An NMR-based method for detecting the activity of Arf6-specific guanylate exchange factor GEF and its application

Abstract

The present invention discloses an NMR-based Arf6 specific guanine nucleotide exchange factor GEF activity detection method and application thereof, belonging to the field of biotechnology. The GEF activity detection method provided by the present invention utilizes the substitution of the 47th amino acid of the Arf6 protein to 19 The recombinant protein of the unnatural amino acid tfmF labeled with F was used as a probe to detect the transition of the Arf6 protein from the GDP state to the GTP state over time. 19 The one-dimensional F NMR spectrum can detect the activity of the Arf6-specific guanylate exchange factor GEF in simple environments such as in vitro purified GEF enzymes and in complex biological environments such as cell lysates, and can be used to screen drugs that have an enhancing or inhibitory effect on the activity of the Arf6-specific guanylate exchange factor GEF.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and specifically relates to an activity detection method of Arf6-specific guanine nucleotide exchange factor GEF based on NMR (nuclear magnetic resonance) and its application, and also relates to a method for detecting the activity of the Arf6-specific guanine nucleotide exchange factor GEF. 19 Arf6 recombinant protein labeled with specific amino acid at F site and its expression vector and application in screening drugs with enhancing or inhibiting effect on the activity of Arf6 specific guanylate exchange factor GEF. Background Art

[0002] ADP-ribosylation factor (Arf) is a type of small GTPase that belongs to the Ras superfamily. Mammals have 6 Arf proteins (Arf1-6), of which Arf6 mainly functions to regulate plasma membrane transport and actin cytoskeleton assembly, and participates in the regulation of various physiological processes, including vesicle endocytosis, secretion, cell adhesion, cell migration, etc. In addition, Arf6 also plays an important regulatory role in the migration and invasion of tumor cells. Similar to other small GTPases, Arf6 functions as a molecular switch in cells, cycling between the activated state bound to GTP (Arf6-GTP) and the inactivated state bound to GDP (Arf6-GDP). The transition between these two states of Arf6 needs to be achieved through the guanine exchange factor GEF (Guanine Exchange Factor) and the GTPase activating protein GAP (GTPase Activating Protein). Among them, GEF promotes GDP / GTP exchange, converting Arf6-GDP into Arf6-GTP, while GAP mediates GTP hydrolysis, converting Arf6-GTP into Arf6-GDP. Arf6-specific GEF and GAP play important functions in cells by regulating the GDP / GTP cycle of Arf6. Therefore, detecting the activity of these two types of proteins is of great significance for studying their biochemical characteristics and their functions in normal physiological processes and pathological processes such as tumor invasion and metastasis.

[0003] Currently, a variety of methods have been reported for detecting the activity of GEFs and GAPs in vitro and in vivo. For example: 1) Fluorescently labeled nucleotide analogs are combined with purified small GTPase proteins in vitro, and the fluorescence difference produced by the small GTPase binding to nucleotides in the solution changes over time to detect nucleotide exchange or hydrolysis in real time. However, fluorescent labeling will change the kinetics of GTPase nucleotide exchange / hydrolysis reactions; 2) Immunoprecipitation is used to detect the activity of GEFs and GAPs in vitro and in vivo. 32P nucleotides are incorporated into the cell culture system, small GTPases are immunoprecipitated from cell lysates by antibodies, and the GDP to GTP ratio is analyzed by thin layer chromatography to determine the GAP and GEF activities in the cell lysate. This method has high sensitivity, but requires the use of radioactive isotopes and appropriate antibodies; 3) The traditional affinity-based pull-down method for detecting small GTPase activity uses effector proteins to extract activated GTPases from the body, thereby showing the activity state of small GTPases in cells. However, this method cannot distinguish the activity levels of small GTPase-specific GEF / GAPs and is only applicable to small GTPases with strong binding effector proteins; 4) A nuclear magnetic resonance (NMR)-based small GTPase activity detection method developed by the Ikura research group (Smith, MJ, BG Neel and M. Ikura, NMR-based functional profiling of RASopathies and oncogenic RASmutations. Proc Natl Acad Sci USA, 2013.110(12):p.4574-9; Gebregiworgis, T., CB Marshall, T. Nishikawa, et al., Multiplexed Real-Time NMR GTPase Assay for Simultaneous Monitoring of Multiple Guanine Nucleotide Exchange Factor Activities from Human Cancer Cells and Organoids. Journal of the American Chemical Society, 2018.140(13):p.4473-4476). This method records a series of two-dimensional NMR spectra and uses the intensity changes of the cross peaks of small GTPase proteins that are sensitive to nucleotide binding or hydrolysis to measure the nucleotide exchange or hydrolysis activity of small GTPases. It can simultaneously detect the GEF / GAP activities of multiple small GTPases. However, this method requires the small GTPase proteins to be subjected to 15 N(or 13 C) Stable isotope labeling. To avoid peak overlap, the protein must be labeled with a specific amino terminus. 15 N / 13 C labeling, and the acquisition of NMR two-dimensional spectra is time-consuming. Summary of the invention

[0004] In view of one or more problems existing in the prior art, one aspect of the present invention provides a method for detecting the activity of an Arf6-specific guanylate exchange factor GEF based on NMR, which comprises the following steps:

[0005] 1) Provide a 19 F site-specific non-natural amino acid labeled Arf6 recombinant protein GDP state protein, detection and recording 19 F NMR one-dimensional spectrum R0;

[0006] 2) The Arf6 specific guanine nucleotide exchange factor GEF sample to be detected is mixed with the one provided in step 1) 19 The GDP-state protein of Arf6 recombinant protein labeled with a non-natural amino acid at the F site is mixed, and GTP or its analog is added to obtain a mixed system;

[0007] 3) Detect and record a series of 19 F NMR one-dimensional spectra R1, R2, R3, ..., Rn, the one-dimensional spectrum contains representative 19 The first peak and representative peak of the GDP state of Arf6 recombinant protein labeled with site-specific unnatural amino acids 19 F. The second spectrum peak of the GTP state of the Arf6 recombinant protein labeled with a site-specific non-natural amino acid, wherein the GTP state is obtained by converting the GDP state via GEF;

[0008] 4) integrating the areas under the first peak and the second peak in the one-dimensional spectra R0, R1, R2, R3, ..., Rn, respectively, wherein the area under the first peak represents the GDP state content, and the area under the second peak represents the GTP state content, and obtaining the GDP state content and the GTP state content corresponding to the first peak and the second peak in each one-dimensional spectrum;

[0009] 5) The time of the recorded one-dimensional spectra R0, R1, R2, R3, ..., Rn was used as the horizontal coordinate, and the GTP state content / (GTP state content + GDP state content) was used as the vertical coordinate to fit and draw the GEF action kinetic curve to characterize the activity of the Arf6-specific guanylate exchange factor GEF;

[0010] As described in step 1) 19 The Arf6 recombinant protein labeled with a site-specific non-natural amino acid is a protein in which the 47th amino acid of the Arf6 protein is replaced by 19 F-labeled recombinant protein with trifluoromethylphenylalanine.

[0011] In the above detection method, the Arf6 specific guanine nucleotide exchange factor GEF sample to be detected in the mixed system in step 2) contains GEF and 19The molar ratio of the GDP-state protein of the Arf6 recombinant protein labeled with a non-natural amino acid at the F site is: 1:(100-10000); preferably 1:(500-4800);

[0012] In the mixed system 19 The molar ratio of the GDP-state protein and GTP or its analogues of the Arf6 recombinant protein labeled with F site-specific non-natural amino acids is 1:(5-10); preferably, the GTP analogues include but are not limited to GTPγS.

