Compositions and methods for quantifying recombining vector nucleic acid integration

By using quantitative PCR and a specific oligonucleotide primer-probe combination, the problem of retroviral vector integration was solved, enabling accurate, rapid, and economical quantification and identification of vector nucleic acid integration, and improving the accuracy of transduction efficiency monitoring.

CN115768899BActive Publication Date: 2026-03-27JANSSEN BIOTECH INC
View PDF 13 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2021-03-08
Publication Date
2026-03-27

AI Technical Summary

Technical Problem

Existing technologies struggle to accurately, quickly, and economically determine whether a retroviral vector has successfully integrated into the host genome and the frequency of integration. Furthermore, existing methods cannot distinguish between free, unincorporated vectors and integrated vectors.

Method used

Using quantitative PCR, digital PCR, or droplet digital PCR techniques, specific oligonucleotide primers and probes are used to hybridize with the integrated recombinant vector polynucleotide sequence and identify the copy number by combining with a reference polynucleotide sequence. Specific primer and probe combinations and kits are provided.

Benefits of technology

It enables accurate, rapid, and universal quantification of nucleic acid integration in recombinant vectors, reduces costs, can distinguish between integrated and unintegrated vectors, and improves the accuracy of transduction efficiency monitoring.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0003840115720000241
    Figure BDA0003840115720000241
  • Figure BDA0003840115720000243
    Figure BDA0003840115720000243
  • Figure BDA0003840115720000271
    Figure BDA0003840115720000271
Patent Text Reader

Abstract

In certain aspects, the present disclosure relates to methods of quantifying integration of a recombinant vector nucleic acid into the genome of a target cell. The present disclosure also provides compositions and kits comprising particular primers and probes for performing the quantification.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] Related Applications

[0002] This application claims the benefit of U.S. Provisional Patent Application No. 62 / 987,019, filed March 9, 2020, and U.S. Provisional Patent Application No. 63 / 148,300, filed February 11, 2021, which are hereby incorporated by reference in their entireties.

[0003] SEQUENCE LISTING

[0004] The instant application contains a Sequence Listing which has been submitted electronically in ASCII format and which is hereby incorporated by reference in its entirety. The ASCII copy, named PRD4079WOPCT1_SL.txt, was created on February 24, 2021, and is 21,861 bytes in size. BACKGROUND

[0005] There is a great potential for recent advances in the understanding of the delivery and integration of genomic material into the genome of target cells to alter the standard of care for a variety of diseases. Chimeric antigen receptor (“CAR”) T cell therapy has shown potential to treat B-cell malignancies and other cancers such as lymphocytic leukemia, B-cell lymphoma, sarcomas, neuroblastoma, and certain solid tumor cancers (see, e.g., Sadelain et al., Cancer Discovery, vol. 3: pp. 388-398, 2013, and Titov et al., Cancer, vol. 12: pp. 125-146, 2020), and generally involves modifying T cells in vitro to produce T cells that express CARs. Most T cell gene manipulation methods engineered for human use use retroviruses, such as lentiviruses, for stable expression of chimeric antigen receptors (CARs) (Jena et al., 2010; Ertl et al., 2011; Kohn et al., 2011). However, one of the challenges with current integration techniques using viral vectors for delivery is determining whether the vector has not only entered the cell, but also whether the transgene successfully integrated into the host genome (a process known as “viral integration”) and the number of integrations (or frequency of viral integration).

[0006] Southern blotting was originally the preferred technique for measuring copy number of integrated retroviral vector sequences, but was slow and costly due to the need for manual labor. More recently, researchers have developed quantitative PCR ("qPCR") methods to determine transduction efficiency and copy number. Some methods are unable to distinguish between free, unincorporated vector and integrated vector, and thus are only an estimate of copy number. See, e.g., Charrier et al., Gene Therapy, vol. 18: pp. 479-487, 2011. Some other methods use primers specific to a particular transgene. See Hum. Gene Ther., vol. 14: pp. 497-507, 2003. However, these methods either fail to yield accurate copy numbers or are cost prohibitive due to the need to design different specific primers for each transgene. SUMMARY

[0007] The present disclosure provides methods of quantifying integration of a recombinant vector nucleic acid (typically including a transgene) into a target cell genome that are not limited by or specific to any particular transgene. The present disclosure also provides compositions and kits including specific primers and probes for performing the quantification.

[0008] In one aspect, the present disclosure provides a method of quantifying integration of a recombinant vector nucleic acid into a genome of a cell, the method comprising: (a) providing a biological sample comprising a host cell genome; (b) amplifying genomic DNA of the biological sample using a primer pair comprising a first oligonucleotide primer and a second oligonucleotide primer, wherein at least one oligonucleotide primer of the primer pair specifically hybridizes to an integrated recombinant vector polynucleotide sequence; and (c) quantifying the genomic nucleic acid amplified by step (b).

[0009] In some embodiments, the quantifying comprises determining copy number. In some embodiments, the quantitative amplification technique is quantitative PCR. In some embodiments, the quantitative amplification technique is digital PCR. In some embodiments, the quantitative amplification technique is microdroplet digital PCR. In some embodiments, the quantitative amplification technique is end-point PCR.

[0010] In certain embodiments, quantifying integration of a recombinant vector nucleic acid in a host cell genome further comprises comparing the integrated recombinant vector sequence copy number of the biological sample to a reference polynucleotide sequence. In some embodiments, the reference polynucleotide sequence encodes a housekeeping protein. In some embodiments, the housekeeping protein is albumin. In some embodiments, the integrated recombinant vector sequence copy number and the reference polynucleotide sequence copy number are measured in a multiplexed manner. In some embodiments, the integrated recombinant vector sequence copy number and the reference polynucleotide sequence copy number are measured in a singleplexed manner.

[0011] In some embodiments, the method further comprises evaluating the effectiveness of the assay for quantifying recombmant vector nucleic acid integration by assessing one or more assay acceptance criteria selected from the group consisting of: (a) the threshold cycle for both the provirus and the reference polynucleotide sequence is not determinable in all replicates of the no-template DNA control; (b) the correlation coefficient of the standard curve for both the provirus and the reference polynucleotide sequence generated using linear regression from the standard samples is greater than or equal to 0.97; (c) the copy values for both the provirus and the reference polynucleotide sequence estimated from the slope of the standard curve indicate a PCR efficiency between 90% and 110%; (d) the threshold cycle for neither the provirus nor the reference polynucleotide sequence is not determinable in replicates of any of the standard samples; (e) the average threshold cycle for both the provirus and the reference polynucleotide sequence in the base standard samples is less than or equal to 22.0; (f) the standard deviation in the threshold cycle for both the provirus and the reference polynucleotide sequence in each standard sample is less than or equal to 0.60; (g) the average measured copies of the reference polynucleotide sequence for the one or more positive control samples is within 30% of the nominal expected value; (h) the average measured VCN / cell value for the one or more positive control samples is within 30% of the nominal expected VCN / cell value for each control; and (i) the coefficient of variation for the VCN / cell values for the one or more positive control samples is less than or equal to 20%.

[0012] In some embodiments, the method further comprises evaluating the effectiveness of the assay for quantifying recombmant vector nucleic acid integration by assessing one or more sample acceptance criteria selected from the group consisting of: (a) the average copy value for the reference polynucleotide sequence in the sample is within 30% of the expected value of 30,303.030 copies; (b) if the genomic DNA (gDNA) concentration of the sample is less than 0.02 pg / pL, the expected copies of the reference polynucleotide sequence for the sample is calculated from the amount of DNA actually loaded into the reaction; (c) the average target provirus copy value in the sample is between the validated range of copy values for the assay; (d) the average target provirus copy value in the sample is between 121,212.121 and 193.939 copies; (e) the coefficient of variation for the VCN / cell values for the target sample replicates is less than or equal to 20%; and (f) the standard deviation in the cycle threshold for both the target provirus and the target reference polynucleotide sequence in the sample is less than or equal to 0.60.

[0013] In some embodiments, the recombinant vector comprises a transgene. In some embodiments, the recombinant vector is a gene therapy vector. In some embodiments, the recombinant vector is a viral vector. In some embodiments, the recombinant vector is a retroviral vector. In some embodiments, the recombinant vector is a lentiviral vector. In some embodiments, the lentivirus on which the lentiviral vector is based is human immunodeficiency virus 1 (HIV-1) or human immunodeficiency virus 2 (HIV-2).

[0014] In some embodiments, the method of quantifying integration of a recombinant vector nucleic acid into a cell genome further comprises a method for identifying a transgene. In some embodiments, the method for identifying a transgene comprises: (a) providing a biological sample comprising a host cell genome; (b) amplifying genomic DNA of the biological sample using a primer pair comprising a first oligonucleotide primer and a second oligonucleotide primer with a quantitative amplification technique, wherein at least one oligonucleotide primer of the primer pair specifically hybridizes to a transgene; and (c) detecting and / or quantifying the genomic nucleic acid amplified by step (b). In some embodiments, the transgene is a polypeptide encoded by a nucleic acid sequence comprising the sequence of SEQ ID NO: 19 or 21.

[0015] In some embodiments, the oligonucleotide primer that specifically hybridizes to the integrated recombinant vector polynucleotide sequence comprises the nucleic acid sequence of SEQ ID NO: 1, SEQ ID NO: 5, or SEQ ID NO: 14. In some embodiments, the second oligonucleotide primer used to amplify the recombinant vector nucleic acid comprises the nucleic acid sequence of SEQ ID NO: 2, SEQ ID NO: 6, or SEQ ID NO: 15.

[0016] In some embodiments, the oligonucleotide primer that specifically hybridizes to the integrated recombinant vector polynucleotide sequence specifically hybridizes to an LTR sequence of the integrated recombinant vector sequence. In some embodiments, the oligonucleotide primer that specifically hybridizes to the integrated lentiviral vector polynucleotide sequence specifically hybridizes to the U3 region of the 5' LTR of the lentiviral vector nucleic acid sequence. In some embodiments, the oligonucleotide primer that specifically hybridizes to the integrated lentiviral vector polynucleotide sequence specifically hybridizes to the U3 region and the R region of the 5' LTR of the lentiviral vector nucleic acid sequence. In some embodiments, the oligonucleotide primer that specifically hybridizes to the integrated lentiviral vector polynucleotide sequence specifically hybridizes to the PBS region of the 5' LTR of the lentiviral vector nucleic acid sequence. In some embodiments, the oligonucleotide primer that specifically hybridizes to the integrated lentiviral vector polynucleotide sequence specifically hybridizes to the psi (Ψ) packaging signal. In certain embodiments, the primer does not specifically hybridize to a naturally occurring retroviral nucleic acid sequence.

[0017] In some embodiments, the method utilizes a detectable nucleic acid probe that specifically hybridizes to the amplified recombinant vector nucleic acid. In some embodiments, the probe that specifically hybridizes to the recombinant vector nucleic acid comprises the nucleic acid sequence of SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 7, or SEQ ID NO: 16. In some embodiments, the probe for the recombinant vector nucleic acid for integration specifically hybridizes to the LTR sequences of the integrated recombinant vector nucleic acid. In some embodiments, the probe for the lentiviral vector nucleic acid for use in step (b) specifically hybridizes to the U3 region and the R region of the 5' LTR of the lentivirus. In some embodiments, the probe for the lentiviral vector nucleic acid for use in step (b) specifically hybridizes to the U5 region and the PBS region of the 5' LTR of the lentivirus. In some embodiments, the probe for the lentiviral vector nucleic acid for use in step (b) specifically hybridizes to the PBS region of the 5' LTR of the lentivirus. In some embodiments, the probe for the lentiviral vector nucleic acid for use in step (b) specifically hybridizes to the R region and the U5 region of the 5' LTR of the lentiviral vector nucleic acid sequence. In certain embodiments, step (b) utilizes an intercalating dye. In some embodiments, the intercalating dye is SYBR green.

[0018] In some embodiments, the biological sample is a cell sample or a tissue sample. Specifically, in some embodiments, the tissue sample is blood, plasma, serum, saliva, or a tissue biopsy. In some embodiments, the sample is from a subject. In some embodiments, the subject is a human. In some embodiments, the recombinant vector nucleic acid sequence comprises a transgene. In some embodiments, the transgene encodes a chimeric antigen receptor. In some embodiments, the chimeric antigen receptor comprises the amino acid sequence of SEQ ID NO: 18, SEQ ID NO: 20, or SEQ ID NO: 22. In some embodiments, the chimeric antigen receptor is a polypeptide encoded by a nucleic acid sequence comprising the sequence of SEQ ID NO: 19 or SEQ ID NO: 21. In some embodiments, the chimeric antigen receptor recognizes BCMA, KLK2, or GPRC5D.

[0019] In some embodiments, the method further comprises utilizing at least one pair of oligonucleotide primers that specifically amplify a reference polynucleotide sequence.

[0020] In another aspect, the present disclosure provides a method for monitoring transduction efficiency of a recombinant vector nucleic acid, the method comprising: a) providing one or more biological samples comprising genomic DNA transduced by a recombinant vector nucleic acid, wherein a portion of the recombinant vector nucleic acid is integrated into the genomic DNA; and b) quantifying the recombinant vector nucleic acid integrated in the host cell genome according to the method of the present disclosure. In some embodiments, the method further comprises comparing the copy number of the integrated recombinant vector sequence of the biological sample to a reference.

[0021] In yet another aspect, the present disclosure provides a method of performing a batch release test on a cell product transduced by a recombinant vector, the method comprising: a) providing one or more biological samples of a cell product comprising genomic DNA transduced by a recombinant vector from each batch; b) quantifying the recombinant vector nucleic acid integrated in the host cell genome in each biological sample according to the method of the present disclosure; c) comparing the copy number of the integrated recombinant vector sequence quantified in step (b) for the biological samples to a reference; and d) releasing the batch in which the copy number of the integrated recombinant vector sequence passes a pre-determined standard.

[0022] In another aspect, the present disclosure provides a method of quantifying retroviral vector nucleic acid integration into a cell genome, the method comprising: (a) providing a biological sample comprising a host cell genome; (b) amplifying genomic DNA of the biological sample using a primer pair comprising a first oligonucleotide primer and a second oligonucleotide primer, wherein at least one oligonucleotide primer of the primer pair specifically hybridizes to an integrated retroviral vector polynucleotide sequence; and (c) quantifying the genomic nucleic acid amplified by step (b), wherein quantifying retroviral vector nucleic acid integration into the host cell genome comprises comparing the amplified retroviral vector nucleic acid to a reference ratio, wherein the retroviral vector nucleic acid is a lentiviral vector sequence, and wherein the oligonucleotide primer pair comprises the nucleic acid sequence of SEQ ID NO: 1 and the nucleic acid sequence of SEQ ID NO: 2, respectively, or the nucleic acid sequence of SEQ ID NO: 5 and the nucleic acid sequence of SEQ ID NO: 6, respectively, or the nucleic acid sequence of SEQ ID NO: 14 and the nucleic acid sequence of SEQ ID NO: 15, respectively. In certain embodiments, the quantifying uses a detectable probe comprising the nucleic acid sequence of SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 7, or SEQ ID NO: 16. In another aspect, the present disclosure provides an oligonucleotide comprising the nucleic acid sequence of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 14, SEQ ID NO: 15, or SEQ ID NO: 16.

