A single-tube nested multiplex PCR amplification method for high-throughput targeted sequencing

Abstract

The present invention relates to the field of high-throughput sequencing, and in particular to a single-tube nested multiplex PCR amplification method for high-throughput targeted sequencing, that is, using different primers with different melting temperatures (Tm), by setting two groups of different PCR reaction stages, a single-tube nested multiplex PCR reaction is achieved. The PCR products are connected by connectors to finally complete the construction of an amplicon library. The present invention utilizes nested PCR to improve the sensitivity and specificity of traditional PCR, while overcoming the disadvantage of easy cross-contamination of traditional nested PCR. When this method is applied to the construction of an amplicon library, it can greatly improve the detection sensitivity, specificity and library construction efficiency, and is particularly suitable for high-throughput sequencing analysis of viral resistance mutant genes or other low nucleic acid content samples.

Description

Technical Field

[0001] The present invention relates to the field of high-throughput sequencing, and in particular to a single-tube nested multiplex PCR amplification method for high-throughput targeted sequencing. Background Art

[0002] Polymerase chain reaction (PCR) is a molecular biology technique used to amplify specific DNA in vitro. Nested PCR (also known as nested PCR) is a variant of the polymerase chain reaction that uses two pairs of PCR primers to amplify a complete fragment, significantly improving the sensitivity and specificity of amplification. However, traditional nested PCR requires opening the lid of the reaction tube midway and performing the reaction in two rounds, which has the disadvantage of cross contamination.

[0003] Chinese patent document CN1858219A discloses a single-tube in-situ nested polymerase chain reaction method and its application, which realizes single-tube in-situ nested PCR by controlling the annealing temperature. Specifically, it sets an inner primer and an outer primer, and the inner primer has a mismatch with the target gene sequence or carries a non-gene-specific sequence at the 5 end; the maximum allowable annealing temperature of the inner primer and the original template is lower than the annealing temperature of the first round of reaction, and the melting temperature of the inner primer and the matching template is higher than the maximum allowable annealing temperature of the outer primer. The annealing temperature of the first round of PCR cycle is controlled so that the outer primer can anneal and amplify but the inner primer cannot anneal and amplify. The annealing temperature of the second round of PCR cycle is increased so that the outer primer stops annealing and amplification while the inner primer can anneal and amplify. There are two to several transition stages between the first and second rounds where the annealing temperature of the two cycles is lower than that of the two, so that the inner primer can anneal and amplify with the original template to form a matching template to start the second round of reaction. However, the sensitivity and specificity of the existing single-tube nested PCR are difficult to be satisfactory, and there is a disadvantage of easy cross contamination, which is difficult to be applied to high-throughput targeted sequencing. Summary of the invention

[0004] Therefore, the technical problem to be solved by the present invention is to overcome the disadvantages of the single-tube nested PCR method in the prior art, which has unsatisfactory sensitivity and specificity, and is prone to cross-contamination, and is difficult to apply to high-throughput targeted sequencing, thereby providing a single-tube nested multiple PCR amplification method for high-throughput targeted sequencing. When this method is applied to the construction of an amplicon library, it can greatly improve the detection sensitivity, specificity and library construction efficiency, and is particularly suitable for high-throughput sequencing analysis of viral resistance mutant genes or other low nucleic acid content samples.

[0005] To this end, the present invention provides the following technical solutions:

[0006] A single-tube nested multiplex PCR amplification method, comprising at least one set of outer primers and at least one set of inner primers; the outer primers are gene-specific primers; the inner upstream primers include a gene-specific primer sequence 1, and the inner downstream primers include a gene-specific primer sequence 2; the Tm value of the outer primers is >60°C, and the Tm values ​​of the gene-specific primer sequences 1 and 2 of the inner primers are lower than (<) the Tm value of the outer primers by 5-20°C;

[0007] The PCR amplification reaction includes at least one round of PCR amplification reaction for targeted enrichment amplification of the target gene;

[0008] The PCR amplification reaction includes two groups of PCR reaction stages with different annealing temperatures; the annealing temperature of the first stage is ≥60°C; the annealing temperature of the second stage is 5-20°C lower than (<) the annealing temperature of the first stage.

[0009] Optionally, the Tm value of the gene-specific primer sequences 1 and 2 of the inner primer set is 5-15°C lower (<) than the Tm value of the outer primer set.

[0010] Optionally, the PCR amplification reaction includes two groups of PCR reaction stages with different annealing temperatures; the annealing temperature of the first stage is ≥60°C; and the annealing temperature of the second stage is 5-10°C lower than (<) the annealing temperature of the first stage.

[0011] Optionally, the concentration of the inner primer is 5-20 times the concentration of the outer primer;

[0012] Optionally, the concentration of the inner primer is 5-10 times that of the outer primer.

[0013] Optionally, the concentration of the inner primer is 5 times the concentration of the outer primer.

[0014] Optionally, the number of amplification cycles in the first stage is 5-20 cycles, and the number of amplification cycles in the second stage is 15-30 cycles.

[0015] Optionally, the number of amplification cycles in the first stage is 10-20 cycles, and the number of amplification cycles in the second stage is 15-30 cycles.

[0016] Optionally, the number of amplification cycles in the first stage is 20 cycles, and the number of amplification cycles in the second stage is 15-30 cycles.

[0017] Optionally, the PCR amplification reaction further comprises another round of PCR amplification reaction for amplifying the sub-library.

[0018] Optionally, a library construction scheme (A) is included, in which the single-tube multiple nested PCR amplification products are subjected to another round of PCR amplification reaction, and a sequencing universal adapter sequence and a sequencing primer binding site are added to construct an amplicon sequencing library.