[0013] In the above detection method, the 19 The Arf6 recombinant protein labeled with a non-natural amino acid at the F site was obtained by the following steps:

[0014] P1) connecting the Arf6 gene into the pBAD / His A expression vector containing a His tag to obtain the pBAD / His A-Arf6 recombinant expression vector;

[0015] P2) mutating the 47th codon of the Arf6 gene in the pBAD / His A-Arf6 recombinant expression vector to TAG, thereby obtaining a pBAD / His A-Arf6 recombinant vector in which the 47th codon of the Arf6 gene is TAG;

[0016] P3) The pBAD / His A-Arf6 recombinant vector obtained in step P2) with the 47th codon of the Arf6 gene being TAG was co-transfected with the pDule-tfmF plasmid into Escherichia coli DH10B competent cells, and the expression of 19 F Site-specific unnatural amino acid-tagged Arf6 recombinant protein.

[0017] In the above detection method, the Arf6-specific guanine nucleotide exchange factor GEF sample to be detected in step 2) is selected from ARNO protein; purified ARNO-Sec7 recombinant protein, which contains amino acids 51-252 of ARNO protein; GEP100; EFA6; cell lysate; organism tissue lysate; or a combination thereof.

[0018] Another aspect of the present invention provides a method for detecting 19 The Arf6 recombinant protein marked with a non-natural amino acid at the F site is expressed by co-transfecting Escherichia coli DH10B competent cells with a pBAD / His A-Arf6 recombinant vector carrying an Arf6 gene with the 47th codon being TAG and a pDule-tfmF plasmid.

[0019] Above 19The amino acid sequence of the Arf6 recombinant protein labeled with a site-specific non-natural amino acid is shown in SEQ ID NO: 7, wherein the amino acid at position 47 is substituted with 19 F-labeled trifluoromethylphenylalanine.

[0020] In another aspect, the present invention also provides a method for expressing the above 19 The recombinant vector combination of Arf6 recombinant protein marked with F site-specific non-natural amino acid comprises pBAD / HisA-Arf6 recombinant vector carrying Arf6 gene with the 47th codon as TAG and pDule-tfmF plasmid.

[0021] In another aspect, the present invention also provides a method for screening a drug having a regulating effect on the activity of Arf6-specific guanine nucleotide exchange factor GEF, which comprises the following steps:

[0022] S1) 19 The GDP state protein of the Arf6 recombinant protein labeled with a non-natural amino acid at the F site is mixed with the Arf6 specific guanine nucleotide exchange factor GEF, and GTP or its analog is added to obtain a first mixture; the first mixture is detected at different time points and a series of its 19 F NMR one-dimensional spectra M1, M2, M3, ..., Mn, the one-dimensional spectrum contains representative 19 The third peak of the GDP state of Arf6 recombinant protein labeled with site-specific non-natural amino acids and the representative 19 F: The fourth peak of the GTP state of the Arf6 recombinant protein labeled with site-specific unnatural amino acids;

[0023] S2) integrating the areas under the third peak and the fourth peak in the one-dimensional spectra M1, M2, M3, ..., Mn, respectively, to obtain the GDP state content and the GTP state content corresponding to the third peak and the fourth peak in each one-dimensional spectrum, respectively; fitting and drawing the first action kinetic curve of GEF by taking the time of the recorded one-dimensional spectra M1, M2, M3, ..., Mn as the abscissa and the GTP state content / (GTP state content+GDP state content) as the ordinate;

[0024] S3) combining the candidate drug with the 19 The GDP state protein of the Arf6 recombinant protein labeled with a non-natural amino acid at the F site and the Arf6 specific guanine nucleotide exchange factor GEF are mixed, and GTP or its analog is added to obtain a second mixture; the second mixture is detected at different time points and a series of its 19 F NMR one-dimensional spectra N1, N2, N3, ..., Nn, the one-dimensional spectrum contains representative 19The fifth peak and representative peak of the GDP state of Arf6 recombinant protein labeled with site-specific non-natural amino acids 19 F: The sixth peak of the GTP state of the Arf6 recombinant protein labeled with site-specific unnatural amino acids;

[0025] S4) integrating the areas under the fifth peak and the sixth peak in the one-dimensional spectra N1, N2, N3, ..., Nn, respectively, to obtain the GDP state content and the GTP state content corresponding to the fifth peak and the sixth peak in each one-dimensional spectrum, respectively; taking the time of the recorded one-dimensional spectra N1, N2, N3, ..., Nn as the abscissa and the GTP state content / (GTP state content+GDP state content) as the ordinate to obtain the second action kinetic curve of GEF;

[0026] S5) comparing the slopes of the first action kinetic curve and the second action kinetic curve corresponding to the same time point on the abscissa to determine the enhancing or inhibiting effect of the candidate drug on the activity of the Arf6-specific guanylate exchange factor GEF;

[0027] Step S1) 19 The Arf6 recombinant protein labeled with a site-specific non-natural amino acid is a protein in which the 47th amino acid of the Arf6 protein is replaced by 19 F-labeled recombinant protein with trifluoromethylphenylalanine;

[0028] The first mixture in step S1) and the second blend in step S3) contain 19 The amounts of the GDP-state protein, the Arf6-specific guanylate exchange factor GEF and GTP or its analogues in the Arf6 recombinant protein labeled with the F site-specific non-natural amino acid are all the same.

[0029] In the above method, the Arf6 specific guanine nucleotide exchange factor GEF and the Arf6 specific guanine nucleotide exchange factor GEF in the first mixture and the second mixture 19 The molar ratio of the GDP-state protein of the Arf6 recombinant protein labeled with a non-natural amino acid at the F site is: 1:(100-10000); preferably 1:(500-4800);

[0030] The first mixture and the second mixture 19 The molar ratio of the GDP-state protein and GTP or its analogues of the Arf6 recombinant protein labeled with F site-specific non-natural amino acids is 1:(5-10); preferably, the GTP analogues include but are not limited to GTPγS.

[0031] In the above method, the Arf6-specific guanine nucleotide exchange factor GEF in step S1) and step S3) is selected from GEF enzyme; ARNO protein; purified ARNO-Sec7 recombinant protein, which contains amino acids 51-252 of ARNO protein; GEP100 protein; EFA6 protein; or a combination thereof.

[0032] Based on the NMR-based Arf6-specific guanine nucleotide exchange factor GEF activity detection method provided by the above technical solution, combined with the structural characteristics of Arf6 protein as a molecular switch and 19 F NMR has unique research advantages. 19 The F-labeled non-natural amino acid tfmF was site-specifically introduced into position 47 of the Arf6 protein to obtain a probe that can be used to detect the activity of the Arf6-specific guanine nucleotide exchange factor GEF. 19 F-labeled molecular probe ( 19 The Arf6 recombinant protein labeled with a specific amino acid at the F site can detect the activity of the Arf6 specific guanine nucleotide exchange factor GEF in simple environments such as in vitro purified GEF enzymes and in biological complex environments such as cell lysates, which is of great significance for studying the biochemical properties of GEF and its functions in normal physiological processes and pathological processes such as tumor invasion and metastasis. On the other hand, the present invention uses the provided probe for detecting the activity of GEF 19 Arf6 recombinant protein labeled with F site-specific amino acids can also be used to screen drugs that have enhancing or inhibitory effects on the activity of Arf6-specific guanylate exchange factor GEF, providing a powerful tool for the development and screening of new therapeutic drugs targeting Arf6 regulatory proteins.

[0033] Compared with the prior art, the present invention has the following beneficial effects.