[0023] In another aspect, the present disclosure provides a kit for measuring copy number of integrated recombinant vector nucleic acid sequences, the kit comprising: primers of a primer pair that specifically hybridize to an integrated recombinant vector nucleic acid, wherein the primer pair specifically amplifies a portion of the integrated recombinant vector nucleic acid; and a detectable nucleic acid probe that specifically hybridizes to the amplified recombinant vector nucleic acid.

[0024] In another aspect, the present disclosure provides a kit for measuring copy number of an integrated recombinant vector nucleic acid sequence, the kit comprising: a forward primer that specifically hybridizes to an integrated recombinant vector nucleic acid comprising the nucleic acid sequence of SEQ ID NO: 1, SEQ ID NO: 5, or SEQ ID NO: 14; a reverse primer that specifically hybridizes to an integrated recombinant vector nucleic acid comprising the nucleic acid sequence of SEQ ID NO: 2, SEQ ID NO: 6, or SEQ ID NO: 15; and a detectable probe comprising the nucleic acid sequence of SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 7, or SEQ ID NO: 16.

[0025] The present disclosure encompasses all combinations of any of the foregoing aspects and embodiments, as well as combinations with any of the embodiments set forth in the detailed description and examples. BRIEF DESCRIPTION OF DRAWINGS

[0026] For the purpose of illustrating the present invention, there are depicted in the drawings certain embodiments of the disclosure. However, the disclosure is not limited to the precise arrangements and instrumentalities of the embodiments depicted in the drawings.

[0027] Figure 1A An exemplary lentiviral vector transfer plasmid is shown that contains a transgene encoding a chimeric antigen receptor (CAR). Figure 1B A cell is depicted after integration of a portion of the vector into the target cell and expression of the integrated transgene at the cell surface. As Figure 1A As depicted in, the lentiviral vector transgene encodes a CAR flanked by a 5'-LTR (site C) and a 3'-LTR (site D). As Figure 1B As depicted in, when the lentiviral vector is incorporated into the genome of a cell, a portion of the 5'-LTR region (site A) has been replaced by the ΔU3 portion of the 3'-LTR sequence. The rectangular black boxes indicate exemplary primer and / or probe binding sites, and the "X" indicates a lack of primer binding site to produce a quantifiable amplicon. The integrated 5'-LTR (site a) has a ΔU3 site, while the transfer plasmid 5'-LTR (site C) does not.

[0028] Figure 2Alignments of selected primers and probes of the disclosure to exemplary lentiviral vector sequences are shown. The following sequences are depicted: exemplary lentiviral vector sequence (SEQ ID NO: 13); 5LTR_pairl and 2_F primers (SEQ ID NO: 1); 5LTR_pairl_probe (SEQ ID NO: 3); 5LTR_pairl and 2_R primers (SEQ ID NO: 2); 5LTR_pair2_probe (SEQ ID NO: 4); 5LTR_pair3_F primer (SEQ ID NO: 5); 5LTR_pair3_probe (SEQ ID NO: 7); 5LTR_pair3_R primer (SEQ ID NO: 6), 5LTR_pair4_F primer (SEQ ID NO: 14); 5LTR_pair4_R primer (SEQ ID NO: 15); 5LTR_pair4_probe (SEQ ID NO: 16).

[0029] Figures 3A-3B Quantification results of GPRC5d CAR-T by qPCR (3A) and flow cytometry (3B) side-by-side in blood are shown. DETAILED DESCRIPTION

[0030] SUMMARY

[0031] The present invention provides a method for detecting and / or quantifying recombinant vector nucleic acid integration and thus detecting and / or quantifying a transgene delivered into the genome of a host cell. There is a need for specific detection and / or quantification of transgene sequences delivered by a recombinant vector in transduced cells such as CAR-T cells. To this end, the inventors have developed a method for detecting and / or quantifying the integration of a recombinant vector nucleic acid encoding a transgene, such as a CAR, but not detecting and / or quantifying residual plasmid for the delivery of the transgene or un-integrated recombinant vector nucleic acid sequences. The ability to identify whether a vector has been successfully incorporated into a cell with a transgene independent sequence allows for more accurate, universal and cheaper quantification using quantitative PCR, digital PCR or other quantitative methods. The present disclosure provides methods and kits that take advantage of the change in the 5'-LTR sequence relative to the 5'-LTR sequence in the transfer plasmid vector upon integration into the host genome to identify and quantify genetic information delivered and incorporated via a recombinant vector. This information, including copy number, is critical to understanding and optimizing conditions for transfection or transduction. The methods of the present invention facilitate monitoring lentiviral vector transduction efficiency and characterization in vivo. Thus, the present disclosure provides improved methods for quantifying the integration of a recombinant vector nucleic acid into the genome of a target cell. Although the exemplary embodiments described herein relate to detection of integrated retroviral vector nucleic acids, the methods of the present invention are applicable to any recombinant nucleic acid vector sequence that can be distinguished from un-integrated nucleic acids upon integration into the host genome.

[0032] Throughout this application, various documents are cited. The disclosures of these documents in their entireties are hereby incorporated by reference into this application.

[0033] The scientific and technical terms used in connection with the present application, unless otherwise defined herein, shall have the meanings that are commonly understood by a person of ordinary skill in the art. Further, unless otherwise required by context, singular terms shall include pluralities and plural terms shall include the singular. Generally, nomenclature used in connection with, and techniques of, cell and tissue culture, molecular biology, cell and cancer biology, virology, immunology, microbiology, genetics, and protein and nucleic acid chemistry described herein are those well-known and commonly used in the art. Each embodiment of the present application described herein can be used alone or in combination with one or more other embodiments of the present application.

[0034] The methods and techniques of the application are generally performed according to conventional methods well-known in the art and as described in various general and more specific references that are cited and discussed throughout the present specification unless otherwise indicated. The methods and techniques of the various embodiments are generally performed according to the methods well-known in the art of molecular biology, cell biology, biochemistry, microarray and sequencing techniques and as described in various general and more specific references that are cited and discussed throughout the present specification unless otherwise indicated.See, e.g., Motulsky, "Intuitive Biostatistics," Oxford University Press, Inc., 1995; Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1989; Ausubel et al., Current Protocols in Molecular Biology, Greene Publishing Associates, 1992, and 2003 supplements; Harlow and Lane, Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1990; Coffin et al., Retroviruses, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1997; Bast et al., Cancer Medicine, 5th ed., Frei, Emil, ed., BC Decker Inc., Hamilton, Canada, 2000; Lodish et al., Molecular Cell Biology, 4th ed., W.H. Freeman & Co., New York, 2000; Griffiths et al., Introduction to Genetic Analysis, 7th ed., W.H. Freeman & Co., New York, 1999; Gilbert et al., Developmental Biology, 6th ed., Sinauer Associates, Inc., Sunderland, MA, 2000; and Cooper, The Cell A Molecular Approach, 2nd ed., Sinauer Associates, Inc., Sunderland, MA, 2000.

[0035] Chemical terms used herein are used according to conventional usage in the art, as exemplified by the "McGraw-Hill Dictionary of Chemical Terms" (Parker S., ed., McGraw-Hill, San Francisco, C.A., 1985).

[0036] All of the above cited and any other publications, patents and published patent applications referred to in this application are incorporated herein by reference. In the event of an inconsistency between a definition in the specification and that in a cited reference, the specification shall control.

[0037] Definitions

[0038] As used herein, the terms “polynucleotide,” “nucleic acid,” and “nucleic acid molecule” are used interchangeably. They refer to a polymeric form of nucleotides of any length, DNA

[0039] A polynucleotide can comprise modified nucleotides, such as methylated nucleotides and nucleotide analogs. If present, modifications to the nucleotide structure can be imparted before or after polymer assembly. The sequence of nucleotides can be interrupted by non-nucleotide components. A polynucleotide can be further modified, such as by conjugation to a labeling component. The term “recombinant” polynucleotide refers to polynucleotides of genomic, cDNA, semi-synthetic, or synthetic origin which either do not occur in nature or are linked to another polynucleotide in a nonnatural arrangement. A polynucleotide can be operably linked to an “expression control sequence,” which refers to a nucleotide sequence that regulates the expression of a gene.

[0040] The term “endogenous” refers to a protein, nucleic acid, cell, or another molecule derived from a source within the body of a subject.

[0041] The term “exogenous” refers to a protein, nucleic acid, cell, or another molecule derived from a source outside the body of a subject. Non-limiting examples of exogenous molecules include: a recombinant protein, a plasmid, a virus, a cell from a donor subject, a tissue from a donor subject, an organ from a donor subject, or a synthetic chemical.

[0042] Throughout this specification the word “comprise,” or variations such as “comprises” or “comprising,” will be understood to imply the inclusion of stated integers or group of integers but not the exclusion of any other integer or group of integers.

[0043] Also, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise.

[0044] The term "comprising" is used to mean "including, but not limited to." "Comprising" and "including" are used interchangeably.

[0045] "Subject" or "individual" are used interchangeably and refer to any animal, such as a dog, cat, bird, livestock, and particularly a mammal, and preferably a human.

[0046] The term "recombinant vector nucleic acid" refers to a nucleic acid sequence comprising a vector for delivery of a nucleic acid, which nucleic acid sequence includes at least one modification compared to a naturally occurring sequence, and can include a transgene encoding an exogenous protein to be expressed in the genome of a transduced cell.

[0047] The term "retroviral vector nucleic acid" refers to a nucleic acid sequence that is at least a portion of a retroviral vector, which nucleic acid sequence includes at least one modification compared to a naturally occurring retroviral sequence, and can include a transgene encoding an exogenous protein to be expressed in the genome of a transduced cell, e.g., a portion of a lentiviral vector transfer plasmid. A "retroviral vector nucleic acid sequence" does not encompass naturally occurring retroviral nucleic acids that are not associated with a retroviral vector. A retroviral vector nucleic acid that has been integrated into the genome of a host cell is sometimes referred to as a "proviral nucleic acid."

[0048] The term "retroviral vector" refers to a vector containing structural and functional genetic elements derived primarily from a retrovirus.

[0049] The term "retrovirus," as used herein, refers to an RNA virus that transcribes its genomic RNA into a linear double-stranded DNA copy and then covalently integrates its genomic DNA into the host genome. Exemplary retroviruses suitable for use in particular embodiments include, but are not limited to: Moloney murine leukemia virus (MoMLV), Moloney murine sarcoma virus (MoMSV), Harvey murine sarcoma virus (HaMuSV), murine mammary tumor virus (MuMTV), gibbon ape leukemia virus (GaLV), feline leukemia virus (FLV), foamy virus, Friend murine leukemia virus, murine stem cell virus (MSCV), Rous sarcoma virus (RSV), and lentivirus.

[0050] The term "lentiviral vector" is a subset of retroviral vectors and refers to a vector comprising structural and functional genetic elements derived primarily from a lentivirus. In certain embodiments, lentiviral vectors are produced according to known methods. See, e.g., Kutner et al., BMC Biotechnol., 2009; Kutner et al., Nat. Protoc., 2009. The present application includes recombinant, retroviral, and lentiviral vector constructs that express a transgene that can be directly transduced into a cell. In particular embodiments, lentiviral vectors are used to deliver a polynucleotide encoding a CAR to a cell.

[0051] According to certain specific embodiments contemplated herein, most or all of the viral vector backbone sequence is derived from a lentivirus, such as HIV-1. However, it will be appreciated that many different sources of retroviral and / or lentiviral sequences can be used, or used in combination, and that many substitutions and alterations of certain lentiviral sequences can be accommodated without impairing the ability of the transfer vector to perform the functions described herein. Moreover, a variety of lentiviral vectors are known in the art, see Naldini et al. (1996a, 1996b, and 1998); Zufferey et al., 1997; Dull et al., 1998, U.S. Patents 6,013,516 and 5,994,136, many of which can be adapted to produce the viral vectors or transfer plasmids contemplated herein.

[0052] "Lentivirus" refers to the group (or genus) of retroviruses that cause slowly developing diseases. Viruses included within this group include HIV (human immunodeficiency virus; including HIV type 1 and HIV type 2), the causative agent of human acquired immune deficiency syndrome (AIDS); visna-maedi disease, which causes encephalitis (visna) or pneumonia (maedi) in sheep, caprine arthritis-encephalitis virus, which causes immunodeficiency, arthritis, and encephalopathy in goats; equine infectious anemia virus, which causes autoimmune hemolytic anemia and encephalopathy in horses; feline immunodeficiency virus (FIV), which causes immunodeficiency in cats; bovine immunodeficiency virus (BIV), which causes lymphadenopathy, lymphocytosis, and possibly central nervous system infection in cattle; and simian immunodeficiency virus (SIV), which causes immunodeficiency and encephalopathy in subhuman primates. Diseases caused by these viruses are characterized by long incubation periods and long courses of illness. Typically, the viruses infect monocytes and macrophages latently, from which they can spread to other cells. HIV, FIV, and SIV also readily infect T lymphocytes (i.e., T cells). In various embodiments, lentiviral vectors contemplated herein comprise one or more LTRs, and one or more or all of the following accessory elements: cPPT / FLAP, Psi (Ψ) packaging signal, export element, polyadenylation sequence, and can optionally include a WPRE or HPRE, insulator element, selectable marker, and cell suicide gene as discussed elsewhere herein.

[0053] As a result of modifying the LTR, lentiviral vectors preferably contain several safety enhancements. A "self-inactivating" (SIN) vector refers to a replication-defective vector. The term "self-inactivating vector" refers to a vector in which the right (3') LTR enhancer-promoter region, known as the U3 region, has been modified (e.g., by deletion or substitution) to prevent viral transcription beyond the first round of viral replication. In certain embodiments, the LTR U3 is ΔU3. Thus, the vector is able to infect and then integrate into the host genome only once, and can not be able to further propagate. This is because the right (3') LTR U3 region serves as a template for the left (5') LTR U3 region during viral replication, and thus without the U3 enhancer-promoter, viral transcripts can not be replicated. If viral transcripts cannot be replicated, they can not be processed or packaged into virions, thus ending the life cycle of the virus. Thus, SIN vectors greatly reduce the risk of generating unwanted replication-competent virus, as the right (3') LTR U3 region has been modified to prevent viral transcription beyond the first round of replication, thus eliminating the ability of the virus to propagate. An additional safety enhancement is provided by replacing the U3 region of the 5' LTR with a heterologous promoter to drive transcription of the viral genome during viral particle production. Examples of heterologous promoters that can be used include, for example, the viral simian virus 40 (SV40) (e.g., early or late), cytomegalovirus (CMV) (e.g., immediate early), Moloney murine leukemia virus (MoMLV), Rous sarcoma virus (RSV), and herpes simplex virus (HSV) (thymidine kinase) promoters.