[0019] Optionally, the another round of PCR amplification reaction includes a second round amplification primer set, wherein the upstream primer of the second round amplification primer set includes, in order from 5' to 3', a linker sequence 1, an index sequence, and a universal primer sequence 1; the downstream primer of the second round amplification primer set includes, in order from 5' to 3', a linker sequence 2 and a universal primer sequence 2.

[0020] Optionally, the inner upstream primer includes a universal primer sequence 1 and a gene-specific primer sequence 1 in sequence from 5' to 3'; the inner downstream primer includes a universal primer sequence 2 and a gene-specific primer sequence 2 in sequence from 5' to 3'; the Tm values ​​of the gene-specific primer sequences 1 and 2 of the inner primer are 15-20°C lower (<) than the Tm value of the complete inner primer, and the Tm value of the complete inner primer is at least 5°C higher (>) than the outer primer.

[0021] Optionally, the inner upstream primer includes a universal primer sequence 1 and a gene-specific primer sequence 1 in sequence from 5' to 3'; the inner downstream primer includes a universal primer sequence 2 and a gene-specific primer sequence 2 in sequence from 5' to 3'; the Tm values ​​of the gene-specific primer sequences 1 and 2 of the inner primer are 17.5°C lower than the Tm value of the complete inner primer, and the Tm value of the complete inner primer is at least 5°C higher than that of the outer primer.

[0022] Optionally, including a library construction scheme (B), the single-tube multiple nested PCR amplification product can be added with a sequencing universal adapter sequence and a sequencing primer binding site by DNA ligase to construct an amplicon sequencing library.

[0023] Optionally, the linker connection can be through blunt end connection, TA connection or sticky end connection. The sticky end of the single-tube multiple nested PCR amplification product can be obtained by adding a sequence containing one or more of modified nucleotides, nicking enzyme recognition sites (nicking enzyme), endonuclease recognition sites, chemical modifications, photodegradable bases, etc. to the 5' end of the above-mentioned inner primer; preferably, the modified nucleotides include one or more of dUTP, dITP, and RNA bases.

[0024] Optionally, the sequencing adapter can be blunt-ended, T-overhang, or have a sequence matching the above-mentioned sticky ends; as is known in the art, the 5' end for ligase linkage can be phosphorylated.

[0025] Optional, including the first round of PCR amplification reaction system, taking the total volume of 25μl as an example:

[0026] 10x Buffer for Hot start KOD DNA polymerase, 2.5μl;

[0027] MgSO4, 25 mM, 1.5 μl;

[0028] dNTPs, 2 nM each base, 2.5 μl;

[0029] Inner set upstream primers, 10 μM each, 0.75 μl;

[0030] Inner set downstream primers, 10 μM each, 0.75 μl;

[0031] coat upstream primers, 0.25 μM each, 0.75 μl;

[0032] coat downstream primers, 0.25 μM each, 0.75 μl;

[0033] Template DNA, 2 μl;

[0034] KOD Hot start DNA polymerase, 1U / μl, 0.5μl;

[0035] Make up to 25 μl with PCR water.

[0036] The method comprises the following steps of a first round of PCR amplification reaction:

[0037] The first step was at 95°C for 2 min;

[0038] The second step was 95°C for 20 s, 60°C for 10 s, and 70°C for 2 min; 20 cycles;

[0039] The third step was 95°C for 20 seconds, 50°C for 10 seconds, and 70°C for 15 seconds; 30 cycles;

[0040] The fourth step was 70°C for 1 minute;

[0041] Keep at 10℃.

[0042] Optionally, a second round of PCR amplification reaction system is included, calculated as 25 μl;

[0043] 10x Buffer for Hot start KOD DNA polymerase, 2.5μl;

[0044] MgSO4, 25 mM, 1.5 μl;

[0045] dNTPs, 2 nM each base, 2.5 μl;

[0046] The second round of amplification upstream primer, 10 μM, 0.75 μl;

[0047] Second round amplification downstream primer, 10 μM, 0.75 μl;

[0048] Template DNA, 1 μl;

[0049] KOD Hot start DNApolymerase, 1U / μl, 0.5μl;

[0050] Make up to 25 μl with PCR water.

[0051] Optional, include a second round of PCR amplification reaction program:

[0052] The first step was at 95°C for 2 min;

[0053] The second step was 95°C for 20 s, 55°C for 10 s, and 77°C for 15 s; 18 cycles;

[0054] The third step was 70°C for 1 minute;

[0055] Keep at 10℃.

[0056] The technical solution of the present invention has the following advantages:

[0057] 1. A single-tube nested multiplex PCR amplification method for high-throughput targeted sequencing provided by the present invention comprises at least one set of outer primers and at least one set of inner primers; the outer primers are gene-specific primers; the inner upstream primers comprise a gene-specific primer sequence 1, and the inner downstream primers comprise a gene-specific primer sequence 2; the Tm value of the outer primers is >60°C, and the Tm values ​​of the gene-specific primer sequences 1 and 2 of the inner primers are 5-20°C lower than the Tm value of the outer primers; the PCR amplification reaction comprises at least one round of PCR amplification reaction for targeted enrichment amplification of target genes; the PCR amplification reaction comprises two sets of PCR reaction stages with different annealing temperatures; the annealing temperature of the first stage is ≥60°C; the annealing temperature of the second stage is 5-10°C lower than the annealing temperature of the first stage;

[0058] By jointly controlling the gene-specific sequence in the inner primer (and / or the complete inner primer when constructing the library) and the melting temperature Tm of the outer primer, and setting two sets of PCR reaction stages with different annealing temperatures in the PCR amplification reaction for targeted enrichment amplification of the target gene, the target gene can be amplified with high specificity and high sensitivity, and the targeted enrichment of the target gene can be achieved without cross-contamination, thereby greatly improving the efficiency of library construction, improving the sensitivity and specificity of library detection, and can be widely used in high-throughput sequencing analysis of nucleic acid samples, especially high-throughput sequencing analysis of viral resistance mutation genes or other low nucleic acid content samples. BRIEF DESCRIPTION OF THE DRAWINGS