[0034] 1) Based on the structural information of Arf6 GDP / GTP-bound state in the Protein Data Bank (PDB), the present invention analyzes all phenylalanines that undergo obvious conformational changes in Arf6 during the transition between the two states. 19 F marker, and screening determined that phenylalanine at position 47 could effectively serve as an Arf6 19 F probe labeling site, thereby obtaining a method for detecting the activity of Arf6-specific guanine nucleotide exchange factor GEF 19 F site-specific amino acid-tagged Arf6 recombinant protein, which combines the structural characteristics of Arf6 protein as a molecular switch and 19 F NMR has unique advantages and has been demonstrated through experiments. 19The one-dimensional spectrum of F NMR can detect the activity of GEF without collecting two-dimensional NMR spectra, and has high detection sensitivity and reliability, so the time for collecting spectra can be significantly shortened, and the work efficiency and detection accuracy can be improved; and compared with two-dimensional spectra, the one-dimensional spectra collected by the present invention can detect smaller conformational changes and obtain more topological information or kinetic information.

[0035] 2) Since there is no 19 F nucleus, so the present invention utilizes 19 The Arf6 recombinant protein labeled with F site-specific amino acids is used as a molecular probe for detecting GEF enzyme activity, and there will be no background interference. Therefore, the present invention can be used not only to detect GEF enzyme activity in simple environments such as in vitro purified GEF enzymes, but also to detect GEF enzyme activity in complex biological environments such as cell lysates (normal cell lysates or diseased (cancerous) cell lysates). Therefore, the source range of samples for detection is wider and the detection environment conditions are wider.

[0036] 3) Due to 19 The natural abundance of F nuclei is 100%, the spin quantum number is 1 / 2, and its relative sensitivity is 83% of that of protons. 19 The chemical shift of F is very sensitive to the surrounding environment. 1 H is 100 times wider and the resonance peaks overlap less, so the present invention is more likely to obtain high-resolution spectra without changing the kinetics of the GTPase nucleotide exchange / hydrolysis reaction. BRIEF DESCRIPTION OF THE DRAWINGS

[0037] Figure 1 Arf6-F47 tfmF was purified by size exclusion chromatography and its SDS-PAGE image;

[0038] Figure 2 This is the SDS-PAGE image of ARNO-Sec7 protein after purification by GST resin;

[0039] Figure 3 Arf6-F47 tfmF in GDP and GTP states 19 F NMR one-dimensional spectrum;

[0040] Figure 4 The GDP state of Arf6-F47 tfmF changes to the GTP state over time. 19 F NMR one-dimensional spectrum;

[0041] Figure 5 The kinetic curve of ARNO-Sec7 protein catalyzing the conversion of Arf6-F47 tfmF from GDP state to GTP state in vitro;

[0042] Figure 6 This is the kinetic curve of GEF in the cell lysate of breast cancer cell MDA-MB-231;

[0043] Figure 7 This is the kinetic curve of GEF action in breast cancer tissue lysate. DETAILED DESCRIPTION

[0044] The present invention is further described below in conjunction with specific embodiments. It should be understood that the specific embodiments are only used to further illustrate the present invention, rather than to limit the content of the present invention.

[0045] The methods used in the following examples are conventional methods unless otherwise specified.

[0046] The methods for obtaining various biological materials described in the examples are only provided as an experimental method to achieve the specific disclosed purpose, and should not be construed as limiting the sources of the biological materials of the present invention. In fact, the sources of the biological materials used are extensive, and any biological material that can be obtained without violating laws and moral ethics can be replaced and used according to the instructions in the examples.

[0047] The primers used in the following examples can all be synthesized using existing techniques.

[0048] Embodiment 1: 19 Preparation of Arf6 recombinant protein with site-specific amino acid labeling

[0049] This embodiment uses genetic code expansion technology to 19 F-labeled unnatural amino acids were incorporated into specific sites of Arf6 protein, and expressed and purified to obtain proteins with higher purity and concentration. 19 The Arf6 recombinant protein labeled with F site-specific amino acids specifically includes the following operations.

[0050] 1.1. Construction of Arf6 protein expression vector

[0051] 1.1.1. Using the plasmid carrying the Arf6 gene (synthesized by GENEWIZ Biotechnology Co., Ltd.) as a template, the following upstream and downstream primers (Arf6-F / Arf6-R) and the following PCR reaction program were used to obtain the full-length Arf6 gene by PCR:

[0052] Upstream primer (Arf6-F):

[0053] 5′-GCATGC CTCGAG CTGGTGCCGCGCGGCAGCATGGGGAAGGTGCTAT-3′ (SEQ ID NO: 1);

[0054] Downstream primer (Arf6-R):

[0055] 5′-CGTAGC GAATTC TCAAGATTTGTAGTTAGAGGTTAAC-3′ (SEQ ID NO: 2);

[0056] The underlined parts in the upstream and downstream primers are restriction endonuclease sites XhoⅠ (upstream primer) and EcoRⅠ (downstream primer), respectively, and the italic part in the upstream primer is the thrombin restriction site.

[0057] PCR reaction procedure: Step 1, pre-denaturation, temperature 95°C for 5 min; Step 2, denaturation, temperature 95°C for 30 s; Step 3, annealing, temperature 60°C for 30 s; Step 4, extension, temperature 72°C for 1 min. Steps 2 to 4 were repeated for 35 cycles, and the PCR product was recovered using the Tiangen Agarose Gel Recovery Kit (purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd.).

[0058] 1.1.2. The PCR product and pBAD / His A vector (purchased from NTCC) were double-digested with XhoⅠ and EcoRⅠ, and digested at 37°C for 6 hours. The digested plasmid was recovered using an agarose gel recovery kit (purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd.), and the digested gene fragment was recovered using a centrifugal column-type ordinary DNA product recovery kit (purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd.); then, the double-digested gene fragment was ligated with the pBAD / His A vector linearized after digestion using a ligase (TAKARA ligation kit was used for ligation in a 16°C water bath for 2 hours), and the Arf6 gene fragment was subcloned into the pBAD / His A expression vector containing a His tag. The reaction result system was directly transformed into competent Escherichia coli DH5α cells, and the positive recombinants were detected by colony PCR, and were sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing. The recombinant vector with the correct sequencing result was named pBAD / His A-Arf6 gene expression vector, which is the Arf6 protein expression vector.

[0059] 1.2、 19 Construction of Arf6 recombinant protein expression vector with site-specific amino acid labeling, and expression and purification of recombinant protein

[0060] Based on the structural information of Arf6 GDP / GTP-bound state in the Protein Data Bank (PDB), the inventors used the genetic code expansion technology to replace all phenylalanines in Arf6 that undergo obvious conformational changes in the two state transitions with 19 F-labeled unnatural phenylalanine yielded a series of 19F-labeled Arf6 recombinant protein expression vector, and then these 19 The Arf6 recombinant protein vector labeled with F is expressed and / or the recombinant protein is purified, and then the purified recombinant protein is verified whether it can be used to detect the activity of the Arf6-specific guanine nucleotide exchange factor GEF (mainly including: 19 Whether the F-labeled Arf6 recombinant protein can be successfully expressed, Arf6-GDP and Arf6-GTP 19 Whether the F NMR chemical shifts are distinguishable, and whether the Arf6-GDP state peak gradually decreases and the Arf6-GTP state peak gradually increases after the addition of GEF enzyme to the reaction system, etc., we successfully screened out the Arf6 protein when the 47th phenylalanine was replaced by 19 F-labeled non-natural trifluoromethylphenylalanine can be used as a molecular probe to detect GEF activity. Therefore, the 47th amino acid of the Arf6 protein was selected as the probe labeling site of the molecular probe, and the amino acids (phenylalanine) at other positions were selected as the probe labeling site of the molecular probe. 19 F-specific markers may cause the labeled recombinant protein vector to fail to express or the expression process to terminate prematurely. 19 Steps for incorporation of F-labeled non-natural phenylalanine into amino acid 47 of Arf6 protein.