[0054] The term "long terminal repeat (LTR)" refers to a base pair domain located at the end of certain recombination DNA, such as retroviruses, which in their natural sequence context are direct repeats and contain U3, R, and U5 regions. LTRs generally provide essential functions for expression of the recombined gene (e.g., promotion, initiation, and polyadenylation of the gene transcript) and viral replication.

[0055] The term "R region" refers to the region within a recombining LTR that begins with the capping group (i.e., the start of transcription) and ends immediately before the start of the polyadenylate chain. The R region is also defined as flanking the U3 and U5 regions. The R region plays an important role during reverse transcription, allowing the nascent DNA to be transferred from one end of the genome to the other. The term "PBS region" refers to the region downstream of the U5 region of the 5'-LTR that serves as a primer binding site (PBS) for the tRNA Lys The primer binding site (PBS) of the primer, and is necessary for initiation of reverse transcription.

[0056] The term "specifically hybridizes to an integrated recombinant vector nucleic acid" refers to a nucleic acid (e.g., a primer) that specifically hybridizes to a recombinant vector nucleic acid that has integrated into the genome of a host cell, but not to residual plasmid used to deliver the transgene or a non-integrated recombinant vector nucleic acid sequence.

[0057] Test Assay

[0058] The efficacy and properties of the recombinant vector nucleic acids of the present disclosure can be readily tested by utilizing any of a number of available in vitro or in vivo assays. Several such assays are described below. The present disclosure contemplates that any of the recombinant vector nucleic acids of the present disclosure can be tested using any of these assays, as well as other assays known in the art.

[0059] In some embodiments, quantitative polymerase chain reaction (qPCR) is employed in order to quantify the integration of the recombinant vector nucleic acid into the target cell genome. In some embodiments, digital polymerase chain reaction (dPCR) is employed in order to quantify the integration of the recombinant vector nucleic acid into the target cell genome. In some embodiments, droplet digital polymerase chain reaction (ddPCR) is employed in order to quantify the integration of the recombinant vector nucleic acid into the target cell genome. In these embodiments, a culture of cells expressing the recombinant vector nucleic acid (e.g., PBMC cells) is harvested and prepared for qPCR or dPCR using primers specific for the LTR sequences of the integrated recombinant vector nucleic acid. Such experiments detect the integrated recombinant vector nucleic acid sequence encoding the CAR in the genome of the transduced CAR-T cells, but do not detect residual non-integrated transfer plasmid.

[0060] Methods and Uses of the Disclosure

[0061] The present disclosure provides methods of detecting and / or quantifying the integration of a recombinant vector nucleic acid into a cell genome. In this method, in certain embodiments, a biological sample comprising a host cell genome is provided. Providing a biological material includes providing fresh biological material, such as biological material taken at a given time for the purpose of this analysis. Providing a biological material also includes using previously obtained biological material taken at another point during patient care for this or other purposes, or using archived patient material. The biological material can be freshly obtained or previously obtained, and in the case of being previously obtained, can have been stored (e.g., at room temperature, refrigerated, or frozen) prior to use. Exemplary biological materials include, but are not limited to, whole blood, serum, plasma, urine, stool, cerebrospinal fluid, ascites, and the like.

[0062] In some embodiments, the biological material can be purified or otherwise processed to isolate the genomic DNA of the biological sample. This processing can include HPLC, size exclusion chromatography, gel electrophoresis, affinity chromatography, commercial DNA extraction or purification kits, or other purification techniques.

[0063] Methods of amplifying genomic DNA of a biological sample include, but are not limited to, polymerase chain reaction (PCR), linear polymerase reaction, nucleic acid sequence-based amplification (NASBA), rolling circle amplification, digital PCR (dPCR), droplet digital PCR (ddPCR), end-point PCR, and the like, which are disclosed in the following references incorporated herein by reference: Mullis et al., U.S. Patents 4,683,195, 4,965,188, 4,683,202, 4,800,159 (PCR); Gelfand et al., U.S. Patent 5,210,015 (real-time PCR using “TAQMAN TM ” probes); Wittwer et al., U.S. Patent 6,174,670; Kacian et al., U.S. Patent 5,399,491 (“NASBA”); Lizardi, U.S. Patent 5,854,033; Aono et al., Japanese Patent Publication JP 4-262799 (rolling circle amplification), and the like.

[0064] In certain embodiments, the genomic DNA of a biological sample is then amplified using a quantitative amplification technique. Quantitative amplification techniques are known to those of skill in the art and include quantitative PCR (qPCR), digital PCR, and end-point PCR. “qPCR” or “real-time quantitative PCR” (real-time quantitative polymerase chain reaction) refers to an experimental method that uses PCR to simultaneously amplify and quantify a target nucleic acid. Quantification is performed using a variety of measurement chemistries, including, for example, a fluorescent dye such as SYBR TM Green or a fluorescent reporter oligonucleotide probe such as a Taqman probe, and is quantified in real-time after each amplification cycle with the amplified DNA accumulating in the reaction. For a description of digital PCR methods, see, e.g., Hindson et al., 2011, Anal. Chem. 83:8604-8610; Pohl and Shih, 2004, Expert Rev. Mol. Diagn. 4:41-47; Pekin et al., 2011, Lab Chip 11:2156-2166; Pinheiro et al., 2012, Anal. Chem. 84:1003-1011; Day et al., 2013, Methods 59:101-107; which are incorporated herein by reference in their entireties.

[0065] As used herein, the term "primer" means an oligonucleotide that can serve as a point of initiation for synthesis under conditions that induce synthesis of a primer extension product complementary to a nucleic acid strand (template), i.e., in the presence of a polymerization mixture comprising nucleotides and a DNA polymerase, and suitable temperature and pH conditions. In certain embodiments, the primer is a deoxyribonucleotide and is single-stranded. The primers used in the present invention can include naturally occurring dNMPs (i.e., dAMP, dGMP, dCMP, and dTMP), modified nucleotides, or non-natural nucleotides. Additionally, the primers can also include ribonucleotides.

[0066] The primer should be long enough to be able to initiate synthesis of an extension product in the presence of the polymerization mixture. The appropriate length of the primer is determined by many factors, such as temperature, application, and source of the primer, while generally being 15 to 30 nucleotides. Short primer molecules generally require lower temperatures to form a sufficiently stable hybridization complex with the template.

[0067] In some embodiments, the detectable nucleic acid probe that specifically hybridizes to the amplification product (e.g., the integrated retroviral nucleic acid amplicon or the control nucleic acid amplicon) produces a signal that is detectable in the amplification reaction. In some embodiments, the detectable nucleic acid probe comprises a detectable agent. In some embodiments, the detectable nucleic acid probe comprises a quencher. Detectable agents and quenchers are disclosed in U.S. Patent Publication 20190284610, which is incorporated by reference herein.

[0068] In certain embodiments, the fluorescent analysis can be performed by a commercial detector (e.g., a microplate reader by biorad), and the microdroplet fluorescence signal of each sample can be detected in the device, and the number of positive and negative microdroplets can be counted, and the analysis can be done automatically.

[0069] In certain embodiments, the term "detectable nucleic acid probe" means a TaqMan probe for quantitative PCR. In certain embodiments, a fluorescent material (HEX, VIC, FAM dye) is attached to the probe. In certain embodiments, 3lABkFQ can be used as a quencher at the 3' side of the probe. The TaqMan probe is an oligonucleotide labeled with a fluorescent substance at the 5' end and a quencher substance at the 3' end, respectively. The TaqMan probe is specifically hybridized to the template DNA in the annealing step, but does not show fluorescence even under light because the 3' end of the probe has a quencher. In the following extension step, the 5' to 3' exonuclease activity of the Taq DNA polymerase degrades the TaqMan probe hybridized to the template. Then, the fluorescent substance is separated from the probe, and the inhibition by the quencher is released. By this principle, the fluorescence due to the PCR reaction is quantitatively shown.

[0070] In certain embodiments, a fluorescence quenching assay can be used, in which the probe according to the application comprises a fluorophore and a quencher, which are positioned such that in the absence of the target nucleic acid, and at temperatures below the Tm of the probe, fluorescence is quenched. A variety of fluorophores can be used in the probes and primers according to the application. Fluorophores that can be used include coumarin, fluorescein (FAM), tetrachlorofluorescein, hexachlorofluorescein, fluorescein yellow, rhodamine, BODIPY, tetramethylrhodamine, Cy3, Cy5, Cy7, eosin, Texas red, and ROX. For example, the combination fluorophores described by Lee et al. (1997, Nucleic Acids Research, vol. 25: p. 2816) such as fluorescein-rhodamine dimers are also suitable. The fluorophores can be selected to absorb and emit in the visible spectrum or outside the visible spectrum such as in the ultraviolet or infrared range. Suitable quenchers described in the art include 3lABkFQ, DABCYL, and variants thereof such as DABSYL, DABMI, and methyl red. Fluorophores can also act as quenchers in that they tend to quench fluorescence when in the vicinity of certain other fluorophores. In some embodiments, the preferred quencher is 3lABkFQ. In some embodiments, the preferred fluorophore is fluorescein (FAM). In some embodiments, the preferred internal quencher is ZEN. In some embodiments, the preferred fluorophore is VIC.

[0071] In certain embodiments, the genomic DNA of a biological sample is simultaneously amplified using quantitative PCR with at least one pair of oligonucleotide primers specific for amplifying a reference polynucleotide sequence and with a primer pair comprising a first oligonucleotide primer and a second oligonucleotide primer, wherein at least one oligonucleotide primer of the primer pair specifically hybridizes to the integrated retroviral vector polynucleotide sequence. Specifically, as shown in Figure 1B the reference polynucleotide sequence can be used to determine the number of cells present in the sample using genomic information and thus allow for estimation of copy number. This can improve the accuracy of previous methods that generally use a conversion factor from the mass of genetic material in the sample to determine copy number. Also as shown in Figure 1B the retroviral vector sequence comprising a polynucleotide encoding a CAR can be incorporated into the host cell genome. This incorporated retroviral vector sequence specifically includes a 5'-LTR delta U3 region that is not present in the unincorporated vector, as shown in Figure 1A This method is selective for only the integrated retroviral vector sequence and not the unincorporated retroviral vector by including primers that are only complementary to the 5'-LTR delta U3 region in Figure 1B

[0072] ​In some embodiments, the retroviral vector nucleic acid is based on a member of the Lentivirus genus. Specifically, lentiviruses have shown strong transfection efficiency and are a well- validated tool for incorporating genetic information into host cells. In some embodiments, the lentivirus is human immunodeficiency virus 1 (HIV-1) or human immunodeficiency virus 2 (HIV-2). In some embodiments, the primers used to amplify the integrated retroviral vector nucleic acid specifically hybridize to the LTR sequences of the integrated retroviral vector sequence. In some embodiments, the primers used to amplify the retroviral vector nucleic acid specifically hybridize to the U3 region of the 5' LTR of the lentivirus. In some embodiments, the primers used to amplify the retroviral vector nucleic acid specifically hybridize to the U3 region and the R region of the 5' LTR of the lentivirus. In some embodiments, the primers used to amplify the retroviral vector nucleic acid specifically hybridize to the PBS region of the 5' LTR of the lentivirus. In some embodiments, the primers used to amplify the retroviral vector nucleic acid specifically hybridize to the PBS region and the R region of the 5' LTR of the lentivirus. In some embodiments, the primers used to amplify the retroviral vector nucleic acid specifically hybridize to the psi (Ψ) packaging signal. In some embodiments, the sequence specific for the incorporated retroviral vector nucleic acid comprises the nucleic acid sequence of SEQ ID NO: 1, SEQ ID NO: 5, or SEQ ID NO: 14. In some embodiments, the sequence specific for the incorporated retroviral vector nucleic acid comprises the nucleic acid sequence of SEQ ID NO: 2, SEQ ID NO: 6, or SEQ ID NO: 15. In some embodiments, a detectable nucleic acid probe is used that specifically hybridizes to the amplified retroviral vector nucleic acid. Specifically, in some embodiments, the probe that specifically hybridizes to the retroviral vector nucleic acid comprises the nucleic acid sequence of SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 7, or SEQ ID NO: 16. In some embodiments, the probe that specifically hybridizes to the retroviral vector nucleic acid comprising the nucleic acid sequence of SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 7, or SEQ ID NO: 16 further comprises a fluorophore or quencher located at the 5' end, the 3' end, and / or between the ninth and tenth nucleotides measured from the 5' end of the sequence. In some embodiments, the probe that specifically hybridizes to the retroviral vector nucleic acid consists of the nucleic acid sequence of SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 7, or SEQ ID NO: 16, including a fluorophore or quencher located at the 5' end, the 3' end, and / or internally. In specific embodiments, the internal quencher is located between the ninth and tenth nucleotides measured from the 5' end of the sequence.In some embodiments, the probe has a fluorophore at the 5' end, an internal quencher, and a second quencher at the 3' end. In some embodiments, the preferred quencher is 3lABkFQ. In some embodiments, the preferred fluorophore is fluorescein (FAM). In some embodiments, the preferred internal quencher is ZEN. In some embodiments, the preferred fluorophore is VIC. In some embodiments, the probe that specifically hybridizes to the retroviral vector nucleic acid is / FAM / CTTTCAAGT / ZEN / CCCTGTTCGGGCGCC / 3lABkFQ / (SEQ ID NO: 12) or / 56-FAM / TGCCTTGAG / ZEN / TGCTTCAAGTAGTGTGT / 3IABkFQ / (SEQ ID NO: 17). In some embodiments, the primers that amplify a reference sequence present in all host cells comprise a nucleic acid sequence that specifically hybridizes to a portion of a sequence encoding a housekeeping protein. Specifically, in some embodiments, the housekeeping protein is albumin. In some embodiments, the primer sequence that specifically hybridizes to a portion of the albumin gene is SEQ ID NO: 8 and / or 9. In some embodiments, the sequence of the probe that specifically hybridizes to the albumin nucleic acid is SEQ ID NO: 10. In some embodiments, the probe that specifically hybridizes to the albumin nucleic acid is / 5HEX / AGGGAGA / ZEN / GATTTGTGTGGGCATGAC / 3IABkFQ / (SEQ ID NO: 11).

[0073] In this method, in certain embodiments, the amplified genomic nucleic acid is then detected and / or quantified, where the ratio of amplified retroviral vector nucleic acid to reference nucleic acid is related to the copy number of retroviral vector nucleic acid integrated in the genome of the cell. Specifically, as discussed above, because one primer pair is specific for a polynucleotide sequence that only occurs when a retroviral vector is incorporated into the genome of a host cell, the number of sequences counted by qPCR is directly proportional to the number of integrated retroviral vectors in the sample. Dividing by the number of reference polynucleotide sequences detected allows for direct calculation of copy number for a given biological sample.