[0059] In order to more clearly illustrate the specific implementation methods of the present invention or the technical solutions in the prior art, the drawings required for use in the specific implementation methods or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are some implementation methods of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0060] Figure 1 is a position map of the primers designed in Example 1 of the present invention;

[0061] Figure 2 It is the experimental result of the influence of annealing temperature on PCR reaction in Example 1 of the present invention; Figure a is the PCR reaction detection result of the single outer primer when the annealing temperature is 60°C; Figure b is the PCR reaction detection result of the single inner primer 1 when the annealing temperature is 60°C and 54°C; Figure c is the PCR reaction detection result of the single inner primer 2 when the annealing temperature is 60°C and 54°C;

[0062] Figure 3 This is the experimental result of the effect of the second stage annealing temperature on the PCR reaction in Example 2 of the present invention;

[0063] Figure 4 This is a qPCR graph of adding 5 copies of plasmid to the single-tube multiple nested PCR reaction system in Example 5 of the present invention;

[0064] Figure 5 is a linear regression graph of adding 5 copies of plasmid in the single-tube multiple nested PCR reaction system in Example 5 of the present invention;

[0065] Figure 6 The Illumina sequencing results in Example 6 of the present invention are used to calculate the measured value of the ratio of the two plasmids and the random sampling method is used to detect the impact of different sequencing depths on the measured value. DETAILED DESCRIPTION

[0066] The following examples are provided for a better understanding of the present invention, but are not intended to limit the best mode of implementation, nor to limit the content and protection scope of the present invention. Any product identical or similar to the present invention obtained by anyone under the inspiration of the present invention or by combining the features of the present invention with other prior arts shall fall within the protection scope of the present invention.

[0067] If no specific experimental steps or conditions are specified in the examples, the conventional experimental steps or conditions described in the literature in the field can be used. If no manufacturer is specified for the reagents or instruments used, they are all conventional reagent products that can be obtained commercially.

[0068] Example 1

[0069] This example provides a single-tube nested multiplex PCR primer design for amplifying hepatitis B virus genomic DNA, as follows:

[0070] (1) Primer design

[0071] Primers were designed using HBV type B DNA hepatitis B virus type B genomic DNA (accession number AY220698.1 Hepatitis B virus strain 536207, sequence as shown in SEQ ID NO.1), outer primer Out_Primer_F / R was designed, and the amplified fragment included two target regions, and inner primers Inner_Primer_F1 / R1 and Inner_Primer_F2 / R2 were designed respectively. Primers were designed according to the following principles: the Tm value (melting temperature) of the outer primer is higher than that of the inner primer; the Tm value of the outer primer is >60°C, and the Tm value of the inner primer is 5-15°C lower than the Tm value of the outer primer. The designed primers are shown in Table 1 below, and the positions of the designed primers are shown in Figure 1 shown.

[0072] Table 1. Primers and Tm values

[0073]

[0074] (2) Configure the PCR reaction system

[0075] Table 2. PCR reaction system

[0076]

[0077]

[0078] (3) Effect of annealing temperature on PCR

[0079] 1) Coat primer set

[0080] According to the PCR reaction system configured in Table 2 above (the upstream primer and the downstream primer are the outer primer set at this time), the PCR program is carried out as follows: the first step is at 95°C for 2 minutes; the second step is 35 cycles (95°C for 20 seconds, 60°C for 10 seconds, and 70°C for 2 minutes); the third step is 70°C for 2 minutes and maintained at 10°C. Parallel twice

[0081] The amplified products obtained from the two parallel experiments were subjected to 1% agarose gel electrophoresis. Figure 2 a, the desired 3.2 kb fragment was obtained, indicating that the coat primer set can effectively react with PCR at an annealing temperature of 60°C.

[0082] 2) The reaction of the inner primer set 1 at an annealing temperature of 60°C or 54°C

[0083] The PCR reaction system configured according to Table 2 above (at this time, the upstream primer and the downstream primer are inner primer set 1, i.e., Inner_Primer_F1 and Inner_Primer_R1) was performed according to the following PCR program: the first step was at 95°C for 2 minutes; the second step was 35 cycles (at 95°C for 20 seconds, at 60°C (or 54°C) for 10 seconds, and at 70°C for 15 seconds); the third step was at 70°C for 1 minute and maintained at 10°C. Each annealing temperature was tested in parallel twice.

[0084] The amplified products obtained above were subjected to 2% agarose gel electrophoresis. Figure 2 b, Figure 2 Lanes 1 and 2 in b are the detection results at an annealing temperature of 54°C, and lanes 3 and 4 are the detection results at an annealing temperature of 60°C, indicating that when the annealing temperature is 60°C, inner primer set 1 will not produce specific PCR products, and when the annealing temperature is 54°C, inner primer set 1 will obtain specific PCR products.

[0085] 3) Reaction of inner primer set 2 at annealing temperature of 60°C or 54°C

[0086] The PCR reaction system configured according to Table 2 above (at this time, the upstream primer and the downstream primer are inner primer set 2, i.e., Inner_Primer_F2 and Inner_Primer_R2) was performed according to the following PCR program: the first step was at 95°C for 2 minutes; the second step was 35 cycles (at 95°C for 20 seconds, at 60°C (or 54°C) for 10 seconds, and at 70°C for 15 seconds); the third step was at 70°C for 1 minute and maintained at 10°C. Each annealing temperature was tested in parallel twice.

[0087] The amplified products obtained above were subjected to 2% agarose gel electrophoresis. Figure 2 c, Figure 2 Lane 1 and Lane 2 in c are the detection results at an annealing temperature of 54°C, and Lane 3 and Lane 4 are the detection results at an annealing temperature of 60°C, indicating that when the annealing temperature is 60°C, the inner primer set 2 will not produce specific PCR products, and when the annealing temperature is 54°C, the inner primer set 2 will obtain specific PCR products.