[0061] 1.2.1. Using the pBAD / His A-Arf6 gene expression vector obtained in step 1.1 above as a template, the codon TTC of the 47th amino acid (F) of the Arf6 protein was mutated to TAG using the following mutation primers (Arf6F47-F and Arf6F47-R) and PCR reaction procedure:

[0062] Upstream primer (Arf6F47-F)

[0063] 5′-CATTCCCACTGTGGGT TAG AACGTGGAGACGGTGACTT-3′ (SEQ ID NO: 3);

[0064] Downstream primer (Arf6F47-R)

[0065] 5′-AAGTCACCGTCTCCACGTT CTA ACCCACAGTGGGAATG-3′ (SEQ ID NO: 4);

[0066] Among them: the underlined part is the mutation site.

[0067] Mutation PCR reaction procedure: Step 1, pre-denaturation, temperature 95°C for 5 min; Step 2, denaturation, temperature 95°C for 1 min; Step 3, annealing, temperature 60°C for 1 min; Step 4, extension, temperature 72°C for 5 min; repeat 20 cycles from step 2 to 4, and recover the PCR product with an agarose gel recovery kit.

[0068] 1.2.2. The recovered PCR products were digested with Dpn I at 37°C for 6 hours. The digested products were recovered using a centrifugal column-type common DNA product recovery kit and directly transformed into competent Escherichia coli DH5α cells, which were sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing. The correct recombinant vector in the sequencing result was the pBAD / HisA vector in which the 47th codon of the Arf6 gene was TAG.

[0069] 1.2.3. The pBAD / His A vector with TAG as the codon at position 47 of the Arf6 gene was combined with the pDule-tfmF plasmid (commercially available from NTCC, which contains tetracycline resistance and encodes tRNA CUA and an aminoacyl-tRNA synthetase that specifically recognizes and aminoacylates tRNA CUA and trifluoromethylphenylalanine (L-4-trifluoromethylphenylalanine; tfmF, i.e. 19 F-labeled non-natural phenylalanine), tfmF was introduced into the 47th amino acid site of Arf6 protein) and co-transformed into Escherichia coli expression strain DH10B competent cells (experiments have shown that when co-transformed 19 F The Top10 competent cells commonly used in the expression of recombinant proteins labeled with non-natural amino acids are not expressed in the two vectors), and the expression and purification are obtained 19 The Arf6 recombinant protein with F site-specific amino acid labeling is named Arf6-F47 tfmF protein, which specifically includes the following operations.

[0070] (1) The pBAD / His A vector containing TAG at the 47th codon of the Arf6 gene and the pDule-tfmF plasmid were co-transformed into the overnight culture of the E. coli expression strain DH10B competent cells at a 4% inoculum, and then transferred to freshly prepared 2×YT medium containing ampicillin (100 μg / ml), streptomycin (50 μg / ml) and tetracycline (25 μg / ml). The cells were cultured at 37°C with shaking at 210 rpm for about 2.5 hours, and the OD value was measured. 600 , reaching 0.6, 100× trifluoromethylphenylalanine (tfmF) was added to the culture medium, and the OD 600=0.8, 0.2% arabinose was added to induce protein expression, and the mixture was induced at 37°C for 8 hours. The cells were collected and resuspended in lysis buffer (20 mM Tris, 500 mM NaCl, 5 mM MgCl2, 5 mM β-ME, pH 8.0), and the cells were lysed by ultrasonication and the supernatant was collected by centrifugation.

[0071] (2) The target protein in the supernatant was purified by nickel column affinity chromatography (i.e., the 47th amino acid of Arf6 protein was 19 F-labeled tfmF, named Arf6-F47 tfmF protein), the purified His fusion protein Arf6-F47 tfmF was digested with thrombin, the digestion conditions were: temperature of 4-20°C, digestion during dialysis, dialysis buffer of 20mM Tris, 300mM NaCl, 5mMβ-ME, pH7.5-8.0, and digestion for 12-24 hours; nickel column affinity chromatography and molecular exclusion chromatography were used to further purify the Arf6-F47 tfmF protein.

[0072] The purification results were detected by 12% SDS-PAGE electrophoresis. Figure 1 It can be seen that the purified Arf6-F47 tfmF protein with high purity was obtained, that is, the 47th amino acid of the Arf6 protein is 19 The amino acid sequence of the recombinant protein of tfmF labeled with F is shown below, where the bold underlined amino acid (F) is 19 F-labeled trifluoromethylphenylalanine.

[0073]

[0074] Example 2: Preparation of guanine nucleotide exchange factor (GEF) ARNO-Sec7 protein (used as Arf6-specific guanine nucleotide exchange factor GEF enzyme)

[0075] 2.1、Construction of ARNO-Sec7 prokaryotic expression vector

[0076] 2.1.1. The ARNO-Sec7 domain is the 51st to 252nd amino acids of the ARNO protein, and the coding gene is 609 bp in total. The nucleotide sequence was synthesized by Nanjing GenScript Biotechnology Co., Ltd. The ARNO-Sec7 gene was obtained by PCR using the following primers (pGEXARNOEcoR-F and pGEXARNOTGAXho-R) and PCR reaction program. The primer sequences are as follows:

[0077] Upstream primer: (pGEXARNOEcoR-F)

[0078] TCGGCA GAATTC GAGGCCAATGAGGGCAGTAAGACCT (SEQ ID NO: 5);

[0079] Downstream primer: (pGEXARNOTGAXho-R)

[0080] CGTACG CTCGAG TCAGTCATTCCCGTCATCCTCA (SEQ ID NO: 6);

[0081] Among them: the underlined parts are restriction endonuclease sites EcoRⅠ (upstream primer) and XhoⅠ (downstream primer).

[0082] PCR reaction procedure: Step 1, pre-denaturation, temperature 95℃ for 5min; Step 2, denaturation, temperature 95℃ for 30s; Step 3, annealing, temperature 60℃ for 30s; Step 4, extension, temperature 72℃ for 1min. Repeat steps 2 to 4 for 35 cycles, and recover the PCR product using an agarose gel recovery kit.

[0083] 2.1.2. Use EcoRⅠ and XhoⅠ double restriction PCR to recover the product and expression vector pGEX-4T-1 (purchased from NTCC), digest at 37℃ for 6 hours, recover the digested plasmid with agarose gel recovery kit, and recover the digested gene fragment with centrifugal column type ordinary DNA product recovery kit; then, use TAKARA ligation kit to connect the double restriction gene fragment and the linearized vector in a 16℃ water bath for 2 hours to obtain the prokaryotic expression vector of ARNO-Sec7, named pGEX-4T-1-ARNOSec7, and detect positive recombinants with colony PCR, which are sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing.

[0084] 2.2. ARNO-Sec7 recombinant protein expression and purification

[0085] The correctly sequenced pGEX-4T-1-ARNOSec7 was transformed into competent cells of the E. coli expression strain BL21 (DE3). The overnight culture was transferred to freshly prepared 2×YT medium containing ampicillin (100 μg / ml) at a 1% inoculum volume and cultured at 37°C with shaking at 200 rpm for about 3 hours. The OD 600 , reaching 0.5; lower the shaker temperature to 16°C and continue shaking culture until OD 600Reach 0.8; add IPTG to a final concentration of 0.25mM, shake and culture for 20-24 hours, collect the bacteria and resuspend them in lysis buffer (20mM Tris, 300mM NaCl, pH 8.0); ultrasonic lysis and cell disruption, centrifuge at 12000rpm at 4℃ for 40min; take the supernatant, bind to GST resin (pre-equilibrated with binding buffer, the binding buffer is the same as the lysis buffer), bind at 4℃ for 18-20 hours; collect the permeate, rinse the resin with 10 column volumes of binding buffer to remove impurities, elute the target protein with 5 column volumes of binding buffer containing 20mM reduced glutathione, collect the eluate, and obtain GST-ARNO-Sec7 fusion protein. Figure 2 The SDS-PAGE image of the fusion protein is shown. The fusion protein was dialyzed against a replacement buffer (20 mM Tris, 150 mM NaCl, 1 mM MgCl2, 2 mM β-ME, pH 8.0). After concentration, the concentration was measured and the protein was frozen at -80°C. The resulting ARNO-Sec7 recombinant protein was an Arf6-specific guanine nucleotide exchange factor GEF.

