A kind of aminolysis solution and its preparation method and application in DNA solid phase synthesis

Abstract

The present invention provides an ammonolysis solution, a preparation method thereof, and an application thereof in solid phase DNA synthesis. The ammonolysis solution comprises propylenediamine, alcohol, and an alkaline reagent. The preparation method of the ammonolysis solution comprises mixing an alkaline reagent with water and alcohol to obtain the ammonolysis solution. The application of the ammonolysis solution in solid phase DNA synthesis comprises: (1) adding an ammonolysis solution to a solid synthesis column bound with a target DNA; (2) placing the solid synthesis column in a container filled with an ammonolysis buffer, heating it, and then cooling it; (3) taking out the solid synthesis column, drying, washing, and centrifuging it in sequence; (4) then eluting the solid synthesis column, collecting the effluent, and the effluent containing the target DNA. The new generation of ammonolysis solution used in the present invention has a simple formula, can avoid the occurrence of side reactions on base C compared with the first generation of ammonolysis solution, and has low cost, which can better realize commercialization and industrialization.

Description

Technical Field

[0001] The invention belongs to the field of nucleic acid solid phase synthesis, and relates to an aminolysis solution and a preparation method thereof and application thereof in DNA solid phase synthesis. Background Art

[0002] Short-chain DNA is also called oligonucleotide (Oligo), and its synthesis is usually achieved by solid phase synthesis technology. Solid phase synthesis technology uses controlled pore glass balls (CPG) as solid phase carriers and phosphoramidites as monomers. It is a process of gradually connecting the target sequence in the 3'-5' direction through four reactions of deprotection, condensation, oxidation and capping. Since each step product is connected to the solid phase carrier, solid phase synthesis has the advantages of simple operation and simple post-processing. This technology has been widely used in the synthesis of oligos and peptides.

[0003] At present, in the solid phase synthesis process of oligo, each connection of a base needs to go through four reactions: deprotection, condensation, oxidation and capping. After all the target bases are synthesized, the oligo is cut off from the solid phase support. However, since the A, C, and G bases contain active amino groups, they will interfere with the condensation reaction. Therefore, acetyl (Ac), benzoyl (Bz) and dinitromethylformamidine (dmf) are generally used to protect the active amino groups on the bases. After the reaction is completed, the Ac, Bz and dmf groups are removed. Here, the reaction of cutting the oligo from the solid phase support and removing the protective group is called the aminolysis reaction. The aminolysis reaction mainly includes: (1) cutting the oligo from the solid phase support to expose the 3'-OH of the oligo; (2) removing the protective groups Ac, Bz, and dmf on the A, C, and G bases; (3) removing the cyanoethyl group of each phosphoramidite.

[0004] The earliest ammonia reaction used ammonia water, but there were problems such as long operation time, high risk of cross-contamination, and cumbersome post-processing. Even though the subsequent use of the improved methylamine: ammonia water = 1:1 (AMA) system can greatly reduce the reaction time, there are still problems of cross-contamination and cumbersome post-processing. Subsequently, researchers developed gas-phase ammonia solution, which uses ammonia as the active medium and reacts at high temperature and high pressure. Although it is fast and efficient, it has high requirements for equipment, has safety hazards, and may damage the primer structure. Therefore, it is crucial to find a more effective and simple ammonia solution method.

[0005] CN109956987A discloses a microwave ammonolysis method as an alternative process, using microwaves as a heating means to carry out the reaction. However, in the actual operation process, there are problems such as uneven heating and liquid boiling, resulting in losses and cross contamination.

[0006] CN111704644A discloses an ammonolysis solution and an ammonolysis method, which include amine, butanol, amino alcohol and alkaline aqueous solution. The ammonolysis time is short and the steps are simple. At the same time, the gas phase ammonolysis has high equipment requirements and the damage of primers by high temperature and high pressure can be effectively solved. However, the ammonolysis solution uses up to 80% of organic amine as an active ingredient, resulting in a part of the amino group on the base C being replaced by the organic amine in the ammonolysis solution, causing the structure of the base C to change, which is likely to affect subsequent biological processes such as PCR amplification. At the same time, the first generation of liquid phase ammonolysis uses 1-amino-pentanol, which is more expensive, as a raw material, and is equivalent to gas phase ammonolysis in cost.

[0007] Therefore, developing a new aminolysis solution to avoid the side reaction of base C while ensuring the output and quality of Oligo and not increasing the reaction time has become an urgent problem to be solved. Summary of the invention

[0008] In view of the deficiencies in the prior art and actual needs, the present invention provides an aminolysis solution and a preparation method thereof and an application in DNA solid phase synthesis. The aminolysis solution has a simple and mild formula, is inexpensive, fast and effective, and can avoid side reactions on the bases during the aminolysis process, ultimately being able to obtain high-yield, high-quality oligonucleotides.

[0009] In order to achieve the purpose of the invention, the present invention adopts the following technical solutions:

[0010] In a first aspect, the present invention provides an ammonolysis solution, comprising: propylenediamine, an alkaline reagent and an alcohol.