[0074] In certain embodiments, the present disclosure provides methods for determining the copy number of integrated retroviral vector nucleic acid in the genome of a subject. In some embodiments of the method, a biological sample comprising genomic DNA of the subject is provided. In some embodiments of the method, a portion of the integrated retroviral vector nucleic acid in the genome of the subject and a reference polynucleotide sequence in the biological sample are amplified by quantitative PCR. In some embodiments of the method, the amount of (i) amplified polynucleotides comprising the retroviral vector nucleic acid sequence and (ii) amplified polynucleotides comprising the reference polynucleotide sequence are determined, and the ratio of (i) to (ii) is determined, wherein the ratio corresponds to the copy number of integrated retroviral vector nucleic acid.

[0075] In some embodiments, amplification comprises combining the sample with a composition comprising a primer pair specific for the integrated retroviral vector nucleic acid sequence, and performing quantitative PCR. In some embodiments, amplification comprises combining the sample with a composition comprising a primer pair specific for the integrated retroviral vector nucleic acid sequence, and performing a quantitative amplification technique. In some embodiments, amplification further comprises a primer pair specific for the reference polynucleotide sequence, and performing a quantitative amplification technique, wherein the integrated retroviral vector nucleic acid sequence and the reference polynucleotide are amplified at substantially equal ratios, respectively. In some embodiments, one primer of the primer pair for the integrated retroviral vector nucleic acid sequence specifically hybridizes to the 5' LTR. In some embodiments, one primer of the primer pair for amplifying the retroviral vector nucleic acid specifically hybridizes to the U3 region of the 5' LTR. In some embodiments, one primer of the primer pair for the integrated retroviral vector nucleic acid sequence specifically hybridizes to the U3 region and the R region of the 5' LTR. In some embodiments, one primer of the primer pair for amplifying the retroviral vector nucleic acid specifically hybridizes to the PBS region of the 5' LTR. In some embodiments, the integrated retroviral vector nucleic acid sequence comprises a transgene. In some embodiments, the transgene encodes a chimeric antigen receptor (CAR) that specifically binds to a target antigen.

[0076] The present disclosure provides yet another method for monitoring the transduction efficiency of a retroviral vector. In some embodiments, one or more biological samples comprising genomic DNA transduced by a retroviral vector nucleic acid are provided, wherein a portion of the retroviral vector nucleic acid is integrated into the genomic DNA. In some embodiments, the copy number of the integrated retroviral vector sequence in the genomic DNA of each biological sample is determined according to the methods described herein. In some embodiments, the copy number of the retroviral vector sequence of the biological samples is compared to a reference.

[0077] The present disclosure also provides a method of performing a batch release test on a cell product transduced by a retroviral vector. In some embodiments, one or more biological samples from each batch of a cell product transduced by a retroviral vector comprising genomic DNA are provided. In some embodiments, the copy number of integrated retroviral vector sequences in each biological sample is determined according to the methods of the present disclosure. In some embodiments, the copy number of retroviral vector sequences of the biological sample is compared to a reference. In some embodiments, the copy number of integrated retroviral vector sequences therein is released by a pre-determined standard. In certain embodiments, the pre-determined standard can be a copy number range or a percent change from a control.

[0078] The present disclosure also provides assay acceptance criteria and sample acceptance criteria that can be used to determine the validity of an assay or sample, respectively, for quantifying integration of a recombinant vector nucleic acid. In some embodiments, integration of a recombinant vector nucleic acid sequence is determined by calculating a vector copy number per cell (VCN / cell) value, defined as the ratio of the measured amount of provirus to a reference polynucleotide sequence, multiplied by two. In some embodiments, the amount of provirus or reference polynucleotide sequence is determined via quantitative PCR (qPCR). In some embodiments, the amount of provirus or reference polynucleotide sequence is determined via quantitative PCR (qPCR) from a threshold cycle (Ct) measured by a qPCR instrument. The threshold cycle (Ct) is defined as the number of PCR cycles required to reach each amplification cycle of the provirus or reference polynucleotide sequence and is inversely proportional to the content of the respective polynucleotide sequence.

[0079] In some embodiments, the one or more of the assay acceptance criteria or sample acceptance criteria utilizes three or more replicates of three or more standard samples. In some embodiments, the three or more standard samples, each at or about 3.20 VCN / cell, are prepared from a pre-determined base standard sample by up to four 5-fold serial dilutions using a buffer as a diluent. In some embodiments, the base standard sample comprises 121,212.121 copies of the provirus and 75,757.576 copies of the reference polynucleotide sequence. In some embodiments, for the three or more replicates of one or more positive control samples, the one or more of the assay acceptance criteria or sample acceptance criteria requires comparing the measured amounts of provirus and reference polynucleotide sequence to the nominal amounts of provirus and reference polynucleotide sequence calculated during preparation of the one or more positive control samples from separate samples of known concentrations of provirus and reference polynucleotide sequence.

[0080] In some embodiments, the method further comprises assessing the validity of the assay for quantifying integration of the recombinant vector nucleic acid sample by assessing one or more assay acceptance criteria. In some embodiments, the assay is valid if one or more or all of the assay acceptance criteria selected from the group consisting of: (a) the threshold cycle for both the provirus and the reference polynucleotide sequence is not determinable in all replicates of the no-template DNA control; (b) the correlation coefficient of the standard curve for both the provirus and the reference polynucleotide sequence generated using linear regression from the standard samples is greater than or equal to 0.90, 0.91, 0.92, 0.93, 0.94, 0.95, 0.96, or 0.97; (c) the VCN / cell value estimated from the slope of the standard curve indicates a PCR efficiency between 80% and 120%, between 82% and 118%, between 84% and 116%, between 86% and 114%, between 88% and 116%, or between 90% and 110%; (d) in no replicate of any of the standard samples is the threshold cycle for either of the provirus and the reference polynucleotide sequence not determinable; (e) the average threshold cycle for both the provirus and the reference polynucleotide sequence in the base standard samples is less than or equal to 30.0, 28.0, 26.0, 24.0, or 22.0; (f) the standard deviation in the threshold cycle for both the provirus and the reference polynucleotide sequence in each standard sample is less than or equal to 0.95, 0.90, 0.85, 0.80, 0.75, 0.70, 0.65, or 0.60; (g) the average measured copies of the reference polynucleotide sequence of the one or more positive control samples is within 50%, 45%, 40%, 35%, or 30% of the nominal expected value, (h) the measured average VCN / cell value of the one or more positive control samples is within 50%, 45%, 40%, 35%, or 30% of the nominal expected VCN / cell value of each control; and (i) the coefficient of variation of the VCN / cell value of the one or more positive control samples is less than or equal to 50%, 45%, 40%, 35%, 30%, 25%, or 20%.

[0081] In some embodiments, the method further comprises evaluating the effectiveness of quantifying the recombmant vector nucleic acid integration of the sample by assessing one or more sample acceptance criteria. In some embodiments, the sample is effective if one or more or all of the sample acceptance criteria selected from the group consisting of: (a) the average copy value of the reference polynucleotide sequence in the sample is within 50%, 45%, 40%, 35%, or 30% of the expected value of 30,303.030 copies; (b) if the genomic DNA (gDNA) concentration of the sample is less than 0.02 pg / pL, the expected copies of the reference polynucleotide sequence of the sample is calculated from the amount of DNA actually loaded into the reaction; (c) the average target proviral copy value in the sample is between the validated range of copies determined; (d) the average target proviral copy value in the sample is between 121,212.121 and 193.939 copies; (e) the coefficient of variation of the VCN / cell value of the target sample replicates is less than or equal to 50%, 45%, 40%, 35%, 30%, 25%, 20%; and (f) the standard deviation in the cycle threshold values of both the target provirus and the target reference polynucleotide sequence in the sample is less than or equal to 0.95, 0.90, 0.85, 0.80, 0.75, 0.70, 0.65, or 0.60.

[0082] In some embodiments, the method of quantifying recombmant vector nucleic acid integration to a cell genome further comprises a method for identifying a transgene. In some embodiments, the method for identifying a transgene comprises: (a) providing a biological sample comprising a host cell genome; (b) amplifying genomic DNA of the biological sample using a primer pair comprising a first oligonucleotide primer and a second oligonucleotide primer, wherein at least one oligonucleotide primer of the primer pair specifically hybridizes to a transgene; and (c) detecting and / or quantifying the genomic nucleic acid amplified by step (b). In some embodiments, the transgene encodes a chimeric antigen receptor. In some embodiments, the chimeric antigen receptor comprises the amino acid sequence of SEQ ID NO: 18, SEQ ID NO: 20, or SEQ ID NO: 22. In some embodiments, the chimeric antigen receptor is a polypeptide encoded by a nucleic acid sequence comprising the sequence of SEQ ID NO: 19 or SEQ ID NO: 21. In some embodiments, the chimeric antigen receptor recognizes BCMA, KLK2, or GPRC5D.

[0083] Kit

[0084] In certain embodiments, the present disclosure also provides a kit for measuring the copy number of integrated recombmant vector sequences. In certain embodiments, the kit can include one or more primers of the present application. In certain embodiments, the kit can include one or more probes of the present application.

[0085] The present disclosure also provides a kit for measuring copy number of an integrated recombinant vector sequence. In some embodiments, the kit comprises one primer or both primers of a primer pair that specifically hybridizes to an integrated recombinant vector nucleic acid, wherein the primer pair specifically amplifies a portion of the integrated recombinant vector nucleic acid. In some embodiments, the kit comprises a detectable nucleic acid probe that specifically hybridizes to the amplified recombinant vector nucleic acid.

[0086] The present disclosure also provides another kit for measuring copy number of an integrated recombinant vector sequence. In some embodiments, the kit comprises a forward primer that specifically hybridizes to an integrated recombinant vector nucleic acid. In some embodiments, the kit comprises a forward primer that specifically hybridizes to an integrated recombinant vector nucleic acid, wherein the forward primer comprises the nucleic acid sequence of SEQ ID NO: 1, SEQ ID NO: 5, or SEQ ID NO: 14. In some embodiments, the kit comprises a reverse primer that specifically hybridizes to an integrated recombinant vector nucleic acid. In some embodiments, the kit comprises a reverse primer that specifically hybridizes to an integrated recombinant vector nucleic acid, wherein the reverse primer comprises the nucleic acid sequence of SEQ ID NO: 2, SEQ ID NO: 6, or SEQ ID NO: 15. In some embodiments, the kit comprises a detectable probe. In some embodiments, the kit comprises a detectable probe comprising the nucleic acid sequence of SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 7, or SEQ ID NO: 16.

[0087] Examples

[0088] The present disclosure will now be generally described with reference to the following examples, which are merely intended to illustrate certain aspects and embodiments of the present disclosure, and are not intended to be limiting of the present disclosure. For example, the particular constructs and experimental designs disclosed herein represent exemplary tools and methods for verifying correct function. Thus, it will be readily apparent to one of ordinary skill in the art that any of the particular constructs and experimental plans disclosed can be substituted within the scope of the present disclosure.

[0089] Example 1 : Exemplary Materials and Methods

[0090] Transient transfection experiments were performed with Lipofectamine 2000 (Life Technologies) and plasmids in 6-well plates at a cell density of 4 x 105cells per well. The medium was removed and replaced with fresh growth medium 24 hours later. 5

[0091] ​A qPCR assay was performed to determine the copy number of the transfected cells. First, standards and quality controls were prepared by linearizing the plasmids for the reference gene and 5'-LTR sequence, respectively, in the presence of tRNA (yeast tRNA; Invitrogen catalog number 657491). Second, we prepared a reference gene master mix consisting of forward primer (SEQ ID NO: 8), reverse primer (SEQ ID NO: 9), and probe / 5HEX / AGGGAGA / ZEN / GATTTGTGTGGGCATGAC / 3IABkFQ / (SEQ ID NO: 11) in IX Fast Advanced Master Mix (Thermo Scientific, catalog number 4444558). Third, we prepared a 5'-LTR master mix consisting of forward primer (SEQ ID NO: 5), reverse primer (SEQ ID NO: 6), and probe / FAM / CTTTCAAGT / ZEN / CCCTGTTCGGGCGCC / 3lABkFQ / (SEQ ID NO: 12) in IX Fast Advanced Master Mix (Thermo Scientific, catalog number 4444558).

[0092] The qPCR assay was prepared by adding Master Mix, standards, QC, and samples to a multiwell plate. The qPCR assay was run on any real-time PCR instrument. The qPCR assay includes, but is not limited to, preparation by adding Master Mix, standards, QC, and samples to a 96-well plate. The qPCR assay can be run on, but is not limited to, a Quantstudio instrument with the following conditions: 50°C for 2 minutes, 95°C for 10 minutes, 95°C for 15 seconds for melting, 60°C for 1 minute for annealing and extension.

[0093] Example 2: Quantification of polynucleotide incorporation encoding CAR in HIV-1 delivered T cells

[0094] The general qPCR assay detects only the integrated retroviral vector sequences of any transgene in the genome encoding the transduced cell product, but not the transfer plasmid used to produce the lentiviral vector. Based on the unique feature of lentiviral vector integration into the host genome, a specific qPCR assay was developed that can quantify the copy number of lentiviral transduced cells but not the unintegrated vector (see Figure 1A and Figure 1B ).

[0095] Retroviral vector nucleic acids integrated in the genome of a cell can be readily quantified using the methods of the present application.

[0096] The method according to Example 1 was used to amplify the integrated lentiviral vector sequence using primer and probe sets 1 to 5 (according to Table 1). Primer sets 1 to 4 amplified the lentiviral sequence in which the vector was integrated in the cell samples and did not amplify in control cell samples in which no transduction had taken place but the lentiviral transfer plasmid was present (see Figure 2 ). Control (set 5) amplified the human albumin (hALB) sequence in all samples with cells.

[0097] Example 3: Integration of GPRc5d in blood Quantification of CAR-T

[0098] The method described in the previous example was used to quantify the integrated CAR transgene copy number in mouse studies using GPRc5d CAR-T. This study was performed to select the final clone / construct.

[0099] The qPCR assay was developed and successfully used in five different mouse studies. In the GPRc5d CAR-T study, proviral method copy number correlated with flow data Figures 3A-3B ). 5LTR against 3 (set 3 according to Table 1) was used in these experiments.

[0100] Example 4: Quantification of integrated transgenes in CAR-T products

[0101] A quantitative real-time PCR (qPCR) assay for quantification of integrated transgenes was developed by targeting the cellular genomic integrated form of the HIV derived lentiviral 5'LTR region (proviral sequence target region) in CAR-T products. An exemplary CAR-T product recognizing the target antigen BCMA has the amino acid sequence of SEQ ID NO: 18. The assay is a singleplex or multiplex qPCR with targeting of the integrated 5'LTR region of the proviral sequence as well as human albumin (hALB; reference housekeeping gene). This method can be used, but is not limited to, pre-formulated frozen CAR-T cell pellets for determining transduction efficiency reported as vector copy number (VCN) per cell.