[0086] Example 3: Detection of the transition between the GDP state and the GTP state of the Arf6-F47 tfmF protein

[0087] This example uses the Arf6-F47 tfmF protein prepared in Example 1 and the ARNO-Sec7 recombinant protein prepared in Example 2 to verify the Arf6-GDP state and Arf6-GTP state. 19 Whether the F NMR peaks appear at different chemical shifts, and verify whether the Arf6-GDP state can be converted into the Arf6-GTP state under the catalysis of the GEF enzyme, so as to prove that the Arf6-F47 tfmF protein prepared in Example 1 can be used as a labeled probe for detecting the GEF enzyme. Specifically, the following steps are included.

[0088] 3.1. Preparation of Arf6-F47 tfmF protein mother solution: The Arf6-F47 tfmF protein prepared in Example 1 was dissolved in a solution containing 20 mM Tris, 150 mM NaCl, and 5 mM β-ME (pH 7.5) to prepare Arf6-F47 tfmF protein mother solution.

[0089] 3.2. Mix equal volumes of Arf6-F47 tfmF protein stock solution (20mM Tris, 150mM NaCl, 5mM β-ME, pH7.5) and GDP stock solution (20mM Tris, 150mM NaCl, 10mM EDTA-Na, 5mM GDP (purchased from Shanghai Shenggong Biotechnology Co., Ltd.), 5mM β-ME, pH 7.5), incubate at 37°C for 1 hour, add MgCl2 buffer (20mM Tris, 150mM NaCl, 1M MgCl2, pH7.5) to terminate the reaction and the MgCl2 concentration is 10mM; then replace the reaction system buffer with 20mMTris, 150mM NaCl, 5mM MgCl2, 5mM β-ME, pH7.2 to obtain Arf6-F47 tfmF GDP state protein.

[0090] 3.3. Take Arf6-F47 tfmF GDP protein and 250× internal reference TFA solution (20mM Tris, 100mM NaCl, 2.5mM TFA, pH7.5), add D2O, and record its 19 F NMR one-dimensional spectrum.

[0091] 3.4. After step 3.3, an excess of the ARNO-Sec7 protein prepared in Example 2 and GTP (purchased from Shanghai Shenggong Biotechnology Co., Ltd., the molar ratio of the Arf6-F47 tfmF GDP state protein to the GTP added can be 1:(5-10)) were added to the solution, and the solution was left overnight until all the Arf6-F47 tfmF GDP state proteins were converted to the Arf6-F47 tfmF GTP state, and then the results were recorded. 19 F NMR one-dimensional spectrum.

[0092] The results are as follows Figure 3 As shown, it can be seen that the prepared Arf6-F47 tfmF GDP state can be completely converted into Arf6-F47 tfmF GTP state under the action of ARNO-Sec7 protein (GEF enzyme) prepared in Example 2, and the GDP state and GTP state of Arf6-F47 tfmF correspond to 19 The F NMR chemical shifts are -61.635 and -61.873 ppm, respectively. 19 The Arf6-F47 tfmF GDP state and the Arf6-F47 tfmF GTP state were clearly distinguished in the F NMR one-dimensional spectrum. 19The Arf6-F47 tfmF protein labeled with F can be used to detect the activity of the Arf6 regulatory protein, and the ARNO-Sec7 protein prepared in Example 2 can indeed exert the activity of the GEF enzyme, converting the Arf6-F47 tfmF GDP state to the Arf6-F47 tfmF GTP state, and the Arf6-F47 tfmF GDP state and the Arf6-F47 tfmF GTP state are 19 The chemical shifts in the 1D F NMR spectra are clearly different.

[0093] Example 4: In vitro detection of Arf6-related GEF enzyme activity

[0094] In this example, the ARNO-Sec7 protein prepared in Example 2 simulates the Arf6-related GEF, and the Arf6-F47 tfmF protein prepared in Example 1 is used as a molecular probe. 19 The activity of ARNO-Sec7 protein (Arf6-related GEF) was detected in vitro by F NMR, which specifically included the following steps.

[0095] 4.1. The ARNO-Sec7 protein prepared in Example 2 was added to the Arf6-F47 tfmF GDP state protein system prepared in Example 3, and GTP was added to make the molar ratio of ARNO-Sec7 protein to Arf6-F47 tfmF GDP state protein 1:500, 1:1200, 1:2400 and 1:4800, respectively. The molar ratio of the Arf6-F47 tfmF GDP state protein to the added GTP amount can be 1:(5-10). The above four systems were respectively detected and recorded a series of 19 F NMR one-dimensional spectrum. A series of samples with a molar ratio of ARNO-Sec7 protein to Arf6-F47 tfmF GDP protein of 1:2400 19 The results of the F NMR one-dimensional spectrum are shown in Figure 4 (The vertical axis represents time (in minutes)). It can be seen that after adding ARNO-Sec7 protein to the Arf6-F47 tfmF GDP state protein system, the Arf6-F47 tfmF GDP state gradually changes to the GTP state over time. 19 The one-dimensional F NMR spectrum can reflect the dynamic change process of the transformation from the Arf6-F47 tfmF GDP state to the Arf6-F47tfmFGTP state in the system in real time.

[0096] 4.2. A series of records 19By integrating the areas under the peaks corresponding to the Arf6-F47 tfmF GDP state and the Arf6-F47 tfmFGTP state in the F NMR one-dimensional spectrum, the changes in the relative contents of the Arf6-F47 tfmF GDP state and the Arf6-F47 tfmF GTP state in the system over time can be obtained. Therefore, a curve with time as the abscissa and Arf6-F47 tfmF GTP state content / (Arf6-F47 tfmF GTP state content + Arf6-F47 tfmF GDP state content) (GTP / (GTP+GDP)) as the ordinate can be drawn, that is, the kinetic curve of the ARNO-Sec7 protein catalyzing the transformation of the Arf6-F47 tfmFGDP state to the GTP state can be obtained, and then the exchange rate of ARNO-Sec7 can be obtained. The results are shown in FIG. Figure 5 As shown. It can be seen that in the system containing different molar ratios of ARNO-Sec7 protein and Arf6-F47 tfmF GDP state protein in vitro, ARNO-Sec7 protein can play the role of GEF enzyme, gradually converting Arf6-F47 tfmF GDP state protein into Arf6-F47 tfmF GTP state protein over time, and can be 19 The F NMR one-dimensional spectrum is recorded in real time, and the kinetic curves of the ARNO-Sec7 protein in different systems are obtained, which can reflect the relative activity of the ARNO-Sec7 protein as a GEF enzyme in a simple environment. For example, it can be expressed by the slope of the kinetic curve obtained by fitting under a certain molar ratio of ARNO-Sec7 protein to Arf6-F47 tfmF GDP state protein.

