performance. If the target band cannot be detected, or the target band is weak or the expression level is low, the reproductive performance of the animal to be tested is low, wherein the target band size is 100 to 250 bp, specifically, the target band size is 215 bp and 136 bp.

[0022] In the fourth aspect of the present invention, the present invention proposes a method for determining the reproductive performance of male ruminants. According to an embodiment of the present invention, the method comprises: detecting the expression abundance of the flora Ruminococcaceae and / or Saccharimonadaceae in the first sample of the male ruminant, and determining the reproductive performance of the male ruminant based on the expression abundance of the flora Ruminococcaceae and / or Saccharimonadaceae in the detected male ruminant sample. The inventors found that the expression abundance of Ruminococcaceae and / or Saccharimonadaceae in the intestine of male ruminants with different reproductive performance is different. By using the above differences, male ruminants with different reproductive performance can be distinguished, and the reproductive health status of breeding bulls in the breeding process can be monitored in real time, and breeding bulls with poor reproductive status can be discovered in time, especially those whose reproductive health status has declined due to excessive consumption of fine feed.

[0023] In addition, the method according to the above embodiment of the present invention may also have the following additional technical features:

[0024] According to an embodiment of the present invention, the Ruminococcaceae family flora includes the Ruminococcus_2 genus flora and the Ruminococcaceae_NK4A214_group genus flora.

[0025] According to a specific embodiment of the present invention, the inventors, after careful experimental design and a large number of experiments, found that by using 16S-rDNA sequencing to analyze the first sample, the relative expression abundance of Ruminococcaceae, Saccharimonadaceae, Ruminococcus_2 and / or Ruminococcaceae_NK4A214_group can be accurately obtained, and the reproductive performance of male ruminants can be accurately and efficiently detected.

[0026] According to an embodiment of the present invention, the method further comprises: detecting the expression abundance of retinol and / or α-tocopherol in the first sample and / or the second sample of the male ruminant. After multiple experiments, the inventors found that the metabolites retinol and α-tocopherol in male ruminants are correlated with Ruminococcaceae, Saccharimonadaceae, Ruminococcus_2 and / or Ruminococcaceae_NK4A214_group in predicting their reproductive performance, and detecting metabolites and microbial markers simultaneously can improve accuracy.

[0027] According to an embodiment of the present invention, the flora Ruminococcaceae is negatively correlated with retinol, with a P value of 0.00024 and a correlation coefficient of -0.91; the flora Ruminococcaceae is positively correlated with α-tocopherol, with a P value of 0.0045 and a correlation coefficient of 0.84; the flora Saccharimonadaceae is negatively correlated with retinol, with a P value of 1.8E-05 and a correlation coefficient of -0.95; the flora Saccharimonadaceae is positively correlated with α-tocopherol, with a P value of 0.0068 and a correlation coefficient of 0.82.

[0028] According to a specific embodiment of the present invention, the bacterial community Ruminococcus_2 is negatively correlated with retinol, with a P value of 0.00031 and a correlation coefficient of -0.91; the bacterial community Ruminococcus_2 is positively correlated with α-tocopherol, with a P value of 0.0082 and a correlation coefficient of 0.81; the bacterial community Ruminococcaceae_NK4A214_group is negatively correlated with retinol, with a P value of 0.012 and a correlation coefficient of -0.75; the bacterial community Ruminococcaceae_NK4A214_group is positively correlated with α-tocopherol, with a P value of 0.0068 and a correlation coefficient of 0.82.

[0029] According to a specific embodiment of the present invention, after repeated experiments and demonstrations, the inventors found that the reduced abundance of the flora Ruminococcaceae, Saccharimonadaceae, Ruminococcus_2 and / or Ruminococcaceae_NK4A214_group leads to an imbalance in the intestinal microecology, thereby affecting the digestion and absorption of the metabolites retinol and α-tocopherol, and ultimately leading to a decrease in the abundance of the metabolites retinol and α-tocopherol in the blood transported to the target organ testicles, causing a decrease in the reproductive performance of the breeding rams.

[0030] According to an embodiment of the present invention, the first sample includes at least one selected from small intestine content, large intestine content and feces.

[0031] According to an embodiment of the present invention, the second sample comprises at least one selected from peripheral blood and testicular samples.

[0032] According to an embodiment of the present invention, the relative expression abundance of the Ruminococcaceae in the male ruminant sample is not less than 10%; and / or the relative expression abundance of Saccharimonadaceae is not less than 1%, which is an indication of high reproductive performance of the male ruminant. The inventors used 16S-rDNA sequencing to obtain the microbial diversity of the intestinal contents of male ruminants with low reproductive performance and high reproductive performance, and successively used cluster analysis, alpha diversity analysis (AlphaDiversity), beta diversity analysis (Beta Diversity) and significant species difference analysis to obtain the relative expression abundance of the Ruminococcaceae and the Saccharimonadaceae to determine the reproductive performance of male ruminants. The relative expression abundance of the Ruminococcaceae is less than 10%, which is predicted to be low reproductive performance, and the relative expression abundance of the Saccharimonadaceae is less than 1%, which is predicted to be low reproductive performance.