[0102] Genomic DNA (gDNA) was extracted from pre-formulated CAR-T cell pellets using the Purelink gDNA isolation kit. Prior to DNA isolation, pre-formulated cell pellets were stored frozen at < -60 °C. Isolated DNA was stored at < -60 °C and later thawed for quantitation, or immediately quantitated using a Qubit 4 Fluorometer and fluorescence-based Qubit dsDNA Broad Range assay kit. The Qubit 4 Fluorometer was calibrated using two standards supplied in the Qubit dsDNA Broad Range kit. Standards were prepared and run for each set of DNA samples to be quantitated. The same Qubit working solution was used to prepare both the standard and DNA sample reactions. After quantitation, isolated DNA was diluted to a working concentration of 0.020 pg / pL.

[0103] qPCR reactions were prepared using oligo mix containing proviral primer and probe set 4, including / / 56-FAM / TGCCTTGAG / ZEN / TGCTTCAAGTAGTGTGT / 3IABkFQ / (SEQ ID NO: 17) and hALB primer and probe set 5, according to Table 1, and qPCR TaqPath ProAmp Premix solution diluted using molecular grade water. The final concentration of each of the three oligos in the proviral primer and probe set was 200 nM. The final concentration of each of the hALB forward and reverse primers was 50 nM, while the final concentration of the hALB probe was 200 nM.

[0104] Proviral standard #1 was prepared by spiking 0.05 pg / pL PBMC DNA with linear 5’LTR plasmid such that 5 pL of standard #1 contained 121,212.121 copies of plasmid. Standard #1 was serially diluted using buffer. The proviral qPCR intermediate control was prepared by spiking 0.02 pg / pL of PBMC gDNA with linear 5’LTR plasmid such that 5 pL of intermediate control contained 30,303.030 copies of 5’LTR plasmid. The proviral qPCR low control was made by diluting the intermediate control volume 1:10 using 0.02 pg / pL of PBMC gDNA as diluent. This equates to a nominal vector copy number of 2.00 VCN / cell for 5 pL of intermediate control and 0.20 VCN / cell for 5 pL of low control, but the actual VCN / cell value for each batch of intermediate control and low control was determined during reagent qualification.

[0105] Load the premix into the designated wells of the qPCR plate. Load each dilution standard, pre-viral intermediate control, pre-viral low control, test article DNA, and low EDTA TE buffer (i.e., no template control or NTC) in triplicate into the designated wells of the qPCR plate containing the premix. Load the qPCR plate into the real-time PCR instrument to perform the qPCR reaction.

[0106] Determine the threshold cycle of measurement (Ct) for each target (pre-virus and hALB) by the qPCR instrument. The Ct and log concentration values of the standards are used to generate a standard curve by linear regression. The standard curve is used to calculate the copies of each target for each control and test article replicate.

[0107] The VCN / cell for each sample, intermediate control, and low control replicate is calculated as follows.

[0108]

[0109] where x is each value from the population, is the mean of the dataset, and N is the size of the population, then the mean, standard deviation, and %CV of the triplicate VCN / cell values for each sample, intermediate control, and low control are calculated as:

[0110]

[0111] The following assay acceptance criteria are used to generate a valid assay:

[0112] • The correlation coefficient (R 2 ) value of the pre-virus and hALB standard curves must be > 0.97.

[0113] • The slope of the standard curves must be between -3.585 and -3.104 (equal to 90.08-109.97% PCR efficiency)

[0114] • All Ct replicates of the NTC must be “Not Determinable” for both the pre-virus and hALB targets.

[0115] • The mean Ct of standard #1 must be < 22.0 for both the pre-virus and hALB targets, and no Ct replicate of any of the standards can be “Not Determinable”.

[0116] • The Ct SD of each standard must be < 0.60 for both the pre-virus and hALB targets.

[0117] • The mean hALB copies of the intermediate and low controls must be 30,303.030 copies + / - 30% (expected range: 21,212.121-39,393.939 copies).

[0118] • The average VCN / cell results for the intermediate and low controls must be > -30% and < +30% of the qualified VCN / cell values for each control.

[0119] • The %CV of VCN / cell for the intermediate and low control replicates must be < 20%.

[0120] Any sample that does not meet all of the following acceptance criteria is considered invalid:

[0121] • The Ct SD for each sample must be < 0.60 for both the proviral and hALB targets. Ct SD is not accessed for samples determined to be below or above the assay range.

[0122] • The average hALB copies for each sample must be 30,303.030 copies ± 30% (expected range: 21,212.121 to 39,393.939 copies).

[0123] • If the concentration of sample gDNA is < 0.02 pg / pL, the expected copies of hALB for that sample is calculated based on the amount of DNA actually loaded into the reaction.

[0124] • The average proviral target copy value for each sample must be equal to or between the verification range of the assay in order to calculate the VCN / cell result.

[0125] • If the average proviral copy value for a sample is > 121,212.121, the sample is considered to be above the assay range.

[0126] • If the average proviral copy value for a sample is < 193.939 copies, the sample is considered to be below the assay range.

[0127] • The %CV of sample VCN / cell replicates must be < 20%. %CV is not accessed for samples determined to be below or above the assay range or samples that do not pass the hALB acceptance criteria.

[0128] • The Ct SD for each sample must be < 0.60 for both the proviral and hALB targets. %CV is not accessed for samples determined to be below or above the assay range or samples that do not pass the hALB acceptance criteria.

[0129] For any sample that meets all sample acceptance criteria, the transduction efficiency is reported as the average of the VCN / cell results, rounded to 2 decimal places.

[0130] BCMA CAR-T tested using the method of the application produced showed lower integrated copy numbers than a vector packaging signal (PSI) targeting assay that was unable to distinguish between integrated and unintegrated copy numbers. The results confirmed that the PSI method can select for plasmid contamination in the tested BCMA CAR-T batches (Table 2).

[0131] The method was also used for other CAR-T products, such as exemplary GPRc5d and KLK2 CAR-T products that are being developed. The amino acid sequences of the CARs comprise SEQ ID NOs: 20 and 22, respectively. Comparison of these results with the PSI method did not show any differences in VCN between the methods (Table 3). The results confirmed that there was no plasmid contamination during the GPRc5d CAR-T and KLK2 CAR-T batch production processes.

[0132] Example 5: Other CAR- T Quantification of integrated transgenes in products

[0133] The quantitative real-time PCR (qPCR) assay for quantifying integrated transgenes can also be used for other CAR-T products, such as those targeting GPRC5D. The method of Example 3 was used to determine CAR-T cell kinetics in mice studies as the VCN / cell mean or transgene copy / μg gDNA of GPRc5d CAR-T products in mouse blood.

[0134] Example 6: Quantification of integrated transgenes in CAR-T products followed by identification of transgenes

[0135] While the provirus qPCR method can be used to accurately estimate the VCN / cell of a batch of cell genomes integrated with a CAR-T transgene sequence, the qPCR method using primers that specifically hybridize to nucleotide sequences within the transgene can still be used to confirm the identity of the CAR transgene. This is because the provirus qPCR method is generic rather than transgene specific.

[0136] The design and execution of the transgene qPCR method is identical to that of the provirus qPCR method, differing only in the sequences and optional concentrations of the forward primer, reverse primer, and probe sequences of the transgene target. In the case of the transgene target encoding the CAR in the BCMA CAR-T product, which recognizes the target antigen BCMA, comprises the amino acid sequence of SEQ ID NO: 18, and is encoded by the nucleic acid sequence comprising SEQ ID NO: 19, we used a primer / probe set specific to the CD137 (4-1BB) and CD3 zeta-derived sequences of the CAR transgene. For each of the transgene forward and reverse primers, we used a concentration of 100 nM. For both methods, the human albumin (hALB) housekeeping gene oligonucleotides were identical, but the concentrations of the hALB forward and reverse primers were 75 nM in the transgene method.

[0137] Briefly, to perform the transgene qPCR method, a 5-point serial dilution of a mock transduced lymphocyte cell line was used to generate standard curves for both the transfer plasmid and human albumin (hALB). Genomic DNA isolated from post-collection samples was analyzed in triplicate. The copies of both the transgene and hALB were interpolated from the respective standard curves for each triplicate DNA sample. The average copies of hALB were used to estimate the number of cells from which the sample DNA was derived. The average copies of the transgene present in the sample DNA was divided by the estimated number of cells from which the sample DNA was derived to determine the number of vector copies per cell in the sample.

[0138] Table 1 - Sequences

[0139]

[0140]

[0141]

[0142]

[0143] Table 2 - BCMA tested using methods of the invention CAR-T production showed lower copy number of integration than targeting vector packaging signal (PSI) assays, which cannot distinguish between integrated and unintegrated copy number Table 3 - Comparison of VCN for CAR T products targeting KLK2 and GPRC5D using methods of the invention and PSI methods

[0144]

[0145] REFERENCES

[0146]

[0147] INCORPORATED BY REFERENCE

[0148] 1. Sadelain M, Brentjens R, Riviere I (2013) The Basic Principles of Chimerica Antigen Receptor (CAR) Design. Cancer Discov 3(4): 388-398.

[0149] 2. Titov A, Valiullina A, Zmievskaya E, Zaikova E, Petukhov A, Miftakhova R, Bulatov E, Rizvamov (2020) Advancing CAR T-Cell Therapy for Solid Tumors: Lessons Learned from Lymphoma Treatment. Cancer 12: 125-146.

[0150] 3. Charrier S, Ferrand M, Zerbato M, Precigout G, Viornery A, Bucher-Laurent S, Benkheilifa-Ziyyat S, Merten OW, Perea J, Galy A (2011) Quantification of Lentiviral Vector Copy Numbers in Individual Hematopoietic Colony-Forming Cells Shows Vector Dose-Dependent Effects on the Frequency and Level of Transduction. Gene Therapy 18: 479-487.

[0151] 4. Lizee G, Aerts JL, Gonzales MI, Chinnasamy N, Morgan RA, Topalian SL (2003) Real-Time Quantitative Reverse Transcriptase-Polymerase Chain Reaction As A Method For Determining Lentiviral Vector Titers And Measuring Transgene Expression. Hum Gene Ther. 14(6):497-507.

[0152] 5. Siegel R, Naishadham D, Jemal A (2012) Cancer statistics, 2012. CA: a cancer journal for clinicians 62: 10-29.

[0153] Particular embodiments of the invention are set out in the following numbered paragraphs:

[0154] 1. A method for quantifying integration of a recombinant vector nucleic acid into a cell genome, the method comprising:

[0155]

[0156] (a) providing a biological sample comprising a host cell genome;

[0157] (b) amplifying genomic DNA of the biological sample using a primer pair comprising a first oligonucleotide primer and a second oligonucleotide primer, wherein at least one oligonucleotide primer of the primer pair specifically hybridizes to an integrated recombinant vector polynucleotide sequence; and

[0158] (c) detecting and / or quantifying the genomic nucleic acid amplified by step (b).

[0159] 2. The method of paragraph 1, wherein the recombinant vector comprises a transgene.

[0160] 3. The method of paragraph 2, wherein the transgene encodes a chimeric antigen receptor.

[0161] 4. The method of any one of paragraphs 1 to 3, wherein the recombinant vector is a gene therapy vector.

[0162] 5. The method of paragraph 4, wherein the gene therapy vector is a viral vector.

[0163] 6. The method of any one of paragraphs 1 to 5, wherein the biological sample is a cell sample or a tissue sample.

[0164] 7. The method of paragraph 6, wherein the tissue sample is blood, plasma, serum, saliva, or a tissue biopsy.

[0165] 8. The method of any one of paragraphs 1 to 7, wherein the sample is from a subject.

[0166] 9. The method of paragraph 8, wherein the subject is a human.

[0167] 10. The method of any one of paragraphs 1 to 9, wherein the recombinant vector is a retroviral vector.

[0168] 11. The method of paragraph 10, wherein the retroviral vector is a lentiviral vector.

[0169] 12. The method of paragraph 11, wherein the lentivirus upon which the lentiviral vector is based is human immunodeficiency virus 1 (HIV-1) or human immunodeficiency virus 2 (HIV-2).​

[0170] 13. The method of any one of paragraphs 1 to 12, wherein the oligonucleotide primer that specifically hybridizes to the integrated recombinant vector polynucleotide sequence specifically hybridizes to an LTR sequence of the integrated recombinant vector sequence.

[0171] 14. The method of any one of paragraphs 1 to 13, wherein the oligonucleotide primer that specifically hybridizes to the integrated recombinant vector polynucleotide sequence in step (b) comprises the nucleic acid sequence of SEQ ID NO: 1, SEQ ID NO: 5, or SEQ ID NO: 14.

[0172] 15. The method of paragraph 14, wherein the second oligonucleotide primer used in step (b) to amplify the recombinant vector nucleic acid comprises the nucleic acid sequence of SEQ ID NO: 2, SEQ ID NO: 6, or SEQ ID NO: 15.

[0173] 16. The method of paragraph 11, wherein the oligonucleotide primer that specifically hybridizes to the integrated lentiviral vector polynucleotide sequence used in step (b) specifically hybridizes to the U3 region of the 5' LTR of the lentiviral vector nucleic acid sequence.

[0174] 17. The method of paragraph 11, wherein the oligonucleotide primer that specifically hybridizes to the integrated lentiviral vector polynucleotide sequence used in step (b) specifically hybridizes to the U3 region and the R region of the 5' LTR of the lentiviral vector nucleic acid sequence.

[0175] 18. The method of paragraph 11, wherein the oligonucleotide primer that specifically hybridizes to the integrated lentiviral vector polynucleotide sequence used in step (b) specifically hybridizes to the PBS region of the 5' LTR of the lentiviral vector nucleic acid sequence.

[0176] 19. The method of paragraph 11, wherein the oligonucleotide primer that specifically hybridizes to the integrated lentiviral vector polynucleotide sequence used in step (b) specifically hybridizes to the psi (Ψ) packaging signal.

[0177] 20. The method of any one of paragraphs 1 to 19, wherein the quantitative amplification technique is qPCR.

[0178] 21. The method of any one of paragraphs 1 to 19, wherein the quantitative amplification technique is dPCR or ddPCR.

[0179] 22. The method of any one of paragraphs 1 to 19, wherein the quantitative amplification technique is endpoint PCR.

[0180] 23. The method of any one of paragraphs 1 to 22, wherein step (b) utilizes a detectable nucleic acid probe that specifically hybridizes to the amplified recombinant vector nucleic acid.

[0181] 24. The method of paragraph 23, wherein the recombinant vector nucleic acid is a lentiviral vector.

[0182] 25. The method of paragraph 23 or paragraph 24, wherein the probe for the integrated recombinant vector nucleic acid specifically hybridizes to an LTR sequence of the integrated recombinant vector sequence.

[0183] 26. The method of paragraph 24, wherein the probe for the lentiviral vector nucleic acid used in step (b) specifically hybridizes to the U3 region and the R region of the 5' LTR of the lentiviral vector nucleic acid sequence.