[0088] Example 2

[0089] This embodiment provides a method for amplifying hepatitis B virus genomic DNA by single-tube nested multiplex PCR, comprising:

[0090] (1) The primers designed in Example 1 were used to prepare the PCR reaction system shown in Table 3 below:

[0091] Table 3. PCR reaction system

[0092]

[0093]

[0094] (2) Optimization of annealing temperature of the inner primer set

[0095] The PCR reaction system configured according to Table 3 above is performed according to 1)-3) as follows:

[0096] 1) PCR procedure 1

[0097] The first step was at 95°C for 2 min;

[0098] the second step, 20 cycles (95°C for 20 s, 60°C for 10 s, and 70°C for 2 min);

[0099] Step 3 30 cycles (95°C for 20 s, 50°C for 10 s, 70°C for 15 s);

[0100] The fourth step was 70°C for 1 minute;

[0101] Keep at 10℃.

[0102] 2) PCR procedure 2

[0103] The first step was at 95°C for 2 min;

[0104] the second step, 20 cycles (95°C for 20 s, 60°C for 10 s, and 70°C for 2 min);

[0105] step 30 cycles (95°C for 20 s, 52°C for 10 s, and 70°C for 15 s);

[0106] The fourth step was 70°C for 1 minute;

[0107] Keep at 10℃.

[0108] 3) PCR procedure 3

[0109] The first step was at 95°C for 2 minutes

[0110] the second step, 20 cycles (95°C for 20 s, 60°C for 10 s, and 70°C for 2 min);

[0111] step 30 cycles (95°C for 20 s, 54°C for 10 s, and 70°C for 15 s);

[0112] The fourth step was 70°C for 1 minute;

[0113] Keep at 10℃.

[0114] Each PCR program was tested twice in parallel, and the amplified products of each PCR program were subjected to gel electrophoresis. The results are shown in Figure 3 (In the figure, lanes 1 and 2 are the results when the annealing temperature of inner primer group 1 and 2 is 50°C, lanes 3 and 4 are the results when the annealing temperature of inner primer group 1 and 2 is 52°C, and lanes 5 and 6 are the results when the annealing temperature of inner primer group 5 and 6 is 54°C). The results showed that when the annealing temperature of the second stage amplification was 50°C, the PCR results were best.

[0115] Example 3

[0116] This embodiment provides a method for constructing a single-tube nested multiplex PCR amplicon library, comprising the following steps:

[0117] (1) Primer design

[0118] The primers in Example 1 were used to amplify HBV type B DNA and construct a library. Universal sequence 1 (GCGTCAGATGTGTATAAGAGACAG) was added to the 5' ends of the inner primers Inner_Primer_F1 Inner_Primer_F2, and universal sequence 2 (CGTGTGCTCTTCCGATCT) was added to the 5' ends of Inner_Primer_R1 and Inner_Primer_R2. The primers for the second round of amplification (2nd_round PCR_Primer_F, 2nd_round PCR_Primer_R) were designed. The designed primers are shown in Table 4.

[0119] Table 4. Primer list

[0120]

[0121]

[0122] The NNNNNNNN in the above sequence represents the index sequence.

[0123] (2) Preparation of PCR reaction system and PCR amplification (two parallel experiments) The PCR reaction system for the first round is shown in Table 5.

[0124] Table 5. PCR reaction system for round 1

[0125]

[0126]

[0127] Prepare the first round of PCR reaction system according to the above table and perform the following first round PCR amplification procedure:

[0128] The first step was at 95°C for 2 min;

[0129] the second step, 20 cycles (95°C for 20 s, 60°C for 10 s, and 70°C for 2 min);

[0130] Step 3: 15 cycles (95°C for 20 s, 50°C for 10 s, and 70°C for 15 s);

[0131] The fourth step was 70°C for 1 minute;

[0132] Maintain at 10°C;

[0133] The amplified products of the above PCR program were used to prepare the second round of PCR reaction system as shown in Table 6 below.

[0134] Table 6. Second round PCR reaction system

[0135]

[0136]

[0137] Prepare the second round of PCR reaction system according to the above table and perform the following second round of PCR amplification procedure:

[0138] The first step was at 95°C for 2 min;

[0139] the second step, 18 cycles (95°C for 20 s, 55°C for 10 s, and 77°C for 15 s);

[0140] The third step was 70°C for 1 minute;

[0141] Keep at 10℃.

[0142] (3) Purification

[0143] The obtained second-round PCR amplification reaction products were purified using RNAClean up XP beads (0.8x) and then dissolved in 10 μl of water.

[0144] (4) Library quantification and sequencing

[0145] The library was quantified using the Kapa Quantification kit, and then sequenced using Illumina. The sequencing results are shown in Table 7 below.

[0146] Table 7. Sequencing results

[0147]

[0148] The above results indicate that the sublibraries amplified by the single-tube nested multiplex PCR of the present invention have high specificity.

[0149] Example 4

[0150] This embodiment provides a method for constructing an amplicon library by single-tube nested multiplex PCR combined with DNA ligase, comprising the following steps:

[0151] (1) Primer design

[0152] The HBV type B DNA hepatitis B virus type B genomic DNA was amplified using the primers in Example 1 to construct a library, and the universal sequence 3 (AGATCGGCAGCGTCAGATGTGTATAAGAGACAG) was added to the 5' end of the inner primers Inner_Primer_F1 Inner_Primer_F2, and the universal sequence 4 (AGATCGCTCTTCCGATCT) was added to the 5' end of Inner_Primer_R1 and Inner_Primer_R2. The amplified product was connected to a complementary sticky double-stranded sequencing adapter to construct a sequencing sublibrary. Primers and adapters (the sequence of the upper chain of the adapter of the upstream adapter is shown in SEQ ID NO.18, the sequence of the lower chain of the adapter of the upstream adapter is shown in SEQ ID NO.19, the sequence of the upper chain of the adapter of the downstream adapter is shown in SEQ ID NO.20, and the sequence of the lower chain of the adapter of the downstream adapter is shown in SEQ ID NO.21) are listed as follows:

[0153] Table 8. Primer list

[0154]

[0155]

[0156] Table 9. Connector List

[0157]

[0158] The NNNNNNNN in the above sequence represents the index sequence.