[0033] According to an embodiment of the present invention, the relative expression abundance of Ruminococcus_2 in the male ruminant sample is not less than 5%, 7%; and / or the relative expression abundance of Ruminococcaceae_NK4A214_group is not less than 0.5%, 1%, which is an indication of high reproductive performance of the male ruminant. The inventors used 16S-rDNA sequencing to obtain the microbial diversity of intestinal contents of male ruminants with low and high reproductive performance, and used cluster analysis, alpha diversity analysis (Alpha Diversity), beta diversity analysis (Beta Diversity) and significant species difference analysis to obtain the relative expression abundance of the flora Ruminococcus_2 and the flora Ruminococcaceae_NK4A214_group, which can determine the reproductive performance of male ruminants. If the relative expression abundance of the flora Ruminococcus_2 is lower than 5% and 7%, it is predicted to have low reproductive performance, and if the relative expression abundance of the flora Ruminococcaceae_NK4A214_group is lower than 0.5% and 1%, it is predicted to have low reproductive performance.

[0034] According to an embodiment of the present invention, the relative expression abundance of retinol in the first sample is not higher than 0.01%, which is an indication of high reproductive performance of the male ruminant. According to the method of an embodiment of the present invention, the relative expression abundance of retinol in at least one of the small intestine contents, large intestine contents and feces samples is not higher than 0.01%, which is an indication of high reproductive performance of the male ruminant.

[0035] According to an embodiment of the present invention, the relative expression abundance of α-tocopherol in the first sample is not less than 0.002% and 0.0025%, which is an indication of high reproductive performance of the male ruminant. According to the method of an embodiment of the present invention, the relative expression abundance of α-tocopherol in at least one of the small intestine contents, large intestine contents and feces samples is not less than 0.002% and 0.0025%, which is an indication of high reproductive performance of the male ruminant.

[0036] According to an embodiment of the present invention, the expression abundance of retinol in the second sample is not less than 100 μg / g, which indicates that the male ruminant has high reproductive performance. The expression abundance of retinol in the testis is not less than 100 μg / g, which indicates that the male ruminant has high reproductive performance.

[0037] According to an embodiment of the present invention, the expression abundance of the α-tocopherol in the second sample is not less than 15 μg / g, which is an indication of high reproductive performance of the male ruminant. The expression abundance of the α-tocopherol in the testis is not less than 15 μg / g, 16 μg / g, 17 μg / g, 18 μg / g, 19 μg / g, and 20 μg / g, which is an indication of high reproductive performance of the male ruminant.

[0038] According to a specific embodiment of the present invention, the inventors used an ultra-high resolution liquid chromatography combined with a time-of-flight mass spectrometry instrument platform (UHPLC-QTOF-MS) to complete non-targeted metabolomics data collection for metabolites of male ruminants, screened the mass spectral peaks of differential metabolites of high reproductive performance metabolites and low reproductive performance metabolites by performing R language analysis on the sequencing data, determined the types of potential differential metabolites by searching and analyzing the METLIN data and the HMDB database, and finally screened out differential metabolites by using PCA, OPLS-DA, and KEGG analysis. If the relative expression abundance of retinol is higher than 0.01%, it is predicted to be low reproductive performance, and if the relative expression abundance of α-tocopherol is lower than 0.002% and 0.0025%, it is predicted to be low reproductive performance.

[0039] According to an embodiment of the present invention, detecting the relative expression abundance of Ruminococcaceae, Saccharimonadaceae, Ruminococcus_2 and / or Ruminococcaceae_NK4A214_group in the first sample of the male ruminant and / or detecting the relative expression abundance of retinol and / or α-tocopherol in the second sample of the male ruminant is achieved by at least one of the following methods: 16S-rDNA sequencing, high-throughput sequencing, mass spectrometry detection, enzyme-linked immunosorbent assay, RT-PCR, quantitative PCR and gene chip.

[0040] According to an embodiment of the present invention, the male ruminant is a ram. According to the method of the embodiment of the present invention, the feed formula and feeding method of the ruminant are similar, and the intestinal contents and metabolites are also similar or close. The male ruminant includes but is not limited to rams, bulls, etc., and there is no particular limitation on the breed of sheep or cattle. The inventors have verified a variety of male ruminants, all of which are suitable for the above method.