[0184] 27. The method of paragraph 24, wherein the probe for the lentiviral vector nucleic acid used in step (b) specifically hybridizes to the U5 region and the PBS region of the 5' LTR of the lentiviral vector nucleic acid sequence.

[0185] 28. The method of paragraph 24, wherein the probe for the lentiviral vector nucleic acid used in step (b) specifically hybridizes to the PBS region of the 5' LTR of the lentiviral vector nucleic acid sequence.

[0186] 29. The method of paragraph 24, wherein the probe for the lentiviral vector nucleic acid used in step (b) specifically hybridizes to the R region and the U5 region of the 5' LTR of the lentiviral vector nucleic acid sequence.

[0187] 30. The method of any one of paragraphs 23 to 25, wherein the probe that specifically hybridizes to the recombinant vector nucleic acid comprises the nucleic acid sequence of SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 7, or SEQ ID NO: 16.

[0188] 31. A method for monitoring the transduction efficiency of a recombinant vector nucleic acid, the method comprising:

[0189] a) providing one or more biological samples comprising genomic DNA transduced by a recombinant vector nucleic acid, wherein a portion of the recombinant vector nucleic acid is integrated into the genomic DNA; and

[0190] b) quantifying the recombinant vector nucleic acid integrated in the host cell genome according to the method of any one of paragraphs 1 to 30.

[0191] 32. The method of any one of paragraphs 1 to 30, wherein step (c) further comprises comparing the integrated recombinant vector sequence copy number of the biological sample to a reference polynucleotide sequence.

[0192] 33. The method of paragraph 32, wherein the reference polynucleotide sequence encodes a housekeeping protein.

[0193] 34. The method of paragraph 33, wherein the housekeeping protein is human albumin.

[0194] 35. The method of any one of paragraphs 1 to 34, further comprising at least one pair of oligonucleotide primers that specifically amplify a reference polynucleotide sequence.

[0195] 36. The method of paragraph 31, further comprising comparing the integrated recombinant vector sequence copy number of the biological sample to a reference.

[0196] 37. A method of performing a lot release test on a cell product transduced by a recombinant vector, the method comprising

[0197] a) providing one or more biological samples from each lot of a cell product comprising genomic DNA transduced by a recombinant vector;

[0198] b) quantifying the recombinant vector nucleic acid integrated in the host cell genome in each biological sample according to the method of any one of paragraphs 1 to 35;

[0199] c) comparing the integrated recombinant vector sequence copy number quantified in step (b) for the biological sample to a reference; and

[0200] d) releasing the lot wherein the integrated recombinant vector sequence copy number passes a predetermined standard.

[0201] 38. A method of quantifying lentiviral vector nucleic acid integration into a cell genome, the method comprising:

[0202] (a) providing a biological sample comprising a host cell genome;

[0203] (b) amplifying genomic DNA of the biological sample using a primer pair comprising a first oligonucleotide primer and a second oligonucleotide primer, wherein at least one oligonucleotide primer of the primer pair specifically hybridizes to an integrated lentiviral vector polynucleotide sequence; and

[0204] (c) quantifying the lentiviral vector nucleic acid integrated in the host cell genome, wherein quantifying the lentiviral vector nucleic acid integrated in the host cell genome comprises comparing the ratio of amplified lentiviral vector nucleic acid to a reference.

[0205] wherein the oligonucleotide primer pair comprises the nucleic acid sequence of SEQ ID NO: 1 and the nucleic acid sequence of SEQ ID NO: 2, respectively, or the nucleic acid sequence of SEQ ID NO: 5 and the nucleic acid sequence of SEQ ID NO: 6, respectively, or the nucleic acid sequence of SEQ ID NO: 14 and the nucleic acid sequence of SEQ ID NO: 15, respectively.

[0206] 39. The method of any one of paragraphs 1 to 38, wherein step (b) utilizes an intercalating dye.

[0207] 40. The method of paragraph 39, wherein the intercalating dye is SYBR green.

[0208] 41. The method of any one of paragraphs 32 to 35, wherein the integrated recombinant vector sequence copy number and the reference polynucleotide sequence copy number are measured in a multiplexed manner.

[0209] 42. The method of any one of paragraphs 32 to 35, wherein the integrated recombinant vector sequence copy number and the reference polynucleotide sequence copy number are measured in a singleplexed manner.

[0210] 43. The method of paragraph 3, wherein the chimeric antigen receptor comprises the amino acid sequence of SEQ ID NO: 18, 20, or 22.

[0211] 44. The method of paragraph 3, wherein the chimeric antigen receptor recognizes BCMA, KLK2, or GPRC5D.

[0212] 45. The method of paragraph 2, further comprising a method for identifying the transgene.

[0213] 46. The method of paragraph 45, wherein the method for identifying the transgene comprises:

[0214] (a) providing a biological sample comprising a host cell genome;

[0215] (b) amplifying genomic DNA of the biological sample using a primer pair comprising a first oligonucleotide primer and a second oligonucleotide primer, wherein at least one oligonucleotide primer of the primer pair specifically hybridizes to the transgene; and

[0216] (c) detecting and / or quantifying the genomic nucleic acid amplified by step (b).

[0217] 47. The method of any one of paragraphs 32-35, wherein the method further comprises evaluating the effectiveness of an assay for quantifying integration of a recombinant vector nucleic acid by assessing one or more assay acceptance criteria selected from the group consisting of:

[0218] (a) the threshold cycle for both the provirus and the reference polynucleotide sequence is not determinable in all replicates of the no-template DNA control;

[0219] (b) the correlation coefficient of the standard curve for both the provirus and the reference polynucleotide sequence generated using linear regression from standard samples is greater than or equal to 0.97;

[0220] (c) the copy values for the provirus and the reference polynucleotide sequence estimated from the slope of the standard curve indicate a PCR efficiency between 90% and 110%;

[0221] (d) the threshold cycle for neither the provirus nor the reference polynucleotide sequence is not determinable in replicates of any of the standard samples;

[0222] (e) the average threshold cycle for both the provirus and the reference polynucleotide sequence in the base standard samples is less than or equal to 22.0;

[0223] (f) the standard deviation in the threshold cycle for both the provirus and the reference polynucleotide sequence in each standard sample is less than or equal to 0.60;

[0224] (g) the average measured copies of the reference polynucleotide sequence of the one or more positive control samples is within 30% of the nominal expected value;

[0225] (h) the measured average VCN / cell value of the one or more positive control samples is within 30% of the nominal expected VCN / cell value for each control; and

[0226] (i) the coefficient of variation for the VCN / cell value of the one or more positive control samples is less than or equal to 20%.

[0227] 48. The method of any one of paragraphs 32-35, wherein the method further comprises evaluating the effectiveness of the integration of the recombinant vector nucleic acid of the quantitative sample by assessing one or more sample acceptance criteria selected from the group consisting of:

[0228] (a) the average copy value of the reference polynucleotide sequence in the sample is within 30% of the expected value of 30,303.030 copies;

[0229] (b) if the genomic DNA (gDNA) concentration of the sample is less than 0.02 pg / pL, then the expected copy of the reference polynucleotide sequence of the sample is calculated from the amount of DNA actually loaded into the reaction;

[0230] (c) the average target proviral copy value in the sample is between the validated range of the copy values of the assay;

[0231] (d) the average target proviral copy value in the sample is between 121,212.121 and 193.939 copies;

[0232] (e) the coefficient of variation of the VCN / cell value of the target sample replicates is less than or equal to 20%; and

[0233] (f) the standard deviation in the cycle threshold values of both the target proviral and target reference polynucleotide sequences in the sample is less than or equal to 0.60.

[0234] 49. The method of paragraph 43 or 44, wherein the chimeric antigen receptor is a polypeptide encoded by a nucleic acid sequence comprising the sequence of SEQ ID NO: 19 or 21.

[0235] 50. The method of paragraph 45 or 46, wherein the transgene is a polypeptide encoded by a nucleic acid sequence comprising the sequence of SEQ ID NO: 19 or 21.

[0236] 51. An oligonucleotide comprising the nucleic acid sequence of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 14, SEQ ID NO: 15, or SEQ ID NO: 16.

[0237] 52. A kit for measuring the copy number of an integrated recombinant vector nucleic acid sequence, the kit comprising:

[0238] a primer of a primer pair, the primer of the primer pair specifically hybridizing to an integrated recombinant vector nucleic acid, wherein the primer pair specifically amplifies a portion of the integrated recombinant vector nucleic acid; and

[0239] a detectable nucleic acid probe that specifically hybridizes to the amplified recombinant vector nucleic acid.

[0240] 53. A kit for measuring the copy number of an integrated recombinant vector nucleic acid sequence, the kit comprising:

[0241] a forward primer that specifically hybridizes to the integrated recombinant vector nucleic acid comprising the nucleic acid sequence of SEQ ID NO: 1, SEQ ID NO: 5, or SEQ ID NO: 14;

[0242] a reverse primer that specifically hybridizes to the integrated recombinant vector nucleic acid comprising the nucleic acid sequence of SEQ ID NO: 2, SEQ ID NO: 6, or SEQ ID NO: 15; and

[0243] a detectable probe comprising the nucleic acid sequence of SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 7, or SEQ ID NO: 16.

[0244]

[0245] All publications and patents mentioned herein are hereby incorporated by reference in their entirety as if explicitly and individually incorporated by reference.