[0159] (2) Experimental steps:

[0160] A. Single-tube multiplex nested PCR

[0161] Table 10. PCR reaction system for the first round

[0162]

[0163]

[0164] Prepare the first round of PCR reaction system according to the above table and perform the following first round PCR amplification procedure:

[0165] The first step was at 95°C for 2 min;

[0166] the second step, 20 cycles (95°C for 20 s, 60°C for 10 s, and 70°C for 2 min);

[0167] Step 3: 15 cycles (95°C for 20 s, 50°C for 10 s, and 70°C for 15 s);

[0168] The fourth step was 70°C for 1 minute;

[0169] Maintain at 10°C;

[0170] The PCR products obtained above were purified.

[0171] B DNA ligase-mediated sequencing library construction

[0172] The purified PCR product was treated with restriction endonucleases Bbv1 and Ear1, and the reaction system was prepared according to Table 11 below.

[0173] Table 11. Reaction system

[0174] Components volume 10x Cutsmart Buffer (NEB) 2μl BbvI (NEB, 2 U / μl) 1μl EarI (NEB, 20U / μl) 0.5μl Purification of PCR products 5μl 50ng Nuclease-free water 11.5μl Total volume 20μl

[0175] The reaction system prepared according to Table 11 above was placed in a thermal cycler and incubated at 37°C for 30 minutes.

[0176] Then, the mixture was incubated at 65°C for 20 minutes to inactivate the enzyme.

[0177] The reaction mixture was purified using HiPrep PCR magnetic beads (1.2x) and eluted in 15 μl of water.

[0178] Connector connection, connector preparation: Prepare the reaction system according to Table 12 below.

[0179] Table 12. Preparation of linkers

[0180]

[0181] The reaction system prepared according to Table 12 above was incubated in a thermal cycler at 82°C for 2 minutes.

[0182] Cool to 25°C at a rate of 0.1°C / 3 seconds.

[0183] Annealing procedure:

[0184] 82°C, 2 minutes;

[0185] 570x{82℃, 3 seconds, -0.1℃ / cycle}

[0186] Keep warm at 4℃.

[0187] Ligation reaction, the ligation reaction system is shown in Table 13 below.

[0188] Table 13. Ligation reaction system

[0189] Components capacity 10x T4 DNA Ligase Buffer (NEB) 2μl Purified PCR products 15μl Upstream linker (10 μM) 1μl Downstream linker (10 μM) 1μl T4 DNA ligase (NEB, 200 U / μl) 1μl Total volume 20μl

[0190] Prepare the ligation reaction system according to Table 13 above to obtain a reaction mixture, gently mix the reaction mixture up and down by pipetting, and perform a brief centrifugation. Incubate at room temperature for 15 minutes. Purify the ligation mixture using HiPrep PCR magnetic beads (1x) and elute in 10 μl of water.

[0191] Measuring library concentration

[0192] Take 1 μl of the purified ligation product and prepare a series of 10-fold dilutions (1:10 to 1:10000).

[0193] The concentration of the 1:10,000 dilution was determined using the Kapa Library Quantification Kit.

[0194] The concentration of the library was adjusted to 4 nM with water.

[0195] Sequencing was performed on the Illumina sequencing platform.

[0196] Sequencing results

[0197] The original .fastq files of Illumina paired-end sequencing were assembled into complete segments by PEAR software. Each assembled sequencing result was compared with the target segment sequence, and the sequence that met the expected read length generated by the correctly paired primers was identified as on-target. The on-target rate was the proportion of the number of on-target sequences in the total number of reads. The result was a total of 554,265 reads and a on-target rate of 97.0%.

[0198] Example 5 Sensitivity of single-tube multiple nested PCR amplification library construction

[0199] HBV B subtype plasmid (pHBV1.3_B, provided by Shanghai Pasteur Institute, Chinese Academy of Sciences) was used as a template to detect the lower limit of detection (LOD) of the single-tube multiple nested PCR amplification method of the present invention. The plasmid concentration was first adjusted to 5×10 8copy / uL, and then 10-fold gradient dilution to 5 copy / uL. PCR grade water was used as a blank negative control. Single-tube multiple nested PCR was performed according to the method in Example 4, and Sybr Green was added to the PCR reaction system for real-time monitoring of the PCR amplification curve. Figure 4 It shows that when 5 copies of plasmid were added to a single-tube multiple nested PCR reaction system, there was still a significant Ct difference compared with the blank control. The linear regression r of 5-50,000 template molecules was used. 2 is 0.9985, and the linear regression graph is shown in Figure 5 .

[0200] Example 6 Bias verification of single-tube multiple nested PCR

[0201] The mixing experiment of HBV B subtype plasmid (pHBV1.3_B, provided by Shanghai Pasteur Institute, Chinese Academy of Sciences) and HBV D subtype plasmid (pHBV1.3_D, provided by Shanghai Pasteur Institute, Chinese Academy of Sciences) was used to verify the potential amplification bias (skewing) in single-tube multiple nested PCR. The mixing ratio of the two plasmids was 0.5%, 1%, 2%, 10%, 20%, 50%, 80%, 90%, 98%, 99%, 99.5% (molar ratio). The single-tube multiple nested PCR library was constructed according to the method in Example 4. The Illumina sequencing results were used to calculate the measured value of the ratio of the two plasmids, and the random sampling method was used to detect the effect of different sequencing depths on the measured value ( Figure 6 ). At 1,000x-16,000x sequencing depth, the correlation (r) between the measured and actual values ​​was greater than 0.999.