[0041] In the fifth aspect of the present invention, the present invention proposes a method for selecting and breeding male ruminants, characterized in that it includes: 1. providing a plurality of candidate male ruminants; 2. determining the reproductive performance of the candidate male ruminants according to the method proposed in the fourth aspect of the present invention; 3. determining the target male ruminant based on the result of step 2. The method according to the embodiment of the present invention can accurately select male ruminants with normal reproductive performance, which is conducive to scientific breeding.

[0042] In the sixth aspect of the present invention, the present invention proposes a male ruminant breeding system. According to an embodiment of the present invention, the system comprises: a candidate male ruminant acquisition device, the candidate male ruminant acquisition device is used to provide a plurality of male ruminant candidate individuals; a trait determination device, the trait determination device is connected to the candidate male ruminant acquisition device, the trait determination device determines the reproductive performance of the male ruminant according to the method described above; and a cultivation device, the cultivation device is connected to the trait prediction device. According to an embodiment of the present invention, the male ruminant is a ram. According to the system of the embodiment of the present invention, the device can realize accurate detection of the reproductive performance of male ruminants, and can also perform non-invasive detection of the reproductive performance of male ruminants. It only needs to collect peripheral blood, excrement, etc. of the animal to be detected, and the reproductive performance of the animal to be detected can be accurately judged, thereby realizing the distinction and screening of high-fertility and low-fertility animals. The system can be connected to an automated control system to realize automated processing and analysis, liberate labor, and improve detection efficiency. BRIEF DESCRIPTION OF THE DRAWINGS

[0043] The above and / or additional aspects and advantages of the present invention will become apparent and easily understood from the description of the embodiments in conjunction with the following drawings, in which:

[0044] Figure 1 It is a tissue morphology detection of the reproductive performance of the breeding ram according to an embodiment of the present invention;

[0045] Figure 2 is the relative expression abundance of the differential metabolite retinol according to an embodiment of the present invention;

[0046] Figure 3 is the relative expression abundance of the differential metabolite α-tocopherol according to an embodiment of the present invention;

[0047] Figure 4 is a testis-targeted validation of the differential metabolite retinol according to an embodiment of the present invention;

[0048] Figure 5 It is the testis-targeted validation of the differential metabolite α-tocopherol according to an embodiment of the present invention;

[0049] Figure 6 is the relative expression abundance of the differential bacterial community Ruminococcus_2 according to an embodiment of the present invention;

[0050] Figure 7 is the relative expression abundance of the differential bacterial group Ruminococcaceae_NK4A214_group according to an embodiment of the present invention;

[0051] Figure 8 is a correlation analysis between Ruminococcus_2 and retinol according to an embodiment of the present invention;

[0052] Fig. 9 is a correlation analysis between Ruminococcus_2 and α-tocopherol according to an embodiment of the present invention;

[0053] Fig.10 is a correlation analysis between Ruminococcaceae_NK4A214_group and retinol according to an embodiment of the present invention;

[0054] Fig.11 is a correlation analysis between Ruminococcaceae_NK4A214_group and α-tocopherol according to an embodiment of the present invention;

[0055] Fig.12 is the RT-PCR detection of Ruminococcus_2 according to an embodiment of the present invention;

[0056] Fig.13 is the RT-PCR detection of Ruminococcaceae_NK4A214_group according to an embodiment of the present invention;

[0057] Fig.14 is the relative expression abundance of the differential bacterial community Ruminococcaceae according to an embodiment of the present invention;

[0058] Fig.15 is the relative expression abundance of the differential bacterial community Saccharimonadaceae according to an embodiment of the present invention;

[0059] Fig.16 is a correlation analysis between Ruminococcaceae and retinol according to an embodiment of the present invention;

[0060] Fig.17 is a correlation analysis between Ruminococcaceae and α-tocopherol according to an embodiment of the present invention;

[0061] Fig.18 is a correlation analysis between Saccharimonadaceae and retinol according to an embodiment of the present invention;

[0062] Fig.19 is a correlation analysis between Saccharimonadaceae and α-tocopherol according to an embodiment of the present invention;

[0063] Fig. 20 is a schematic diagram of a method for breeding male ruminants according to an embodiment of the present invention;

[0064] Fig.21 Schematic diagram of a male ruminant breeding system according to an embodiment of the present invention. DETAILED DESCRIPTION

[0065] Embodiments of the present invention are described in detail below, and examples of the embodiments are shown in the accompanying drawings. The embodiments described below with reference to the accompanying drawings are exemplary and intended to be used to explain the present invention, but should not be understood as limiting the present invention.

[0066] In addition, the terms "first" and "second" are used for descriptive purposes only and should not be understood as indicating or implying relative importance or implicitly indicating the number of the indicated technical features. Therefore, the features defined as "first" and "second" may explicitly or implicitly include at least one of the features. In the description of the present invention, the meaning of "plurality" is at least two, such as two, three, etc., unless otherwise clearly and specifically defined.