[0246] While specific embodiments of the disclosure have been discussed, the above specification is illustrative and not restrictive. Many variations of the disclosure will become apparent to those of skill in the art upon review of this specification and the claims below. The full scope of the disclosure should be determined by reference to the claims, along with their full scope of equivalents, and the specification, along with such variations. SEQUENCE LIST <110> JANSSEN PHARMACEUTICA NV <120> Compositions and methods for quantifying recombinant vector nucleic acid integration <130> PRD4079WOPCT1 <140> <141> <150> 63 / 148,300 <151> 2021-02-11 <150> 62 / 987,019 <151> 2020-03-09 <160> 22 <170> PatentIn version 3.5 <210> 1 <211> 25 <212> DNA <213> Artificial Sequence <220> <221> Source <223> COMMENT "Description of artificial sequence: synthetic primer" <400> 1 ctaattcact cccaacgaag acaag 25 <210> 2 <211> 21 <212> DNA <213> Artificial sequence <220> <221> SOURCE <223> COMMENT "Description of artificial sequence: synthetic primer" <400> 2 ggtttccctt tcgctttcaa g 21 <210> 3 <211> 16 <212> DNA <213> Artificial sequence <220> <221> SOURCE <223> COMMENT "Description of artificial sequence: synthetic probe" <400> 3 cgccactgct agagat 16 <210> 4 <211> 27 <212> DNA <213> Artificial sequence <220> <221> SOURCE <223> COMMENT "Description of artificial sequence: synthetic probe" <400> 4 gcttgtactg ggtctctctg gttagac 27 <210> 5 <211> 21 <212> DNA <213> Artificial sequence <220> <221> SOURCE <223> COMMENT "Description of artificial sequence: synthetic primer" <400> 5 ctgctttttg cttgtactgg g 21 <210> 6 <211> 21 <212> DNA <213> Artificial Sequence <220> <221> Source <223> / note=“SYNTHETIC PRIMER” <400> 6 gagagagctc ctctggtttc c 21 <210> 7 <211> 24 <212> DNA <213> Artificial Sequence <220> <221> Source <223> / note=“SYNTHETIC PROBE” <400> 7 ctttcaagtc cctgttcggg cgcc 24 <210> 8 <211> 22 <212> DNA <213> Artificial Sequence <220> <221> Source <223> / note=“SYNTHETIC PRIMER” <400> 8 tcatctcttg tgggctgtaa tc 22 <210> 9 <211> 21 <212> DNA <213> Artificial Sequence <220> <221> Source <223> / note=“SYNTHETIC PRIMER” <400> 9 tgctggttct ctttcactga c 21 <210> 10 <211> 25 <212> DNA <213> Artificial Sequence <220> <221> Source <223> COMMENT "Description of artificial sequence: synthetic probe" <400> 10 agggagagat ttgtgtgggc atgac 25 <210> 11 <211> 18 <212> DNA <213> Artificial Sequence <220> <221> SOURCE <223> COMMENT "Description of artificial sequence: synthetic probe" <400> 11 gatttgtgtg ggcatgac 18 <210> 12 <211> 15 <212> DNA <213> Artificial Sequence <220> <221> SOURCE <223> COMMENT "Description of artificial sequence: synthetic probe" <400> 12 ccctgttcgg gcgcc 15 <210> 13 <211> 300 <212> DNA <213> Artificial Sequence <220> <221> SOURCE <223> COMMENT "Description of artificial sequence: synthetic polynucleotide" <400> 13 ctggaagggc taattcactc ccaacgaaga caagatctgc tttttgcttg tactgggtct 60 ctctggttag accagatctg agcctgggag ctctctggct aactagggaa cccactgctt 120 aagcctcaat aaagcttgcc ttgagtgctt caagtagtgt gtgcccgtct gttgtgtgac 180 TCTGGTAAC T AGAGATCCC CT CAGACCCTT T TAGTCAGTGT GGAAAATCTC TAGCAGTGGC 240 GCCC GAAC AGGGACTTGAAGCGAAAGGGAACCAGAGGAGCTCTCTCGACGCAGGACTC 300 <210> 14 <211> 19 <212> DNA <213> Artificial Sequence <220> <221> SOURCE <223> / note=“Synthetic sequence description: Synthetic primer” <400> 14 TGCTTGTACT GGGTCTCTC 19 <210> 15 <211> 18 <212> DNA <213> Artificial Sequence <220> <221> SOURCE <223> / note=“Synthetic sequence description: Synthetic primer” <400> 15 GCGCCACTGC TAGAGATT 18 <210> 16 <211> 26 <212> DNA <213> Artificial Sequence <220> <221> SOURCE <223> / note=“Synthetic sequence description: Synthetic probe” <400> 16 TGCCTTGA GTGCTTCAAGT AGTGTGT 26 <210> 17 <211> 17 <212> DNA <213> Artificial Sequence <220> <221> SOURCE <223> / note=“Synthetic sequence description: Synthetic probe” <400> 17 tgcttcaagt agtgtgt 17 <210> 18 <211> 488 <212> PRT <213> Artificial Sequence <220> <221> Source <223> COMMENT="Description of artificial sequence: synthetic polypeptide" <400> 18 Met Ala Leu Pro Val Thr Ala Leu Leu Leu Pro Leu Ala Leu Leu Leu 1 5 10 15 His Ala Ala Arg Pro Gln Val Lys Leu Glu Glu Ser Gly Gly Gly Leu 20 25 30 Val Gln Ala Gly Arg Ser Leu Arg Leu Ser Cys Ala Ala Ser Glu His 35 40 45 Thr Phe Ser Ser His Val Met Gly Trp Phe Arg Gln Ala Pro Gly Lys 50 55 60 Glu Arg Glu Ser Val Ala Val Ile Gly Trp Arg Asp Ile Ser Thr Ser 65 70 75 80 Tyr Ala Asp Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala 85 90 95 Lys Lys Thr Leu Tyr Leu Gln Met Asn Ser Leu Lys Pro Glu Asp Thr 100 105 110 Ala Val Tyr Tyr Cys Ala Ala Arg Arg Ile Asp Ala Ala Asp Phe Asp Glu Val Thr Val Thr Val Ser Ser 45115 120 125 Ser Trp Gly Gin Gly Thr Gin Val Thr Val Ser Ser Gly Gly Gly Gly 130 135 140 Ser Glu Val Gin Leu Val Glu Ser Gly Gly Gly Leu Val Gin Ala Gly 145 150 155 160 Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Arg Thr Phe Thr Met 165 170 175 Gly Trp Phe Arg Gin Ala Pro Gly Lys Glu Arg Glu Phe Val Ala Ala 180 185 190 Ile Ser Leu Ser Pro Thr Leu Ala Tyr Tyr Ala Glu Ser Val Lys Gly 195 200 205 Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Thr Val Val Leu Gin 210 215 220 Met Asn Ser Leu Lys Pro Glu Asp Thr Ala Leu Tyr Tyr Cys Ala Ala 225 230 235 240 Asp Arg Lys Ser Val Met Ser Ile Arg Pro Asp Tyr Trp Gly Gin Gly 245 250 255 Thr Gin Val Thr Val Ser Ser Thr Ser Thr Thr Thr Pro Ala Pro Arg 260 265 270 Pro Pro Thr Pro Ala Pro Thr Ile Ala Ser Gin Pro Leu Ser Leu Arg 275 280 285 Pro Glu Ala Cys Arg Pro Ala Ala Gly Gly Ala Val His Thr Arg Gly 290 295 300 Leu Asp Phe Ala Cys Asp Ile Tyr Ile Trp Ala Pro Leu Ala Gly Thr 305 310 315 320 Cys Gly Val Leu Leu Leu Ser Leu Val Ile Thr Leu Tyr Cys Lys Arg 325 330 335 Gly Arg Lys Lys Leu Leu Tyr Ile Phe Lys Gln Pro Phe Met Arg Pro 340 345 350 Val Gln Thr Thr Gln Glu Glu Asp Gly Cys Ser Cys Arg Phe Pro Glu 355 360 365 Glu Glu Glu Gly Gly Cys Glu Leu Arg Val Lys Phe Ser Arg Ser Ala 370 375 380 Asp Ala Pro Ala Tyr Gln Gln Gly Gln Asn Gln Leu Tyr Asn Glu Leu 385 390 395 400 Asn Leu Gly Arg Arg Glu Glu Tyr Asp Val Leu Asp Lys Arg Arg Gly 405 410 415 Arg Asp Pro Glu Met Gly Gly Lys Pro Arg Arg Lys Asn Pro Gln Glu 420 425 430 Gly Leu Tyr Asn Glu Leu Gin Lys Asp Lys Met Ala Glu Ala Tyr Ser 435 440 445 Glu He Gly Met Lys Gly Glu Arg Arg Arg Gly Lys Gly His Asp Gly 450 455 460 Leu Tyr Gin Gly Leu Ser Thr Ala Thr Lys Asp Thr Tyr Asp Ala Leu 465 470 475 480 His Met Gin Ala Leu Pro Pro Arg 485 <210> 19 <211> 1467 <212> DNA <213> Artificial Sequence <220> <221> Source <223> COMMENT="Description of artificial sequence: synthetic polynucleotide" <400> 19 atggctctgc ccgtcaccgc tctgctgctg cctctggctc tgctgctgca cgctgctcgc 60 cctcaggtca aactggaaga atctggcgga ggcctggtgc aggcaggacg gagcctgcgc 120 ctgagctgcg cagcatccga gcacaccttc agctcccacg tgatgggctg gtttcggcag 180 gccccaggca aggagagaga gagcgtggcc gtgatcggct ggagggacat ctccacatct 240 tacgccgatt ccgtgaaggg ccggttcacc atcagccggg acaacgccaa gaagacactg 300 TATCTGCAGA TGAACAGCCT GAAGCCCGAG GACACCGCCG TGACTATTGC GCAGCAAGG 360 AGAATCGACG CAGCAGACTT TGATTCCCGG GGCCAGGGCA CCCAGGTGAC AGTGTC TAGC 420 GGAGGAGGAG GATCTGAGGT GCAGCTGGTG GAGAGCGGAG GCAGCCTGGT GCAGGCCGGA 480 GGCTCTCTGA GGCTGAGCTG TGCAGCATCC GGAAGAACCCT TCACAATGGG CTGTTAGG 540 CAGGCACCA GGAAAGGAGA GGGAGTTCGT GGCAGCAATC A GCCTGTCCC CTACCCTGGC 600 TACTATGCCG AGAGCGTGAA GGGCAGGTTT ACCATCTCCC GCGATAACGC CAAGAATACA 660 GTGGTGCTGC AGATGAAC TCCTGAAACCT GAGGACACAG CCCTGTACTA TTGTGCCGCC 720 GATCGGAAGA GC GTGATGAG CAT TAGACCA GACTATTGGG GG C AGGGAAC AC AGGTGACC 780 GTGAGCAGCA C TAGTACCAC GACGCCAGCG CC GC GACCAC CAACACC GGC G CCC ACC ATC 840 GC GTC GC AGC CCCTGTCCCT GCGCCCAGAG GC GTGCCGGC C AGCGGC GGG GGGGC GC AGTG 900 CACACGAGGG GGCTGGACTT C GCCTGTGAT ATCTACATCT GGGCGCCCTT GGCCGGGACT 960 TGTGGGGTCC TTCTCCTGTC ACTG GTTATC ACCCTTTACT GCA AACGGGG C AGAAAGAAA 1020 ctcctgtata tattcaaaca accatttatg agaccagtac aaactactca agaggaagat 1080 ggctgtagct gccgatttcc agaagaagaa gaaggaggat gtgaactgag agtgaagttc 1140 agcaggagcg cagacgcccc cgcgtaccag cagggccaga accagctcta taacgagctc 1200 aatctaggac gaagagagga gtacgatgtt ttggacaaga gacgtggccg ggaccctgag 1260 atggggggaa agccgagaag gaagaaccct caggaaggcc tgtacaatga actgcagaaa 1320 gataagatgg cggaggccta cagtgagatt gggatgaaag gcgagcgccg gaggggcaag 1380 gggcacgatg gcctttacca gggtctcagt acagccacca aggacaccta cgacgccctt 1440 cacatgcagg ccctgccccc tcgctaa 1467 <210> 20 <211> 474 <212> PRT <213> Artificial Sequence <220> <221> Source <223> / Note="Description of artificial sequence: synthetic polypeptide" <400> 20 Asp Ile Val Met Thr Gln Thr Pro Leu Ser Ser Pro Val Thr Leu Gly 1 5 10 15 Gln Pro Ala Ser Ile Ser Cys Arg Ser Ser Gln Ser Leu Val His Ser 20 25 30 Asp Gly Asn Thr Tyr Leu Ser Trp Leu Gln Gln Arg Pro Gly Gln Pro 35 40 45 Pro Arg Leu Leu Ile Tyr Lys Ile Ser Asn Arg Phe Phe Gly Val Pro 50 55 60 Asp Arg Phe Ser Gly Ser Gly Ala Gly Thr Asp Phe Thr Leu Lys Ile 65 70 75 80 Ser Arg Val Glu Ala Glu Asp Val Gly Val Tyr Tyr Cys Met Gln Ala 85 90 95 Thr Gln Phe Pro His Thr Phe Gly Gln Gly Thr Lys Leu Glu Ile Lys 100 105 110 Gly Gly Ser Glu Gly Lys Ser Ser Gly Ser Gly Ser Glu Ser Lys Ser 115 120 125 Thr Gly Gly Ser Gln Val Thr Leu Lys Glu Ser Gly Pro Val Leu Val 130 135 140 Lys Pro Thr Glu Thr Leu Thr Leu Thr Cys Thr Val Ser Gly Phe Ser 145 150 155 160 Leu Thr Asn Ile Arg Met Ser Val Ser Trp Ile Arg Gln Pro Pro Gly 165 170 175 Lys Ala Leu Glu Trp Leu Ala His Ile Phe Ser Asn Asp Glu Lys Ser 180 185 190 Tyr Ser Ser Ser Leu Lys Ser Arg Leu Thr Ile Ser Arg Asp Thr Ser 195 200 205 Lys Ser Gln Val Val Leu Thr Leu Thr Asn Val Asp Pro Val Asp Thr 210 215 220 Ala Thr Tyr Tyr Cys Ala Arg Met Arg Leu Pro Tyr Gly Met Asp Val 225 230 235 240 Trp Gly Gln Gly Thr Thr Val Thr Val Ser Ser Thr Ser Thr Pro Ala 245 250 255 Pro Arg Pro Pro Thr Pro Ala Pro Thr Ile Ala Ser Gln Pro Leu Ser 260 265 270 Leu Arg Pro Glu Ala Cys Arg Pro Ala Ala Gly Gly Ala Val His Thr 275 280 285 Arg Gly Leu Asp Phe Ala Cys Asp Ile Tyr Ile Trp Ala Pro Leu Ala 290 295 300 Gly Thr Cys Gly Val Leu Leu Leu Ser Leu Val Ile Thr Leu Tyr Cys 305 310 315 320 Lys Arg Gly Arg Lys Lys Leu Leu Tyr Ile Phe Lys Gln Pro Phe Met 325 330 335 Arg Pro Val Gln Thr Thr Gln Glu Glu Asp Gly Cys Ser Cys Arg Phe 340 345 350 Pro Glu Glu Glu Glu Gly Gly Cys Glu Leu Arg Val Lys Phe Ser Arg 355 360 365 Ser Ala Asp Ala Pro Ala Tyr Lys Gln Gly Gln Asn Gln Leu Tyr Asn 370 375 380 Glu Leu Asn Leu Gly Arg Arg Glu Glu Tyr Asp Val Leu Asp Lys Arg 385 390 395 400 Arg Gly Arg Asp Pro Glu Met Gly Gly Lys Pro Arg Arg Lys Asn Pro 405 410 415 Gln Glu Gly Leu Tyr Asn Glu Leu Gln Lys Asp Lys Met Ala Glu Ala 420 425 430 Tyr Ser Glu Ile Gly Met Lys Gly Glu Arg Arg Arg Gly Lys Gly His 435 440 445 Asp Gly Leu Tyr Gln Gly Leu Ser Thr Ala Thr Lys Asp Thr Tyr Asp 450 455 460 Ala Leu His Met Gln Ala Leu Pro Pro Arg 465 470 <210> 21 <211> 1482 <212> DNA <213> Artificial Sequence <220> <221> Source <223> / note=“synthetic sequence description: synthetic polynucleotide” <400> 21 atggcttggg tgtggacctt gctattcctg atggcagctg cccaaagtat acaggccgac 60 attgtgatga cccaaacacc tcttagtagt cctgtaactc tcggacagcc agcttcaata 120 tcttgtcgct caagtcaatc cctcgtccat tccgacggca acacctacct ctcttggctc 180 caacagagac ccggccagcc tcccagactt ctcatctaca aaatcagtaa caggttcttc 240 ggcgtccctg acaggttcag tggatctgga gcaggtacag atttcacctt gaagataagt 300 agagtggagg ctgaggacgt aggcgtctat tattgtatgc aagctaccca attcccacat 360 acattcggcc aaggcactaa attggaaata aaaggcggct ccgagggcaa gagcagcggc 420 agcggcagcg agagcaagag caccggcggc agccaagtaa cactcaagga gagcggacca 480 gtcttggtga aaccaactga gaccttgact ttgacatgta ctgtaagtgg cttcagcctt 540 accaacatca ggatgtcagt atcttggata aggcaaccac ctggcaaggc actcgaatgg 600 ctggcacaca tcttttctaa cgacgaaaaa tcctattctt ccagtctcaa aagtcgcctt 660 accatcagcc gagataccag taagagtcaa gtagttctta cattgaccaa tgtagatcca 720 gttgatacag ccacatacta ctgcgcacga atgcggcttc catacggcat ggatgtatgg 780 ggacaggga ctactgttac cgttagttcc actagtaccc cgccccacg ccctcccacc cctgctccta caatagcatc ccagcccttg tcacttcgcc ccgaagcatg cagaccagcc gcaggcggtg ctgtgcatac ccgaggactg gacttcgcct gcgacatcta catctgggcc 960 ccactggccg gcacctgcgg cgtgctgctg ctgagcctgg tgatcaccct gtactgcaag 1020 cgcggccgca agagctgct gtacatcttc agcagccat tcatgcgccc agtgcagacc 1080. acccaggagg aggacggctg cagctgccgc ttcccagagg aggaggg cggctgcgag 1140 ctgcgcgtga agttcagccg cagcgccgac gccccagcct acaagcaggg ccagaaccag ctgtacaacg agctgaacct gggccgccgc gaggagtacg acgtgctgga caagcgccgc ggccgcgacc cagagatggg cggcaagcca cgccgcaaga acccacagga gggcctgtac 1320 aacgagctgc agaaggacaa gatggccgag gcctacagcg agatcggcat gaagggcgag cgccgccgcg gcaagggcca cgacggcctg taccagggcc tgagcaccgc caccaaggac 1440 acctacgacg ccctgcacat gcaggccctg ccaccacgct ga 1482 <210> 22 <211> 474 <212> PRT <213> Artificial Sequence <220> <221> Source <223> COMMENT="Description of artificial sequence: synthetic polypeptide" <400> 22 Glu Ile Val Leu Thr Gln Ser Pro Ser Phe Leu Ser Ala Ser Val Gly 1 5 10 15 Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Gly Ile Ser Ser Tyr 20 25 30 Leu Ser Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile 35 40 45 Tyr Ala Thr Ser Thr Leu Gln Ser Gly Val Pro Ser Arg Phe Ser Gly 50 55 60 Ser Gly Ser Gly Thr Glu Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro 65 70 75 80 Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Leu Asn Ser Tyr Pro Arg 85 90 95 Thr Phe Gly Gln Gly Thr Lys Val Glu Ile Lys Gly Gly Ser Glu Gly 100 105 110 Lys Ser Ser Gly Ser Gly Ser Glu Ser Lys Ser Thr Gly Gly Ser Glu 115 120 125 Val Gin Leu Val Glu Ser Gly Gly Gly Leu Val Gin Pro Gly Gly Ser 130 135 140 Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr Trp 145 150 155 160 Met Thr Trp Val Arg Gin Ala Pro Gly Lys Gly Leu Glu Trp Val Ala 165 170 175 Asn lie Lys Gin Asp Gly Ser Glu Arg Tyr Tyr Val Asp Ser Val Lys 180 185 190 Gly Arg Phe Thr lie Ser Arg Asp Asn Ala Lys Asn Ser Leu Tyr Leu 195 200 205 Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys Ala 210 215 220 Arg Asp Gin Asn Tyr Asp lie Leu Thr Gly His Tyr Gly Met Asp Val 225 230 235 240 Trp Gly Gin Gly Thr Thr Val Thr Val Ser Ser Thr Ser Thr Pro Ala 245 250 255 Pro Arg Pro Pro Thr Pro Ala Pro Thr lie Ala Ser Gin Pro Leu Ser 260 265 270 Leu Arg Pro Glu Ala Cys Arg Pro Ala Ala Gly Gly Ala Val His Thr 275 280 285 Arg Gly Leu Asp Phe Ala Cys Asp Ile Tyr Ile Trp Ala Pro Leu Ala 290 295 300 Gly Thr Cys Gly Val Leu Leu Leu Ser Leu Val Ile Thr Leu Tyr Cys 305 310 315 320 Lys Arg Gly Arg Lys Lys Leu Leu Tyr Ile Phe Lys Gln Pro Phe Met 325 330 335 Arg Pro Val Gln Thr Thr Gln Glu Glu Asp Gly Cys Ser Cys Arg Phe 340 345 350 Pro Glu Glu Glu Glu Gly Gly Cys Glu Leu Arg Val Lys Phe Ser Arg 355 360 365 Ser Ala Asp Ala Pro Ala Tyr Lys Gln Gly Gln Asn Gln Leu Tyr Asn 370 375 380 Glu Leu Asn Leu Gly Arg Arg Glu Glu Tyr Asp Val Leu Asp Lys Arg 385 390 395 400 Arg Gly Arg Asp Pro Glu Met Gly Gly Lys Pro Arg Arg Lys Asn Pro 405 410 415 Gln Glu Gly Leu Tyr Asn Glu Leu Gln Lys Asp Lys Met Ala Glu Ala 420 425 430 Tyr Ser Glu lie Gly Met Lys Gly Glu Arg Arg Arg Gly Lys Gly His 435 440 445 Asp Gly Leu Tyr Gin Gly Leu Ser Thr Ala Thr Lys Asp Thr Tyr Asp 450 455 460 Ala Leu His Met Gin Ala Leu Pro Pro Arg 465 470