[0202] Obviously, the above embodiments are merely examples for the purpose of clear explanation, and are not intended to limit the implementation methods. For those skilled in the art, other different forms of changes or modifications can be made based on the above description. It is not necessary and impossible to list all the implementation methods here. The obvious changes or modifications derived therefrom are still within the scope of protection of the invention. Sequence Listing <110> Beijing Meikang Gene Science Co., Ltd. <120> A single-tube nested multiplex PCR amplification method for high-throughput targeted sequencing <150> CN202011629568.1 <151> 2020-12-31 <160> twenty one <170> SIPOSequenceListing 1.0 <210> 1 <211> 3215 <212> DNA <213> Hepatitis B virus strain genomic DNA <400> 1 aactccacca ctttccacca aactcttcaa gatcccagag tcagggccct gtactttcct 60 gctggtggct ccagttcagg aacagtgagc cctgctcaaa atactgtctc tgccatatcg 120 tcaatcttat cgaaaactgg ggaccctgta ccgaacatgg agaacatcgc atcaggactc 180 ctaggacccc tgctcgtgtt acaggcgggg tttttcttgt tgacaaaaat cctcacaata 240 ccacagagtc tagactcgtg gtggacttct ctcaattttc tagggggaac acccgtgtgt 300 cttggccaaa attcgcagtc ccaaatctcc agtcactcac caacctgttg tcctccaatt 360 tgtcctggtt atcgctggat gtatctgcgg cgttttatca tattcctctg catcctgctg 420 ctatgcctca tcttcttgtt ggttcttctg gactatcaag gtatgttgcc cgtttgtcct 480 ctaattccag gatcatcaac aaccagcacc ggaccatgca aaacctgcac gactcctgct 540 caaggaacct ctatgtttcc ctcatgttgc tgtacaaaac ctacggacgg aaactgcacc 600 tgtattccca tcccatcatc ttgggctttc gcaaaattcc tatgggagtg ggcctcagtc 660 cgtttctctt ggctcagttt actagtgcca tttgttcagt ggttcgtagg gctttccccc 720 actgtctggc tttcagttat atggatgatt tggttttggg ggccaagtct gtacaacatc 780 ttgagtccct ttatgccgct gttaccaatt ttcttttgtc tttgggtata catttaaacc 840 ctcacaaaac aaaaagatgg ggatattccc ttaactttat gggatatgta attgggagtt 900 ggggcacatt gccacaggaa catattgtac aaaaaatcaa aatatgtttt aggaaacttc 960 ctgtaaacag gcctattgat tggaaagtct gtcaacgaat tgtgggtctt ttggggtttg 1020 ccgccccttt cacgcaatgt ggatatcctg ctttaatgcc tttatatgca tgtatacaag 1080 caaaacaggc ttttattttc tcgccaactt acaaggcctt tctgagtaaa cagtatttga 1140 acctttaccc cgttgctcgg caacggcctg gtctgtgcca agtgtttgct gacgcaaccc 1200 ccactggttg gggcttggcc ataggccatc agcgcatgcg tggcaccttt gtgtctcctc 1260 tgccgatcca tactgcggaa ctcctagccg cttgttttgc tcgcagcagg tctggggcaa 1320 aactcatcgg gactgacaat tctgtcgtgc tctcccgcaa gtatacatca tttccatggc 1380 tgctaggctg tgctgccaac tggatcctgc gcgggacgtc ctttgtttac gtcccgtcgg 1440 cgctgaatcc cgcggacgac ccctcccggg gccgcttggg gctctaccgc ccgcttctcc 1500 gcctgttgta ccgaccgacc acggggcgca cctctcttta cgcggactcc ccgtctgtgc 1560 cttctcatct gccggaccgt gtgcacttcg cttcacctct gcacgtcgca tggaaaccac 1620 cgtgaacgcc cacaggaacc tgcccaaggt cttgcataag aggactcttg gactttcagc 1680 aatgtcaacg accgaccttg aggcatactt caaagactgt gtgtttactg agtgggagga 1740 gttgggggag gaggttaggt taatgatctt tgtactagga ggctgtaggc ataaattggt 1800 gtgttcacca gcaccatgca actttttcac ctctgcctaa tcatctcatg ttcatgtcct 1860 actgttcaag cctccaagct gtgccttggg tggctttggg gcatggacat tgacccgtat 1920 aaagaatttg gagcttctgt ggagttactc tcttttttgc cttctgactt ctttccttct 1980 attcgagatc tcctcgacac cgcctctgct ctgtatcggg aggccttaga gtctccggaa 2040 cattgttcac ctcaccatac ggcactcagg caagctattc tgtgttgggg tgagttaatg 2100 aatctagcca cctgggtggg aagtaatttg gaagatccag catccaggga attagtagtc 2160 agctatgtca acgttaatat gggcctaaaa atcagacaac tattgtggtt tcacatttcc 2220 tgtcttactt ttgggagaga aactgttctt gaatatttgg tgtctttttgg agtgtggatt 2280 cgcactcctc ccgcatatag accgccaaat gccctatct tatcaacact tccggaaact 2340 actgttgtta gacgaagagg caggtcccct agaagaagaa ctccctcgcc tcgcagacga 2400 aggtctcaat cgccgcgtcg cagaagatct caatctcggg aatctcaatg ttagtattcc 2460 ttggacacac aaggtgggaa actttacggg gctttattct tctacggtac cttgctttaa 2520 tcctaaatgg caaactcctt cttttcctga cattcatttg caggaggaca ttgttgatag 2580 atgtaagcaa tttgtggggc cccttacagt aaatgaaaac aggagactta attaattat 2640 gcctgctagg tttatccca atgttactaa atatttgccc ttagataaag ggatcaaacc 2700 gtattatcca gagtatgtag ttaatcatta cttccagacg cgacattatt tacacactct 