[0097] Example 5: Detection of Arf6-related GEF activity in breast cancer cells

[0098] This example uses the 19 F-labeled Arf6-F47 tfmF was used as a molecular probe to detect the activity of Arf6-related GEF in breast cancer cells, specifically including the following steps:

[0099] 5.1. Human breast cancer cells MDA-MB-231 (purchased from ATCC) were cultured at 1.5×10 6 The cells were inoculated in a 10 mm cell culture dish in DMEM (containing 10% FBS, 100 U / mL penicillin and 100 μg / mL streptomycin) and cultured in a 37°C incubator until the cell confluence reached 90%. The cells (2×10 8The cells were lysed on ice for 15 min with NP-40 lysis buffer (NP-40 lysis buffer: 50 mM Tris-HCl pH 8.0, 150 mM NaCl, 1% NP-40), centrifuged at 13000 rpm for 15 min at 4°C, the supernatant was taken, and the total protein concentration in the supernatant was detected by BCA method.

[0100] 5.2. Detect and record the Arf6-F47 tfmF GDP protein solution prepared in Example 3 19 F NMR one-dimensional spectrum.

[0101] 5.3. According to the mass ratio of total protein in the lysate to Arf6-F47 tfmF GDP protein of 1:1.2 (can be 1:(1-2)), the above-mentioned supernatant lysate and 5 mM GTPγS (purchased from Sigma, a GTP analog. Since GAP enzyme exists in cells, the addition of GTPγS can eliminate the interference of GAP enzyme. The molar ratio of the amount of Arf6-F47tfmF GDP protein to the amount of GTPγS added can be 1:(5-10)) are added to the Arf6-F47 tfmF GDP protein solution to obtain a mixed solution; the mixed solution is detected and a series of records are recorded over time. 19 F NMR one-dimensional spectra, respectively for this series 19 The areas under the peaks corresponding to the GDP state of Arf6-F47 tfmF and the GTPγS state of Arf6-F47 tfmF in the one-dimensional F NMR spectrum were integrated and fitted to obtain the kinetic curve of the GEF enzyme in breast cancer cells MDA-MB-231.

[0102] The results are as follows Figure 6 As shown, the ordinate is represented by Arf6-F47 tfmF GTPγS state content / (Arf6-F47 tfmF GTPγS state content+Arf6-F47 tfmF GDP state content)(Arf6-GTPγS / (Arf6-GTPγS+GDP)), which shows that GEF enzyme exists in the lysate of breast cancer cells MDA-MB-231, and over time, under the action of GEF enzyme in the lysate of breast cancer cells MDA-MB-231, Arf6-F47 tfmF GDP state gradually transforms to Arf6-F47 tfmF GTPγS state with a higher transformation rate, which proves that breast cancer cells MDA-MB-231 have higher GEF enzyme activity and are related to their high invasiveness.

[0103] Example 6: Detection of Arf6-related GEF activity in breast cancer tissue

[0104] This example uses the19 F-labeled Arf6-F47 tfmF was used as a molecular probe to detect the activity of Arf6-related GEF in breast cancer tissues, which specifically included the following steps:

[0105] 6.1. Fresh breast cancer tissues were frozen in liquid nitrogen and taken out from liquid nitrogen before the experiment. NP-40 lysis buffer (50 mM Tris-HCl pH 8.0, 150 mM NaCl, 1% NP-40) was added and ground on ice with a grinder. The tissues were centrifuged at 13000 rpm and 4°C for 15 min. The supernatant was taken and the total protein concentration in the supernatant was detected by BCA method.

[0106] 6.2. Detect and record the Arf6-F47 tfmF GDP protein solution prepared in Example 3 19 F NMR one-dimensional spectrum.

[0107] 6.3. Add the above-mentioned supernatant lysate and 5 mM GTPγS to the Arf6-F47 tfmF GDP protein solution at a mass ratio of 1:1.2 to the total protein in the lysate to the Arf6-F47 tfmF GDP protein solution to obtain a mixed solution; detect and record a series of 19 F NMR one-dimensional spectra, respectively for this series 19 The peaks corresponding to the GDP state of Arf6-F47 tfmF and the GTPγS state of Arf6-F47 tfmF in the one-dimensional F NMR spectrum were integrated and fitted to obtain the kinetic curve of the GEF enzyme in breast cancer tissue.

[0108] The results are as follows Figure 7 As shown, the ordinate is expressed as Arf6-F47 tfmF GTPγS state content / (Arf6-F47 tfmF GTPγS state content+Arf6-F47 tfmF GDP state content)(Arf6-GTPγS / (Arf6-GTPγS+GDP)), which shows that GEF enzyme exists in the lysate of breast cancer tissue, and over time, under the action of GEF enzyme in the lysate of breast cancer tissue, Arf6-F47 tfmF GDP state gradually transforms to Arf6-F47 tfmF GTPγS state with a higher transformation rate, which proves that GEF enzyme in breast cancer tissue has higher activity.

[0109] From the results of Examples 4 to 6, it can be seen that the method for detecting the activity of the Arf6-specific guanine nucleotide exchange factor GEF provided by the present invention can be used not only to detect the activity of the GEF enzyme in a simple environment such as an in vitro purified GEF enzyme system, but also to detect the activity of the GEF enzyme in a biologically complex environment such as a diseased cell lysate and a diseased tissue. Therefore, the scope of application of this method is very wide; and the recorded 19 The F NMR one-dimensional spectrum monitors the process and rate of the transformation of the Arf6-F47tfmF GDP state to the Arf6-F47 tfmF GTP state in real time. Therefore, the system can screen drugs that have a regulating (enhancing or inhibiting) effect on the activity of the Arf6-specific guanine nucleotide exchange factor GEF according to the rate of transformation of the Arf6-F47tfmF GDP state to the Arf6-F47 tfmF GTP state. The specific operation is as follows:

[0110] S1) 19 The GDP state of the Arf6 recombinant protein labeled with a site-specific non-natural amino acid (i.e., the Arf6-F47tfmF GDP state) is mixed with the Arf6-specific guanylate exchange factor GEF (which may be the ARNO-Sec7 protein prepared in Example 2, in which case there is no GAP enzyme in the system, and GTP or GTPγS may be added to the system; or it may be ARNO protein, guanine nucleotide exchange protein 100 (GEP100) or EFA-6 protein (a protein that regulates axon regeneration), etc., in which case there is no GAP enzyme in the system, and GTP or GTPγS may be added to the system) to obtain a first mixture; the first mixture is detected and a series of its 19 F NMR one-dimensional spectra M1, M2, M3, ..., Mn. These one-dimensional spectra contain representative 19 The third peak of the GDP state of Arf6 recombinant protein labeled with site-specific non-natural amino acids and the representative 19 F: The fourth peak of the GTP state of the Arf6 recombinant protein labeled with site-specific unnatural amino acids;

[0111] S2) integrating the areas under the third peak and the fourth peak in the one-dimensional spectra M1, M2, M3, ..., Mn, respectively, to obtain the Arf6-F47 tfmF GDP state content (relative content, the same below) and the Arf6-F47 tfmF GTP state content corresponding to the third peak and the fourth peak in each one-dimensional spectrum, respectively; taking the time of the recorded one-dimensional spectra M1, M2, M3, ..., Mn as the abscissa and the Arf6-F47 tfmF GTP state content / (Arf6-F47 tfmF GTP state content+Arf6-F47 tfmF GDP state content) as the ordinate to plot the first action kinetic curve of GEF;