[0067] In the specification and claims of the present invention, when nucleic acids are mentioned, those skilled in the art should understand that they actually include any one or both of the complementary double strands. For convenience, in the specification and claims, although only one strand is given in most cases, the other strand complementary thereto is actually disclosed. For example, when SEQ ID NO: 1 is mentioned, its complementary sequence is actually included, and those skilled in the art can also understand that one strand can be used to detect the other strand, and vice versa.

[0068] In the specification and claims of the present invention, references to "high fertility, normal fertility" or "high reproductive performance, normal reproductive performance" all refer to animals with better fertility or higher reproductive performance relative to "low fertility, low reproductive performance". Male animals with better fertility or higher reproductive performance can be bred as breeding male animals, while male animals with low fertility and low reproductive performance are not suitable to be kept as breeding male animals, or it is indicated that they need to improve their fertility before they are suitable as breeding male animals.

[0069] Male ruminant breeding method and system

[0070] In one aspect of the present invention, the present invention provides a method for breeding male ruminants. Fig. 20 , the method comprising:

[0071] S100, providing a plurality of candidate male ruminants; S200, determining the reproductive performance of the candidate male ruminants according to the aforementioned method; S300, determining a target male ruminant based on the result of step S200.

[0072] In another aspect of the present invention, the present invention provides a male ruminant breeding system. Fig.21 The system comprises: a candidate male ruminant acquisition device 100, which is used to provide a plurality of male ruminant candidate individuals; a trait determination device 200, which is connected to the candidate male ruminant acquisition device, and which determines the reproductive performance of the male ruminant according to the method described in the aforementioned method; and a breeding device 300, which is connected to the trait prediction device.

[0073] The present invention is described below with reference to specific embodiments. It should be noted that these embodiments are merely illustrative and do not limit the present invention in any way.

[0074] Example 1

[0075] Experimental animals: To simulate the high-energy diet level of breeding rams during breeding, 2-month-old weaned Mongolian lambs with similar body weight were randomly divided into two groups, a normal feeding group (20 heads) and a high-energy feeding group (20 heads). The lambs were raised for 6 months to reach sexual maturity.

[0076] Experimental methods:

[0077] 1. Use tissue morphology to detect the reproductive performance of breeding rams.

[0078] The first step is to take the testicles and epididymis tissues of the ram, put them in the fixative, and fix them at 4°C overnight. Wash the fixed tissues 3 times with 1×PBS and then wash them once with 70% alcohol. Put the tissues in a fixative box for gradient alcohol dehydration, and place them on a shaker during the period to ensure that the tissues are completely dehydrated. Let xylene penetrate into the tissues through tissue transparency, and then dip in wax for tissue embedding. The second step is to cut the paraffin blocks into 5μm slices, stick them on slides and bake them overnight. The third step is to perform HE morphological staining of paraffin sections. First, dewax and rehydrate the sections; then stain with hematoxylin, differentiate in 1% hydrochloric acid alcohol for 3 to 5s after staining, stop with tap water to return to blue, and stain with eosin; finally, perform gradient alcohol dehydration and xylene transparency, seal the sections, and take pictures.

[0079] Results: The spermatogenesis process of the normal feeding group was the same, the sperm density in the epididymis was high and the morphology was good, which was the normal reproductive performance group; the spermatogenesis process of the high-energy feeding group was abnormal, multinucleated giant cells appeared in the testicular spermatogenic epithelium, the arrangement of spermatogenic cells was disordered, the number of spermatogenic cells in the testis was significantly reduced, the spermatogenic epithelium became thinner, the sperm density in the epididymis was low and the sperm was fragmented, which was the low reproductive performance group. Figure 1 shown.

[0080] 2. Comparative analysis of differential metabolites in small intestine contents and testicles.

[0081] With the help of an ultra-high resolution liquid chromatography-time-of-flight mass spectrometry (UHPLC-QTOF-MS) instrument platform, data collection for non-targeted metabolomics was completed. The Linux operating system and R language were used to perform quality control and upstream and downstream analysis of the samples, and the mass spectral peaks of differential metabolites between the low reproductive performance group and the normal reproductive performance group were screened out. The potential metabolite types corresponding to the characteristic molecular weight were predicted by searching the METLIN database and the HMDB database. The ropls package was used for PCA, OPLS-DA and other analyses, and clusterProfiler was used to perform enrichment analysis on the KEGG annotation results of the differential metabolites, thereby screening out the differential metabolites.