2760 ttggaaggcg gggatcttat ataaaagaga gtccacacgt agcgcctcat tttgcgggtc 2820 accatattct tgggaacaag atctacagca tgggaggttg gtcttccaaa cctcgaaaag 2880 gcatggggac aaatctttct gtccccaatc ccctgggatt cttccccgat catcagttgg 2940 accctgcatt caaagccaac tcagaaaatc cagattggga cctcaacccg cacaaggaca 3000 actggccgga cgccaacaag gtgggagtgg gagcattcgg gccagggttc acccctcccc 3060 atgggggact gttggggtgg agccctcagg ctcagggcct actcacaact gtgccagcag 3120 ctcctcctcc tgcctccacc aatcggcagt taggaaggca gcctactccc ttatctccac 3180 ctctaaggga cactcatcct caggccatgc agtgg 3215 <210> 2 <211> 32 <212> DNA <213> Artificial Sequence Out_Primer_F <400> 2 cacctctgcc taatcatctc atgttcatgt cc 32 <210> 3 <211> 25 <212> DNA <213> Artificial Sequence Out_Primer_R <400> 3 agttgcatgg tgctggtgaa cacac 25 <210> 4 <211> twenty one <212> DNA <213> Artificial Sequence Inner_Primer_F1 <400> 4 attcttggga acaagatcta c 21 <210> 5 <211> 17 <212> DNA <213> Artificial Sequence Inner_Primer_R1 <400> 5 tgaactggag ccaccag 17 <210> 6 <211> 19 <212> DNA <213> Artificial Sequence Inner_Primer_F2 <400> 6 cacctgtatt cccatccca 19 <210> 7 <211> twenty three <212> DNA <213> Artificial Sequence Inner_Primer_R2 <400> 7 cgttgacaga ctttccaatc aat 23 <210> 8 <211> 45 <212> DNA <213> Artificial SequenceInner_Primer_F1 with a universal tail(Artificial SequenceInner_Primer_F1 with a universal tail) <400> 8 gcgtcagatg tgtataagag acagattctt gggaacaaga tctac 45 <210> 9 <211> 35 <212> DNA <213> Artificial Sequence Inner_Primer_R1 with a universal tail <400> 9 cgtgtgctct tccgatcttg aactggagcc accag 35 <210> 10 <211> 43 <212> DNA <213> Artificial Sequence Inner_Primer_F2 with a universal tail <400> 10 gcgtcagatg tgtataagag acagcacctg tattcccatc cca 43 <210> 11 <211> 41 <212> DNA <213> Artificial Sequence Inner_Primer_R2 with a universal tail <400> 11 cgtgtgctct tccgatctcg ttgacagact ttccaatcaa t 41 <210> 12 <211> 70 <212> DNA <213> Artificial Sequence 2nd_round PCR_Primer_F <220> <221> misc_feature <222> (30)...(37) <223> n =a or g or c or t <400> 12 aatgatacgg cgaccaccga gatctacacn nnnnnnntcg tcggcagcgt cagatgtgta 60 taagagacag 70 <210> 13 <211> 66 <212> DNA <213> Artificial Sequence 2nd_round PCR_Primer_R <220> <221> misc_feature <222> (25)...(32) <223> n =a or g or c or t <400> 13 caagcagaag acggcatacg agatnnnnnn nngtgactgg agttcagacg tgtgctcttc 60 cgatct 66 <210> 14 <211> 54 <212> DNA <213> Artificial SequenceInner_Primer_F1 with a universal tail <400> 14 agatcggcag cgtcagatgt gtataagaga cagattcttg ggaacaagat ctac 54 <210> 15 <211> 35 <212> DNA <213> Artificial SequenceInner_Primer_R1 with a universal tail(Artificial SequenceInner_Primer_R1 with a universal tail) <400> 15 agatcgctct tccgatcttg aactggagcc accag 35 <210> 16 <211> 52 <212> DNA <213> Artificial SequenceInner_Primer_F2 with a universal tail(Artificial SequenceInner_Primer_F2 with a universal tail) <400> 16 agatcggcag cgtcagatgt gtataagaga cagcacctgt attcccatcc ca 52 <210> 17 <211> 41 <212> DNA <213> Artificial SequenceInner_Primer_R2 with a universal tail <400> 17 agatcgctct tccgatctcg ttgacagact ttccaatcaa t 41 <210> 18 <211> 56 <212> DNA <213> Artificial sequence upstream adapter adapter chain (Artificial Sequence upstream adapter adapter chain) <220> <221> misc_feature <222> (30)...(37) <223> n =a or g or c or t <400> 18 aatgatacgg cgaccaccga gatctacacn nnnnnnntcg tcggcagcgt cagatg 56 <210> 19 <211> twenty three <212> DNA <213> Artificial sequence upstream adapter adapter lower chain (Artificial Sequence upstream adapter adapter lower chain) <400> 19 tacacatctg acgctgccga cga 23 <210> 20 <211> 64 <212> DNA <213> Artificial sequence downstream adapter adapter chain (Artificial Sequence downstream adapter adapter chain) <220> <221> misc_feature <222> (33)...(40) <223> n =a or g or c or t <400> 20 atcggaagag cacacgtctg aactccagtc acnnnnnnnn atctcgtatg ccgtcttctg 60 cttg 64 <210> twenty one <211> 29 <212> DNA <213> Artificial sequence downstream adapter adapter lower chain (Artificial Sequence downstream adapter adapter lower chain) <400> twenty one gtgactggag ttcagacgtg tgctcttcc 29