[0112] S3) adding the candidate drug (the amount of which is usually added so that the concentration of the drug is within the safe concentration range during clinical use, which can be easily determined by those skilled in the art, such as through in vitro cell culture experiments) to the 19 The GDP state of the Arf6 recombinant protein labeled with a non-natural amino acid at the F site and the Arf6 specific guanine nucleotide exchange factor GEF (same as step S1) are mixed, and an equal amount of GTP or GTPγS as in step S1 is added to obtain a second mixture; a series of changes in the second mixture are detected and recorded over time. 19 F NMR one-dimensional spectra N1, N2, N3, ..., Nn, these one-dimensional spectra contain representative 19 The fifth peak and representative peak of the GDP state of Arf6 recombinant protein labeled with site-specific non-natural amino acids 19 F: The sixth peak of the GTP state of the Arf6 recombinant protein labeled with site-specific unnatural amino acids;

[0113] S4) integrating the areas under the fifth peak and the sixth peak in the one-dimensional spectra N1, N2, N3, ..., Nn, respectively, to obtain the Arf6-F47 tfmF GDP state content and the Arf6-F47 tfmF GTP state content corresponding to the fifth peak and the sixth peak in each one-dimensional spectrum, respectively; taking the time of the recorded one-dimensional spectra N1, N2, N3, ..., Nn as the abscissa and the Arf6-F47 tfmF GTP state content / (Arf6-F47 tfmF GTP state content+Arf6-F47 tfmF GDP state content) as the ordinate to plot the second action kinetic curve of GEF;

[0114] S5) comparing the slopes of the first action kinetic curve and the second action kinetic curve corresponding to the same time point on the abscissa (preferably comparing the initial slopes of the first action kinetic curve and the second action kinetic curve), the judgment criteria are:

[0115] If the former is significantly greater than the latter, the candidate drug inhibits the activity of the Arf6-specific guanylate exchange factor GEF;

[0116] If the former is significantly less than the latter, the candidate drug enhances the activity of the Arf6-specific guanylate exchange factor GEF;

[0117] If there is no significant difference between the former and the latter, the candidate drug has no effect on the activity of the Arf6-specific guanylate exchange factor GEF.

[0118] The first mixture in step S1 and the second blend in step S3 contain 19 The amount of the GDP state protein of the Arf6 recombinant protein labeled with the non-natural amino acid at the F site, the Arf6 specific guanylate exchange factor GEF and GTP or its analogues are the same, and the added amount can satisfy: the Arf6 specific guanylate exchange factor GEF and GTP or its analogues in the first mixture and the second mixture are the same. 19 The molar ratio of the Arf6 recombinant protein labeled with the non-natural amino acid at the F site to the GDP state protein is: 1: (100-10000); preferably 1: (500-4800); and the first mixture and the second mixture 19 The molar ratio of the GDP state protein and GTP or its analogues of the Arf6 recombinant protein labeled with F site-specific non-natural amino acids is 1: (5-10).

[0119] Finally, it should be noted that the above is only a preferred embodiment of the present invention and is not intended to limit the present invention. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art can still modify the technical solutions described in the aforementioned embodiments or replace some of the technical features therein by equivalents. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention. Sequence Listing <110> Hefei Institutes of Physical Science, Chinese Academy of Sciences <120> An NMR-based method for detecting the activity of Arf6-specific guanylate exchange factor GEF and its application <160> 7 <170> SIPOSequenceListing 1.0 <210> 1 <211> 46 <212> DNA <213> Artificial Sequence <400> 1 gcatgcctcg agctggtgcc gcgcggcagc atggggaagg tgctat 46 <210> 2 <211> 37 <212> DNA <213> Artificial Sequence <400> 2 cgtagcgaat tctcaagatt tgtagttaga ggttaac 37 <210> 3 <211> 38 <212> DNA <213> Artificial Sequence <400> 3 cattcccact gtgggttaga acgtggagac ggtgactt 38 <210> 4 <211> 38 <212> DNA <213> Artificial Sequence <400> 4 aagtcaccgt ctccacgttc taacccacag tgggaatg 38 <210> 5 <211> 37 <212> DNA <213> Artificial Sequence <400> 5 tcggcagaat tcgaggccaa tgagggcagt aagacct 37 <210> 6 <211> 34 <212> DNA <213> Artificial Sequence <400> 6 cgtacgctcg agtcagtcat tcccgtcatc ctca 34 <210> 7 <211> 175 <212> PRT <213> Artificial Sequence <400> 7 Met Gly Lys Val Leu Ser Lys Ile Phe Gly Asn Lys Glu Met Arg Ile 1 5 10 15 Leu Met Leu Gly Leu Asp Ala Ala Gly Lys Thr Thr Ile Leu Tyr Lys 20 25 30 Leu Lys Leu Gly Gln Ser Val Thr Thr Ile Pro Thr Val Gly Phe Asn 35 40 45 Val Glu Thr Val Thr Tyr Lys Asn Val Lys Phe Asn Val Trp Asp Val 50 55 60 Gly Gly Gln Asp Lys Ile Arg Pro Leu Trp Arg His Tyr Tyr Thr Gly 65 70 75 80 Thr Gln Gly Leu Ile Phe Val Val Asp Cys Ala Asp Arg Asp Arg Ile 85 90 95 Asp Glu Ala Arg Gln Glu Leu His Arg Ile Ile Asn Asp Arg Glu Met 100 105 110 Arg Asp Ala Ile Ile Leu Ile Phe Ala Asn Lys Gln Asp Leu Pro Asp 115 120 125 Ala Met Lys Pro His Glu Ile Gln Glu Lys Leu Gly Leu Thr Arg Ile 130 135 140 Arg Asp Arg Asn Trp Tyr Val Gln Pro Ser Cys Ala Thr Ser Gly Asp 145 150 155 160 Gly Leu Tyr Glu Gly Leu Thr Trp Leu Thr Ser Asn Tyr Lys Ser 165 170 175

Claims

1. A method for detecting the activity of Arf6-specific guanine nucleotide exchange factor GEF based on NMR, comprising the following steps: 1) Provide a 19 F site-specific non-natural amino acid labeled Arf6 recombinant protein GDP state protein, detection and recording 19 F NMR one-dimensional spectrum R0; 2) Mix the Arf6-specific guanine nucleotide exchange factor GEF sample to be tested with the 19 The GDP-state protein of Arf6 recombinant protein labeled with a non-natural amino acid at the F site is mixed, and GTP or its analog is added to obtain a mixed system; 3) Detect and record a series of 19 F NMR one-dimensional spectra R1, R2, R3, ..., Rn, the one-dimensional spectrum contains representative 19 The first peak and representative peak of the GDP state of Arf6 recombinant protein labeled with site-specific unnatural amino acids 19 F. The second spectrum peak of the GTP state of the Arf6 recombinant protein labeled with a site-specific non-natural amino acid, wherein the GTP state is obtained by converting the GDP state via GEF; 4) integrating the areas under the first peak and the second peak in the one-dimensional spectra R0, R1, R2, R3, ..., Rn, respectively, wherein the area under the first peak represents the GDP state content, and the area under the second peak represents the GTP state content, and obtaining the GDP state content and the GTP state content corresponding to the first peak and the second peak in each one-dimensional spectrum; 5) The time of the recorded one-dimensional spectra R0, R1, R2, R3, ..., Rn was used as the horizontal coordinate, and the GTP state content / (GTP state content + GDP state content) was used as the vertical coordinate to fit and draw the GEF action kinetic curve to characterize the activity of the Arf6-specific guanylate exchange factor GEF; As described in step 1) 19 The Arf6 recombinant protein labeled with a site-specific non-natural amino acid is a protein in which the 47th amino acid of the Arf6 protein is replaced by 19 F-labeled recombinant protein with trifluoromethylphenylalanine; Said 19 The Arf6 recombinant protein labeled with a non-natural amino acid at the F site was obtained by the following steps: P1) Connect the Arf6 gene into the pBAD / His A expression vector containing the His tag to obtain the pBAD / His A-Arf6 recombinant expression vector; P2) mutating the 47th codon of the Arf6 gene in the pBAD / His A-Arf6 recombinant expression vector to TAG, thereby obtaining the pBAD / His A-Arf6 recombinant vector in which the 47th codon of the Arf6 gene is TAG; P3) The pBAD / His A-Arf6 recombinant vector obtained in step P2) with the 47th codon of the Arf6 gene being TAG was co-transfected with the pDule-tfmF plasmid into Escherichia coli DH10B competent cells, and the expression of 19 F Site-specific unnatural amino acid-tagged Arf6 recombinant protein.