[0082] Results: By comparing the small intestinal contents of the low reproductive performance group and the normal reproductive performance group through non-targeted metabolite analysis, metabolites (retinol and α-tocopherol) with important biological significance and significant differences were detected and screened. Figure 2 , 3As shown in the figure, compared with the normal reproductive performance group, the retinol expression abundance in the low reproductive performance group increased significantly, while the α-tocopherol expression abundance decreased significantly. The range of values ​​for predicting low reproductive performance based on the relative expression abundance of retinol is higher than 0.01%, that is, if the relative expression abundance of retinol is higher than 0.01%, it is predicted to be low reproductive performance; the range of values ​​for predicting low reproductive performance based on the relative expression abundance of α-tocopherol is lower than 0.002%, that is, if the relative expression abundance of α-tocopherol is lower than 0.002%, it is predicted to be low reproductive performance. Please refer to the attached Figure 2 , 3 .

[0083] The differential metabolites retinol and α-tocopherol in the metabolome data were validated for target metabolism in testicular tissue. The mass spectrometry analysis of targeted metabolites was performed using a 5500QTRAP mass spectrometer. Using standards as references, specific metabolites retinol and α-tocopherol in the testis were specifically detected and analyzed. It was found that compared with the normal reproductive performance group, the expression abundance of retinol in the low reproductive performance group was significantly reduced, and the expression abundance of α-tocopherol was significantly reduced. The range of values ​​for predicting low reproductive performance based on the expression abundance of retinol is less than 100μg / g, that is, if the expression abundance of retinol is less than 100μg / g, it is predicted to be low reproductive performance; the range of values ​​for predicting low reproductive performance based on the expression abundance of α-tocopherol is less than 15μg / g, that is, if the relative expression abundance of α-tocopherol is less than 15μg / g, it is predicted to be low reproductive performance. Figure 4 and attached Figure 5 shown.

[0084] The target metabolism of retinol, a differential metabolite in the metabolome data, was verified in peripheral blood. ELISA detection showed that the expression abundance of retinol in the low reproductive performance group was significantly lower than that in the normal reproductive performance group.

[0085] 3. 16S-rDNA sequencing was used to analyze the microbial diversity of small intestinal contents in the low reproductive performance group and the normal reproductive performance group.

[0086] The small intestinal contents of the low reproductive performance group and the normal reproductive performance group were sampled and 16S-rDNA sequencing was performed. The original sequencing sequences were filtered and spliced ​​to obtain optimized tags. The optimized tags were clustered and divided into OTUs. The species classification was obtained according to the sequence composition of the OTUs. Based on the OTU analysis results, the samples were analyzed at various classification levels. Then, the Ace, Chao1, Shannon and Simpson indexes of the low reproductive performance group and the normal reproductive performance group at the 97% similarity level were studied by Alpha diversity analysis, and the rarefaction curve and grade abundance curve were drawn; the difference in species diversity between the control group and the experimental group was compared by Beta diversity analysis. Heatmap, PCA, PCoA, UPGMA tree and NMDS analysis at the corresponding distance were obtained according to the distance matrix. Finally, the biomolecules with statistical differences were found through the inter-group difference significance analysis, and the gene function prediction and calculation of the abundance of functional genes were performed through 16S functional gene prediction analysis. Finally, the differential bacterial community was screened out.

[0087] Results: The microbial diversity of the small intestine contents of the low reproductive performance group and the normal reproductive performance group was analyzed by 16S-rDNA sequencing, and the OTUs (Operational Taxonomic Units) with a similarity level of 97% were clustered and analyzed. Species annotation and abundance analysis were performed to reveal the composition of microbial species among the groups. Alpha diversity analysis (AlphaDiversity), beta diversity analysis (Beta Diversity) and significant species difference analysis were further performed to explore the differences in microbial species between the groups, and to clarify that the intestinal flora homeostasis of the low reproductive performance breeding sheep was imbalanced and the flora (Ruminococcus_2, Ruminococcaceae_NK4A214_group) had undergone significant changes. As shown in the attached Figure 6 , 7 As shown, compared with the normal reproductive performance group, the relative expression abundance of the flora Ruminococcus_2 and Ruminococcaceae_NK4A214_group in the low reproductive performance group was significantly reduced. The value range of the relative expression abundance of the flora Ruminococcus_2 predicting low reproductive performance is less than 5%, that is, the relative expression abundance of the flora Ruminococcus_2 is less than 5%, which is predicted to be low reproductive performance; the value range of the relative expression abundance of the flora Ruminococcaceae_NK4A214_group predicting low reproductive performance is less than 0.5%, that is, the relative expression abundance of the flora Ruminococcaceae_NK4A214_group is less than 0.5%, which is predicted to be low reproductive performance.

[0088] 4. Integrated cross-analysis of metabolomics data and 16S-rDNA data.