Claims

1. A single-tube nested multiplex PCR amplification method for non-disease diagnosis and treatment purposes, characterized in that: include: The primers and Tm values ​​are as follows: The PCR amplification reaction is a round of PCR amplification reaction, which is used for targeted enrichment amplification of the target gene; the PCR amplification reaction consists of two sets of PCR reaction stages with different annealing temperatures. Composition: Amplification reaction program: the first step is at 95°C for 2 minutes; the second step is at 95°C for 20 seconds, 60°C for 10 seconds, and 70°C for 2 minutes; 20 cycles; the third step is at 95°C for 20 seconds, 50°C for 10 seconds, and 70°C for 15 seconds; 30 cycles; the fourth step is at 70°C for 1 minute; maintained at 10°C; the PCR reaction system is as follows: 。 2. The method according to claim 1, characterized in that The single-tube nested multiplex PCR amplification product is added with a sequencing universal adapter sequence and a sequencing primer binding site by DNA ligase to construct an amplicon sequencing library; The primer sequences are as follows: The linker sequence is as follows: The NNNNNNNN in the above sequence represents the index sequence; The PCR reaction system of single-tube multiple nested PCR is as follows: The PCR amplification procedure is as follows: Step 1: 95°C for 2 minutes; Step 2: 95°C for 20 seconds, 60°C for 10 seconds, 70°C for 2 minutes, 20 cycles; Step 3: 95°C for 20 seconds, 50°C for 10 seconds, 70°C for 15 seconds, 15 cycles; Step 4: 70°C for 1 minute; Maintain at 10°C; Purify the PCR product obtained above; DNA ligase-mediated sequencing library construction: The purified PCR amplification product was treated with restriction endonucleases Bbv1 and Ear1, and the reaction system was prepared as follows: The reaction system prepared as above was placed in a thermal cycler and incubated at 37°C for 30 minutes; Then incubate at 65°C for 20 min to inactivate the enzyme; The reaction mixture was purified using HiPrep PCR magnetic beads 1.2x and eluted in 15 μl of water; Adapter connection, adapter preparation according to the following preparation reaction system: The reaction system prepared as above was incubated in a thermal cycler at 82°C for 2 minutes; Cool to 25°C at a rate of 0.1°C / 3 seconds; Annealing procedure: 82°C, 2 minutes; 570x{82℃, 3 seconds, -0.1℃ / cycle} Keep warm at 4℃; Ligation reaction, the ligation reaction system is as follows: Prepare the ligation reaction system as described above to obtain a reaction mixture, gently mix the reaction mixture up and down by pipetting, and briefly centrifuge; incubate at room temperature for 15 minutes; purify the ligation mixture using HiPrep PCR magnetic beads 1x and elute in 10 μl of water; Measure library concentration; Take 1 μl of the purified ligation product and prepare a series of 10-fold dilutions, from 1:10 to 1:10000; The concentration of the 1:10,000 dilution was determined using the Kapa library quantification kit; The concentration of the library was adjusted to 4 nM with water; Sequencing was performed on the Illumina sequencing platform.

3. The method according to claim 1, characterized in that The PCR amplification reaction further includes another round of PCR amplification reaction for amplifying the sub-library, wherein the another round of PCR amplification reaction includes a second round of amplification primer set, and the second round of amplification primer set is as follows: The NNNNNNNN in the above sequence represents the index sequence; The first round of PCR reaction system: 25 μl; Hot start KOD DNA polymerase 10× Buffer, Novagen, 2.5 μl; MgSO4, 25 mM, 1.5 μl; dNTPs, 2 nM each base, 2.5 μl; Internal primer F1 with universal sequence, 10 μM, 0.75 μl; Internal primer R1 with universal sequence, 10 μM, 0.75 μl; Internal primer F2 with universal sequence, 10 μM, 0.75 μl; Internal primer R2 with universal sequence, 10 μM, 0.75 μl; outer primer F, 0.25 μM, 0.75 μl; Outer primer_R, 0.25 μM, 0.75 μl; Template DNA: DNA template diluted at a volume ratio of 1:10, 2 μl; KOD hot start DNA polymerase, 1 U / μl, 0.5 μl; Make up to 25 μl with PCR water; PCR amplification procedure for round 1: Step 1: 95°C for 2 minutes; Step 2: 95°C for 20 seconds, 60°C for 10 seconds, 70°C for 2 minutes; 20 cycles; Step 3: 95°C for 20 seconds, 50°C for 10 seconds, 70°C for 15 seconds; 15 cycles; Step 4: 70°C for 1 minute; Maintain at 10°C; The amplified product of the above PCR amplification procedure was used to prepare the second round of PCR reaction system. The second round of PCR amplification reaction system is 25 μl; Hot start KOD DNA polymerase 10× Buffer, Novagen, 2.5 μl; MgSO4, 25 mM, 1.5 μl; dNTPs, 2 nM each base, 2.5 μl; The second round of amplification upstream primer, 10 μM, 0.75 μl; Second round amplification downstream primer, 10 μM, 0.75 μl; First round PCR amplification template DNA, 1 μl; KOD hot start DNA polymerase, 1 U / μl, 0.5 μl; Make up to 25 μl with PCR water; Second round PCR amplification reaction procedure: Step 1: 95°C for 2 minutes; Step 2: 95°C for 20 seconds, 55°C for 10 seconds, 77°C for 15 seconds; 18 cycles; Step 3: 70°C for 1 minute; Maintain at 10°C; purification: The obtained second-round PCR amplification reaction products were purified using RNA Clean up XP beads, 0.8x, and then dissolved in 10 μl of water; Library quantification and sequencing: The library was quantified using the Kapa Quantification kit and then sequenced using Illumina.

Images