2. The activity detection method according to claim 1, wherein the Arf6 specific guanine nucleotide exchange factor GEF sample to be detected in the mixed system in step 2) contains GEF and 19 The molar ratio of the GDP-state protein of the Arf6 recombinant protein labeled with F site-specific non-natural amino acids is: 1:(100-10000); In the mixed system 19 The molar ratio of the GDP-state protein and GTP or its analogues of the Arf6 recombinant protein labeled with F site-specific non-natural amino acids is 1:(5-10).

3. The activity detection method according to claim 2, wherein the Arf6 specific guanine nucleotide exchange factor GEF sample to be detected in the mixed system in step 2) contains GEF and 19 The molar ratio of the GDP-state protein of the Arf6 recombinant protein labeled with a site-specific non-natural amino acid is 1:(500-4800); and / or GTP analogs include GTPyS.

4. The activity detection method according to any one of claims 1-3, wherein the Arf6-specific guanine nucleotide exchange factor GEF sample to be detected in step 2) is selected from ARNO protein, purified ARNO-Sec7 recombinant protein containing amino acids 51-252 of ARNO protein, GEP100, EFA6, cell lysate, organism tissue lysate, or a combination thereof.

5. A method for detecting the activity of the Arf6-specific guanine nucleotide exchange factor GEF according to any one of claims 1 to 4 19 The Arf6 recombinant protein marked with a non-natural amino acid at the F site is expressed by co-transfecting Escherichia coli DH10B competent cells with a pBAD / His A-Arf6 recombinant vector carrying an Arf6 gene with the 47th codon being TAG and a pDule-tfmF plasmid.

6. According to claim 5 19 The amino acid sequence of the Arf6 recombinant protein labeled with a non-natural amino acid at the F site is shown in SEQ ID NO: 7, wherein the 47th amino acid is 19 F-labeled trifluoromethylphenylalanine.

7. A method for expressing the method of claim 5 or 6 19 The recombinant vector combination of Arf6 recombinant protein marked with F site-specific non-natural amino acid comprises pBAD / His A-Arf6 recombinant vector carrying Arf6 gene with the 47th codon as TAG and pDule-tfmF plasmid.

8. A method for screening a drug having a regulatory effect on the activity of Arf6-specific guanylate exchange factor GEF, comprising the following steps: S1) 19 The GDP state protein of the Arf6 recombinant protein labeled with a non-natural amino acid at the F site is mixed with the Arf6 specific guanine nucleotide exchange factor GEF, and GTP or its analog is added to obtain a first mixture; the first mixture is detected at different time points and a series of its 19 F NMR one-dimensional spectra M1, M2, M3, ..., Mn, the one-dimensional spectrum contains representative 19 The third peak of the GDP state of Arf6 recombinant protein labeled with site-specific non-natural amino acids and the representative 19 F: The fourth peak of the GTP state of the Arf6 recombinant protein labeled with site-specific unnatural amino acids; S2) integrating the areas under the third peak and the fourth peak in the one-dimensional spectra M1, M2, M3, ..., Mn, respectively, and obtaining the GDP state content and the GTP state content corresponding to the third peak and the fourth peak in each one-dimensional spectrum, respectively; taking the time of the recorded one-dimensional spectra M1, M2, M3, ..., Mn as the abscissa and the GTP state content / (GTP state content + GDP state content) as the ordinate to fit and draw the first action kinetic curve of GEF; S3) The candidate drug is combined with the one described in step S1) 19 The GDP state protein of the Arf6 recombinant protein labeled with a non-natural amino acid at the F site and the Arf6 specific guanine nucleotide exchange factor GEF are mixed, and GTP or its analog is added to obtain a second mixture; the second mixture is detected at different time points and a series of its 19 F NMR one-dimensional spectra N1, N2, N3, ..., Nn, the one-dimensional spectrum contains representative 19 The fifth peak and representative peak of the GDP state of Arf6 recombinant protein labeled with site-specific non-natural amino acids 19 F: The sixth peak of the GTP state of the Arf6 recombinant protein labeled with site-specific unnatural amino acids; S4) integrating the areas under the fifth peak and the sixth peak in the one-dimensional spectra N1, N2, N3, ..., Nn, respectively, to obtain the GDP state content and the GTP state content corresponding to the fifth peak and the sixth peak in each one-dimensional spectrum, respectively; plotting the second action kinetic curve of GEF with the time of the recorded one-dimensional spectra N1, N2, N3, ..., Nn as the abscissa and the GTP state content / (GTP state content + GDP state content) as the ordinate; S5) comparing the slopes of the first kinetic curve and the second kinetic curve corresponding to the same time point on the abscissa to determine the enhancing or inhibiting effect of the candidate drug on the activity of the Arf6-specific guanylate exchange factor GEF; Step S1) 19 The Arf6 recombinant protein labeled with a site-specific non-natural amino acid is a protein in which the 47th amino acid of the Arf6 protein is replaced by 19 F-labeled recombinant protein with trifluoromethylphenylalanine; The first mixture in step S1) and the second blend in step S3) contain 19 The amounts of the GDP-state protein, the Arf6-specific guanylate exchange factor GEF, and GTP or its analogs of the Arf6 recombinant protein labeled with the F site-specific non-natural amino acid were all the same; Said 19 The Arf6 recombinant protein labeled with a non-natural amino acid at the F site was obtained by the following steps: P1) Connect the Arf6 gene into the pBAD / His A expression vector containing the His tag to obtain the pBAD / His A-Arf6 recombinant expression vector; P2) mutating the 47th codon of the Arf6 gene in the pBAD / His A-Arf6 recombinant expression vector to TAG, thereby obtaining the pBAD / His A-Arf6 recombinant vector in which the 47th codon of the Arf6 gene is TAG; P3) The pBAD / His A-Arf6 recombinant vector obtained in step P2) with the 47th codon of the Arf6 gene being TAG was co-transfected with the pDule-tfmF plasmid into Escherichia coli DH10B competent cells, and the expression of 19 F Site-specific unnatural amino acid-tagged Arf6 recombinant protein.

9. The method according to claim 8, wherein the first mixture and the second mixture contain Arf6-specific guanylate exchange factor GEF and 19 The molar ratio of the GDP-state protein of the Arf6 recombinant protein labeled with F site-specific non-natural amino acids is: 1:(100-10000); The first mixture and the second mixture 19 The molar ratio of the GDP-state protein and GTP or its analogues of the Arf6 recombinant protein labeled with F site-specific non-natural amino acids is 1:(5-10).

10. The method according to claim 9, wherein the first mixture and the second mixture contain Arf6-specific guanine nucleotide exchange factor GEF and 19 The molar ratio of the GDP-state protein of the Arf6 recombinant protein labeled with a site-specific non-natural amino acid is: 1: (500-4800); and / or GTP analogs include GTPyS.

11. The method according to any one of claims 8-10, wherein the Arf6-specific guanine nucleotide exchange factor GEF in step S1) and step S3) is selected from ARNO protein, purified ARNO-Sec7 recombinant protein comprising amino acids 51-252 of ARNO protein, GEP100 protein, EFA6 protein, or a combination thereof.

Images