[0089] Metabolome data and 16S-rDNA data were integrated and cross-analyzed, and Spearman correlation analysis was established to clarify the correlation between metabolites (retinol and α-tocopherol) and bacterial communities (Ruminococcus_2, Ruminococcaceae_NK4A214_group) that affect reproductive performance. Figures 8 to 11 As shown, the bacterial community Ruminococcus_2 was negatively correlated with retinol, with a P value of 0.00031 and a correlation coefficient of -0.91; the bacterial community Ruminococcus_2 was positively correlated with α-tocopherol, with a P value of 0.0082 and a correlation coefficient of 0.81; the bacterial community Ruminococcaceae_NK4A214_group was negatively correlated with retinol, with a P value of 0.012 and a correlation coefficient of -0.75; the bacterial community Ruminococcaceae_NK4A214_group was positively correlated with α-tocopherol, with a P value of 0.0068 and a correlation coefficient of 0.82.

[0090] The results showed that the decreased abundance of Ruminococcus_2 and Ruminococcaceae_NK4A214_group led to intestinal microecological imbalance, which in turn affected the digestion and absorption of metabolites retinol and α-tocopherol, ultimately leading to a decrease in the abundance of metabolites retinol and / or α-tocopherol in the blood transported to the target organ testicles, causing a decrease in the reproductive performance of breeding rams.

[0091] Example 2

[0092] The method in Example 1 was used to randomly test the reproductive performance of 11 sexually mature Mongolian sheep aged 8 months, and the relative expression abundance of Ruminococcus_2 and / or Ruminococcaceae_NK4A214_group in feces and small intestinal contents was detected by 16S-rDNA sequencing. The relative expression abundance of retinol and α-tocopherol in feces, small intestinal contents, and peripheral blood was detected by non-targeted mass spectrometry.

[0093] Results: Through 16s-rDNA sequencing of Mongolian sheep feces, it was found that the relative expression abundance of Ruminococcus_2 and / or Ruminococcaceae_NK4A214_group in 4 Mongolian sheep was low, and was less than 5% and 0.5%. Through the relative expression abundance detection of retinol and α-tocopherol in peripheral blood of Mongolian sheep, it was found that the relative expression abundance of retinol and α-tocopherol in the above 4 Mongolian sheep was low. Therefore, it was predicted that these 4 Mongolian sheep were rams with low reproductive performance, and the other 7 were rams with normal reproductive performance.

[0094] Histomorphological examination was performed on the testicles of rams with low reproductive performance and rams with normal reproductive performance detected by the above method. The results showed that the spermatogenesis process of rams with low reproductive performance was abnormal, multinucleated giant cells appeared in the testicular seminiferous epithelium, the arrangement of spermatogenic cells was disordered, the number of spermatogenic cells in the testis was significantly reduced, the seminiferous epithelium became thinner, the sperm density in the epididymis was low and the sperm was fragmented. The spermatogenesis process of rams with normal reproductive performance was normal, and the sperm density in the epididymis was high and the morphology was good.

[0095] This shows that the method of the present invention can accurately determine the reproductive performance of rams.

[0096] Example 3

[0097] Eleven rams with known reproductive performance were tested using primers, of which seven had normal reproductive performance and four had low reproductive performance.

[0098] Fecal DNA was extracted from the 11 rams, and Ruminococcus_2 primers Forward primer: TAAACTCCTTTTATAAGGGACGAACTAA (SEQ ID NO: 1), Reverse primer: GCCTCTACATCACTCAAGCTCGAT (SEQ ID NO: 2) were designed. PCR amplification was performed for 35 cycles, and the length of the amplified product fragment was 215 bp. The amount of template DNA in each amplified sample was consistent, and the reaction system and reaction conditions were consistent, as shown below:

[0099] PCR reaction system

[0100]

[0101] PCR reaction conditions

[0102]

[0103] Agarose gel electrophoresis showed that the positive bands were specific and accurate in size. Seven rams had positive bands of the target product (1, 2, 3, 4, 5, 7, 9), and four rams had weak bands (6, 8, 10, 11). Fig.12 .

[0104] Fecal DNA was extracted from the above 11 rams, and Ruminococcaceae_NK4A214_group primers Forward primer: AACTCATAAACTGCATTTGAAACTGTACT (SEQ ID NO: 3) and Reverse primer: AGCGTCAGTTGCTGTCCAGTAGAC (SEQ ID NO: 4) were designed. PCR amplification was performed for 35 cycles, and the length of the amplified product fragment was 136 bp. The amount of template DNA in each amplified sample was consistent, and the reaction system and reaction conditions were the same as described above, and the reaction system and conditions in each amplified sample were consistent. Agarose gel electrophoresis detection showed that the positive bands were specific and accurate in size, of which 7 rams had brighter positive bands (1, 2, 3, 4, 5, 7, 9), and 4 rams had no positive bands (6, 8, 10, 11), as shown in the attached Fig.13 .