Claims

1. A method for quantifying integration of a recombinant vector nucleic acid into a cell genome, the method comprising: (a) providing a biological sample comprising a host cell genome; (b) amplifying genomic DNA of the biological sample using a primer pair comprising a first oligonucleotide primer and a second oligonucleotide primer, wherein at least one oligonucleotide primer of the primer pair specifically hybridizes to an integrated recombinant vector polynucleotide sequence; and (c) detecting and / or quantifying the genomic nucleic acid amplified by step (b), wherein the recombinant vector is a self-inactivating lentiviral vector having a ΔU3 modification in its 3' LTR and the U3 region of its 5' LTR is replaced with a heterologous promoter, such that upon integration into the host genome, the 5' LTR of the integrated vector lacks a wild-type U3 region, wherein the oligonucleotide primer used in step (b) that specifically hybridizes to an integrated recombinant vector polynucleotide sequence specifically hybridizes to the U3 region of the 5' LTR of the integrated recombinant vector, wherein the oligonucleotide primer pair is the nucleic acid sequence of SEQ ID NO: 1 and the nucleic acid sequence of SEQ ID NO: 2, respectively, or the nucleic acid sequence of SEQ ID NO: 5 and the nucleic acid sequence of SEQ ID NO: 6, respectively, or the nucleic acid sequence of SEQ ID NO: 14 and the nucleic acid sequence of SEQ ID NO: 15, respectively.

2. The method of claim 1, wherein the recombinant vector comprises a transgene.

3. The method of claim 2, wherein the transgene encodes a chimeric antigen receptor.

4. The method of claim 1, wherein the recombinant vector is a gene therapy vector.

5. The method of claim 1, wherein the lentivirus on which the lentiviral vector is based is human immunodeficiency virus 1 (HIV-1) or human immunodeficiency virus 2 (HIV-2).

6. The method of claim 1, wherein the biological sample is a cell sample or a tissue sample.

7. The method of claim 6, wherein the tissue sample is blood, plasma, serum, saliva, or a tissue biopsy.

8. The method of claim 1, wherein the oligonucleotide primer used in step (b) that specifically hybridizes to an integrated lentiviral vector polynucleotide sequence specifically hybridizes to the U3 region and the R region of the 5' LTR of the lentiviral vector nucleic acid sequence.

9. The method of claim 1, wherein the oligonucleotide primer used in step (b) that specifically hybridizes to an integrated lentiviral vector polynucleotide sequence specifically hybridizes to the PBS region of the 5' LTR of the lentiviral vector nucleic acid sequence.

10. The method of claim 1, wherein step (c) further comprises comparing the integrated recombinant vector sequence copy number of the biological sample to a reference polynucleotide sequence.

11. The method of claim 1, wherein the quantitative amplification technique is qPCR.

12. The method of claim 1, wherein the quantitative amplification technique is dPCR or ddPCR.

13. The method of claim 10, wherein the reference polynucleotide sequence encodes a housekeeping protein.

14. The method of claim 13, wherein the housekeeping protein is human albumin.

15. The method of claim 1, wherein step (b) utilizes a detectable nucleic acid probe that specifically hybridizes to the amplified recombinant vector nucleic acid.

16. The method of claim 15, wherein the recombinant vector nucleic acid is a lentiviral vector.

17. The method of claim 15, wherein the probe that specifically hybridizes to the recombinant vector nucleic acid comprises the nucleic acid sequence of SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 7, or SEQ ID NO:

16.

18. The method of claim 15, wherein the probe for the integrated recombinant vector nucleic acid specifically hybridizes to the LTR sequence of the integrated recombinant vector sequence.

19. The method of claim 16, wherein the probe for the lentiviral vector nucleic acid used in step (b) specifically hybridizes to the U3 region and R region of the 5' LTR of the lentiviral vector nucleic acid sequence.

20. The method of claim 16, wherein the probe for the lentiviral vector nucleic acid used in step (b) specifically hybridizes to the U5 region and PBS region of the 5' LTR of the lentiviral vector nucleic acid sequence.

21. The method of claim 16, wherein the probe for the lentiviral vector nucleic acid used in step (b) specifically hybridizes to the PBS region of the 5' LTR of the lentiviral vector nucleic acid sequence.

22. The method of claim 1, wherein the oligonucleotide primer that specifically hybridizes to the integrated lentiviral vector polynucleotide sequence used in step (b) specifically hybridizes to the psi (Ψ) packaging signal.

23. The method of claim 16, wherein the probe for the lentiviral vector nucleic acid used in step (b) specifically hybridizes to the R region and U5 region of the 5' LTR of the lentiviral vector nucleic acid sequence.

24. The method of claim 1, wherein the biological sample is from a subject.

25. The method of claim 24, wherein the subject is a human.

26. The method of claim 1, further comprising at least one pair of oligonucleotide primers that specifically amplify a reference polynucleotide sequence.

27. A method for monitoring the transduction efficiency of a recombinant vector nucleic acid, the method comprising: a) providing one or more biological samples comprising genomic DNA transduced by a recombinant vector nucleic acid, wherein a portion of the recombinant vector nucleic acid is integrated into the genomic DNA; and b) quantifying the recombinant vector nucleic acid integrated in the host cell genome according to the method of claim 1. ​ 28. The method of claim 27, further comprising comparing the integrated recombinant vector sequence copy number of the biological sample to a reference.

29. A method of performing a batch release test on a cell product transduced by a recombinant vector, the method comprising a) providing one or more biological samples from each batch of a cell product comprising genomic DNA transduced by a recombinant vector; b) quantifying the recombinant vector nucleic acid integrated in the host cell genome in each biological sample according to the method of claim 1 ; c) comparing the integrated recombinant vector sequence copy number quantified in step (b) for the biological sample to a reference; and d) releasing the batch where the integrated recombinant vector sequence copy number passes a pre-determined standard.

30. A method of quantifying lentiviral vector nucleic acid integration into a cell genome, the method comprising: (a) providing a biological sample comprising a host cell genome; (b) amplifying genomic DNA of the biological sample using a primer pair comprising a first oligonucleotide primer and a second oligonucleotide primer, wherein at least one oligonucleotide primer of the primer pair specifically hybridizes to an integrated lentiviral vector polynucleotide sequence; and (c) quantifying the genomic nucleic acid amplified by step (b), wherein quantifying the lentiviral vector nucleic acid integrated in the host cell genome comprises comparing the ratio of amplified lentiviral vector nucleic acid to a reference, wherein the oligonucleotide primer pair is respectively the nucleic acid sequence of SEQ ID NO: 1 and the nucleic acid sequence of SEQ ID NO: 2, or respectively the nucleic acid sequence of SEQ ID NO: 5 and the nucleic acid sequence of SEQ ID NO: 6, or respectively the nucleic acid sequence of SEQ ID NO: 14 and the nucleic acid sequence of SEQ ID NO: 15, wherein the recombinant vector is a self-inactivating lentiviral vector having a ΔU3 modification in its 3' LTR and the U3 region of its 5' LTR is replaced with a heterologous promoter, such that upon integration into a host genome, the 5' LTR of the integrated vector lacks a wild-type U3 region.

31. A kit for measuring integrated recombinant vector nucleic acid sequence copy number, the kit comprising: a forward primer that specifically hybridizes to an integrated recombinant vector nucleic acid; a reverse primer that specifically hybridizes to an integrated recombinant vector nucleic acid; and a detectable probe, wherein the forward primer, reverse primer, and probe are selected from the following combinations: the forward primer is the nucleic acid sequence of SEQ ID NO: 1, the reverse primer is the nucleic acid sequence of SEQ ID NO: 2, and the probe comprises the nucleic acid sequence of SEQ ID NO: 3 or SEQ ID NO: 4; the forward primer is the nucleic acid sequence of SEQ ID NO: 5, the reverse primer is the nucleic acid sequence of SEQ ID NO: 6, and the probe comprises the nucleic acid sequence of SEQ ID NO: 7; or the forward primer is the nucleic acid sequence of SEQ ID NO: 14, the reverse primer is the nucleic acid sequence of SEQ ID NO: 15, and the probe comprises the nucleic acid sequence of SEQ ID NO:

16. the forward primer is the nucleic acid sequence of SEQ ID NO: 14, the reverse primer is the nucleic acid sequence of SEQ ID NO: 15, and the probe comprises the nucleic acid sequence of SEQ ID NO: 16; wherein the recombinant vector is a self-inactivating lentiviral vector having a ΔU3 modification in its 3' LTR and the U3 region of its 5' LTR is replaced with a heterologous promoter, such that upon integration into the host genome, the 5' LTR of the integrated vector lacks a wild-type U3 region.

32. The method of claim 3, wherein the chimeric antigen receptor comprises the amino acid sequence of SEQ ID NO: 18, 20, or 22.

33. The method of claim 3, wherein the chimeric antigen receptor recognizes BCMA, KLK2, or GPRC5D.

34. The method of claim 1, wherein the quantitative amplification technique is end-point PCR.

35. The method of claim 1, wherein step (b) utilizes an intercalating dye.

36. The method of claim 35, wherein the intercalating dye is SYBR green.

37. The method of claim 10, wherein the integrated recombinant vector sequence copy number and the reference polynucleotide sequence copy number are measured in a multiplexed manner.

38. The method of claim 10, wherein the integrated recombinant vector sequence copy number and the reference polynucleotide sequence copy number are measured in a singleplexed manner.

39. The method of claim 2, further comprising a method for identifying the transgene.

40. The method of claim 39, wherein the method for identifying the transgene comprises: (a) providing a biological sample comprising a host cell genome; (b) amplifying genomic DNA of the biological sample using a primer pair comprising a first oligonucleotide primer and a second oligonucleotide primer, wherein at least one oligonucleotide primer of the primer pair specifically hybridizes to the transgene; and (c) detecting and / or quantifying the genomic nucleic acid amplified by step (b).

41. The method of claim 10, wherein the method further comprises evaluating the effectiveness of an assay for quantifying recombinant vector nucleic acid integration by assessing one or more acceptance criteria selected from the group consisting of: (a) the threshold cycle for both the provirus and the reference polynucleotide sequence is not determinable in all replicates of a no-template DNA control; (b) the correlation coefficient of a standard curve for both the provirus and the reference polynucleotide sequence generated using linear regression from standard samples is greater than or equal to 0.97; (c) the copy values for provirus and reference polynucleotide sequence estimated from the slope of the standard curve indicate a PCR efficiency of between 90% and 110%; (d) the threshold cycle for neither the provirus nor the reference polynucleotide sequence is not determinable in a replicate of any of the standard samples; (e) The average threshold cycle of both the provirus and the reference polynucleotide sequence in the baseline standard sample is less than or equal to 22.0; (f) The standard deviation of the threshold cycle for both the provirus and the reference polynucleotide sequence in each standard sample is less than or equal to 0.60; (g) The average measured copy number of the reference polynucleotide sequence in the one or more positive control samples is within 30% of the nominal expected value; (h) The measured mean VCN / cell value of the one or more positive control samples is within 30% of the nominal expected VCN / cell value for each control; and (i) The coefficient of variation of the VCN / cell value of the one or more positive control samples is less than or equal to 20%.

42. The method of claim 10, wherein the method further comprises evaluating the effectiveness of the integration of the recombinant vector nucleic acid of the quantitative sample by assessing one or more sample acceptance criteria selected from the group consisting of: (a) The average copy value of the reference polynucleotide sequence in the sample is within 30% of the expected value of 30,303.030 copies; (b) If the concentration of genomic DNA (gDNA) in the sample is less than 0.02 µg / µL, the expected copy of the reference polynucleotide sequence of the sample shall be calculated based on the amount of DNA actually loaded into the reaction; (c) The average pre-target viral copy number in the sample is within the validation range of the measured copy number; (d) The average pre-target viral copy number in the sample was between 121, 212.121 and 193.939 copies; (e) The coefficient of variation of the VCN / cell ratio of the target sample replica is less than or equal to 20%; and (f) The standard deviation of the cycle thresholds of both the pre-target virus and the target reference polynucleotide sequence in the sample is less than or equal to 0.

60.

43. The method of claim 32, wherein the chimeric antigen receptor is a polypeptide encoded by a nucleic acid sequence comprising the sequence of SEQ ID NO: 19 or 21.

44. The method of claim 39, wherein the transgene is a polypeptide encoded by a nucleic acid sequence comprising the sequence of SEQ ID NO: 19 or 21.

Citation Information

Patent Citations

  • Method for amplifying nucleic acid sequence and reagent kid therefor

    JP1992262799A

  • Quantitative amplification normalization with quenchers

    US20190284610A1

  • Process for amplifying, detecting, and / or-cloning nucleic acid sequences

    US4683195A

  • Process for amplifying nucleic acid sequences

    US4683202A

  • Process for amplifying, detecting, and / or cloning nucleic acid sequences

    US4800159A