[0105] In summary, the results showed that the reproductive performance of rams could be predicted using primers. Among the 11 rams tested, 4 were rams with low reproductive performance, and the remaining 7 were rams with normal reproductive performance.

[0106] Example 4

[0107] The experimental method is the same as that in Example 1 and will not be described again.

[0108] 16S-rDNA sequencing was used to analyze the microbial diversity of small intestinal contents in the low reproductive performance group and the normal reproductive performance group.

[0109] The small intestinal contents of the low reproductive performance group and the normal reproductive performance group were sampled and 16S-rDNA sequencing was performed. The original sequencing sequences were filtered and spliced ​​to obtain optimized tags. The optimized tags were clustered and divided into OTUs. The species classification was obtained according to the sequence composition of the OTUs. Based on the OTU analysis results, the samples were analyzed at various classification levels. Then, the Ace, Chao1, Shannon and Simpson indexes of the low reproductive performance group and the normal reproductive performance group at the 97% similarity level were studied by Alpha diversity analysis, and the rarefaction curve and grade abundance curve were drawn; the difference in species diversity between the control group and the experimental group was compared by Beta diversity analysis. Heatmap, PCA, PCoA, UPGMA tree and NMDS analysis at the corresponding distance were obtained according to the distance matrix. Finally, the biomolecules with statistical differences were found through the inter-group difference significance analysis, and the gene function prediction and calculation of the abundance of functional genes were performed through 16S functional gene prediction analysis. Finally, the differential bacterial community was screened out.

[0110] Results: The microbial diversity of the small intestine contents of the low reproductive performance group and the normal reproductive performance group was analyzed by 16S-rDNA sequencing, and the OTUs (Operational Taxonomic Units) with a similarity level of 97% were clustered and analyzed. Species annotation and abundance analysis were performed to reveal the composition of microbial species among the groups. Alpha diversity analysis (AlphaDiversity), beta diversity analysis (Beta Diversity) and significant species difference analysis were further performed to explore the differences in microbial species between the groups, and to clarify that the intestinal flora homeostasis of the low reproductive performance breeding sheep was imbalanced and the flora (Ruminococcaceae, Saccharimonadaceae) had changed significantly. As shown in the attached Fig.14 , 15 As shown, compared with the normal reproductive performance group, the relative expression abundance of the flora (Ruminococcaceae, Saccharimonadaceae) in the low reproductive performance group was significantly reduced. The value range of the relative expression abundance of the flora Ruminococcaceae predicting low reproductive performance is less than 10%, that is, the relative expression abundance of the flora Ruminococcaceae is less than 10%, which is predicted to be low reproductive performance; the value range of the relative expression abundance of the flora Saccharimonadaceae predicting low reproductive performance is less than 1%, that is, the relative expression abundance of the flora Saccharimonadaceae is less than 1%, which is predicted to be low reproductive performance.

[0111] Metabolome data and 16S-rDNA data were integrated and cross-analyzed.

[0112] Metabolome data and 16S-rDNA data were integrated and cross-analyzed, and Spearman correlation analysis was established to clarify the correlation between metabolites (retinol and α-tocopherol) and bacterial communities (Ruminococcaceae, Saccharimonadaceae) that affect reproductive performance. Figures 16 to 19 As shown, the Ruminococcaceae flora was negatively correlated with retinol, with a P value of 0.00024 and a correlation coefficient of -0.91; the Ruminococcaceae flora was positively correlated with α-tocopherol, with a P value of 0.0045 and a correlation coefficient of 0.84; the Saccharimonadaceae flora was negatively correlated with retinol, with a P value of 1.8E-05 and a correlation coefficient of -0.95; the Saccharimonadaceae flora was positively correlated with α-tocopherol, with a P value of 0.0068 and a correlation coefficient of 0.82.

[0113] The results showed that the decreased abundance of Ruminococcaceae and Saccharimonadaceae led to intestinal microecological imbalance, which in turn affected the digestion and absorption of metabolites retinol and α-tocopherol, ultimately leading to a decrease in the abundance of metabolites retinol and α-tocopherol in the blood and transported to the target organ testicles, causing a decrease in the reproductive performance of breeding rams.

[0114] In the description of this specification, the description with reference to the terms "one embodiment", "some embodiments", "example", "specific example", or "some examples" etc. means that the specific features, structures, materials or characteristics described in conjunction with the embodiment or example are included in at least one embodiment or example of the present invention. In this specification, the schematic representations of the above terms do not necessarily refer to the same embodiment or example. Moreover, the specific features, structures, materials or characteristics described may be combined in any one or more embodiments or examples in a suitable manner. In addition, those skilled in the art may combine and combine the different embodiments or examples described in this specification and the features of the different embodiments or examples, without contradiction.

[0115] Although the embodiments of the present invention have been shown and described above, it is to be understood that the above embodiments are exemplary and are not to be construed as limitations of the present invention. A person skilled in the art may change, modify, replace and vary the above embodiments within the scope of the present invention. SEQUENCE LISTING <110> Inner Mongolia University <120> Microbial markers for predicting reproductive performance in male ruminants and their applications <130> PIDC3204878 <160> 4 <170> PatentIn version 3.5 <210> 1 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> Ruminococcus_2 kit Forward primer <400> 1 taactcctt ttataagga cgaactaa <210> 2 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Ruminococcus_2 reverse primer <400> 2 gcctctacat cactcaagct cgat <210> 3 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> Ruminococcaceae_NK4A214_group Forward primer <400> 3 aactcataaa ctgcatttga aactgtact <210> 4 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Ruminococcaceae_NK4A214_group reverse primer <400> 4 agcgtcagtt gctgtccagt agac 24

Claims

1. Use of the reagent in preparing a kit for determining the reproductive performance of rams, the reagent for detecting Ruminococcaceae The bacterial flora of the family in, Said Ruminococcaceae The bacterial flora of the family Ruminococcus_2 The bacterial flora of the genus Ruminococcaceae_NK4A214_group The bacterial flora of the genus; The reagent is for specific detection of the Ruminococcaceae Primers or probes for bacterial groups of the family.

2. The use according to claim 1, characterized in that The specific detection Ruminococcaceae The primers for the bacterial group of the family have the nucleotide sequences shown below: The first pair of primers upstream sequence: 5'-TAAACTCCTTTTATAAGGGACGAACTAA-3' (SEQ ID NO: 1), The first pair of primers downstream sequence: 5'-GCCTCTACATCACTCAAGCTCGAT-3' (SEQ ID NO: 2); The second pair of primers upstream sequence: 5'-AACTCATAAACTGCATTTGAAACTGTACT-3' (SEQ ID NO: 3), The downstream sequence of the second pair of primers: 5′-AGCGTCAGTTGCTGTCCAGTAGAC-3′ (SEQ ID NO: 4).

3. A method for determining the reproductive performance of a ram, characterized in that: include: Detecting the flora in the first sample of the ram Ruminococcaceae The expression abundance of as well as Based on the bacterial flora in the ram samples tested Ruminococcaceae The expression abundance of , determines the reproductive performance of the ram, Among them, the Ruminococcaceae The bacterial flora is Ruminococcus_2 Bacteria and Ruminococcaceae_ NK4A214_group Belongs to the bacterial community.

4. The method according to claim 3, characterized in that: Further including: The expression abundance of retinol and / or α-tocopherol in the first sample and / or the second sample of the ram is detected.

5. The method according to claim 4, characterized in that The first sample includes at least one selected from small intestine content, large intestine content and feces.

6. The method according to claim 4, characterized in that The second sample includes at least one selected from peripheral blood and testicular samples.

7. The method according to claim 3, characterized in that The flora in the ram samples Ruminococcaceae A relative expression abundance of not less than 10% is an indication that the reproductive performance of the ram is high.

8. The method according to claim 3, characterized in that The flora in the ram samples Ruminococcus_2 The relative expression abundance of the organism is not less than 5%; and / or Ruminococcaceae_NK4A214_group A relative expression abundance of not less than 0.5% is an indication that the reproductive performance of the ram is high.

9. The method according to claim 4, characterized in that The relative expression abundance of the retinol in the first sample being no higher than 0.01% is an indication that the reproductive performance of the ram is high.

10. The method according to claim 4, characterized in that The relative expression abundance of the α-tocopherol in the first sample being not less than 0.002% is an indication that the reproductive performance of the ram is high.

11. The method according to claim 4, characterized in that The expression abundance of the retinol in the second sample being not less than 100 μg / g is an indication that the reproductive performance of the ram is high.

12. The method according to claim 4, characterized in that The expression abundance of the α-tocopherol in the second sample being not less than 15 μg / g is an indication that the reproductive performance of the ram is high.

13. The method according to claim 3, characterized in that Detection of the ram flora Ruminococcus_2 and / or Ruminococcaceae_NK4A214_group The relative expression abundance of retinol and / or α-tocopherol in the ram is measured and / or the relative expression abundance of retinol and / or α-tocopherol is detected by at least one of the following methods: 16S-rDNA sequencing, high-throughput sequencing, mass spectrometry, enzyme-linked immunosorbent assay, RT-PCR, quantitative PCR and gene chip.

14. A method for breeding rams, characterized in that: include: (1) Provide multiple candidate rams; (2) determining the reproductive performance of the candidate ram according to the method according to any one of claims 3 to 13; (3) Based on the result of step (2), determine the target ram.

Images