[0011] In the present invention, propylenediamine cooperates with alcohol and alkaline reagent to cut the synthesized oligonucleotide from the solid phase carrier and remove the protecting groups Ac, Bz and dmf on the bases A, C and G. Meanwhile, propylenediamine can provide two amine molecules, thereby improving the reaction activity of each organic amine molecule. Moreover, propylenediamine has a large steric hindrance, thereby greatly reducing the chance of the base C having a side reaction.

[0012] Preferably, the propylenediamine includes 1,2-propylenediamine.

[0013] Preferably, the volume concentration of propylenediamine in the ammonolysis solution is 5-20%, for example, it can be 5%, 8%, 10%, 15% or 20%, etc., but is not limited to the listed values, and the same applies to other values ​​within this range.

[0014] In the present invention, 1,2-propylenediamine is preferably used as the active ingredient of the ammonolysis solution. One molecule has two primary amines, which can further improve the reactivity of each organic amine molecule. Moreover, due to the large steric hindrance, the side reaction of the base C can be effectively avoided, and the base C can cooperate with the alcohol and the alkaline reagent to exert more efficient ammonolysis activity and realize an efficient ammonolysis reaction.

[0015] Preferably, the alkaline reagent includes KOH reagent, LiOH reagent, NaOH reagent, Be(OH) 2 Reagents, Mg(OH) 2 Reagent or Ca(OH) 2 Any one or a combination of at least two of the reagents, for example, the combination can be a combination of KOH reagent and LiOH reagent, a combination of LiOH reagent and NaOH reagent, etc., and any other combinations can be selected and will not be described here one by one.

[0016] Preferably, the concentration of the alkaline agent in the ammonolysis solution is 0.02-0.08 M, for example, it can be 0.02 M, 0.03 M, 0.04 M, 0.05 M, 0.06 M, 0.07 M or 0.08 M, but is not limited to the listed values, and the same applies to other values ​​within this range.

[0017] In the present invention, the concentration of the alkaline aqueous solution is limited to the range of 0.02 to 0.08 M, which is conducive to the efficient aminolysis reaction. The concentration of the alkaline aqueous solution cannot be too low or too high. If the concentration is too low, it cannot promote the aminolysis reaction. If the concentration is too high, it will affect the yield and purity of the oligonucleotide. The eluted oligonucleotide is prone to produce salt peaks during mass spectrometry detection, and the oligonucleotide may appear whitish after drying.

[0018] Preferably, the alcohol includes any one of methanol, ethanol, propanol, butanol, or a combination of at least two of them. The combination may be, for example, a combination of methanol and ethanol, a combination of ethanol and propanol, etc. Any other combinations may be selected and will not be described in detail here.

[0019] Preferably, the volume fraction of alcohol in the aminolysis solution is 50-90%, for example, it can be 50%, 60%, 70%, 80% or 90%, etc., but is not limited to the listed values, and the same applies to other values ​​within this range.

[0020] In a second aspect, the present invention provides a method for preparing the ammonolysis solution as described in the first aspect, the method comprising: mixing an alkaline reagent, propylenediamine, alcohol and optional water to prepare the ammonolysis solution.

[0021] Preferably, the preparation method comprises:

[0022] An alkaline reagent is mixed with water to obtain an alkaline aqueous solution; and the alkaline aqueous solution is then mixed with propylenediamine and alcohol to obtain the ammonolysis solution.

[0023] Preferably, the molar concentration of the alkaline agent in the alkaline aqueous solution is 0.1-0.5M, for example, 0.1M, 0.3M or 0.5M, etc., but is not limited to the listed values, and other values ​​within this range are also applicable.

[0024] Preferably, the volume ratio of the propylenediamine, the alkaline aqueous solution and the alcohol is (0.5-2):(0.8-1.2):(7.8-8.2), for example, it can be 0.5:0.8:8.2, 0.8:0.9:8.1, 1:1:8, 1.5:1.1:7.9 or 2:1.2:7.8, etc., but is not limited to the listed values, and the same applies to other values ​​within this range.

[0025] In the present invention, propylenediamine, alcohol and alkaline aqueous solution are coordinated with each other in a specific ratio. The propylenediamine and alcohol are used as the main effective components of the aminolysis solution to cut the synthesized oligonucleotide from the solid phase carrier and remove the protecting groups Ac, Bz and dmf on the bases A, C and G. Meanwhile, the propylenediamine contains two amine molecules, which improves the reaction activity of each organic amine molecule. The propylenediamine has a large steric hindrance, which greatly reduces the chance of the base C having a side reaction. A trace amount of alkaline aqueous solution plays an aminolysis catalytic role, which not only improves the oligonucleotide yield, but also avoids the phenomenon of the oligonucleotide appearance turning white, and the obtained oligonucleotide has high purity.

[0026] In a third aspect, the present invention provides an application of the aminolysis solution as described in the first aspect, wherein the application includes application in DNA solid phase synthesis.

[0027] Preferably, the method for solid phase DNA synthesis comprises the following steps:

[0028] (1) adding the aminolysis solution described in the first aspect to a solid synthesis column bound with the target DNA;

[0029] (2) placing the solid synthesis column described in step (1) in a sealed container filled with an aminolysis buffer solution, heating it, and then cooling it;

[0030] (3) taking out the solid synthesis column obtained in step (2), and sequentially performing drying, washing and centrifugation operations;

[0031] (4) Eluting the solid synthetic column obtained in step (3) and collecting the effluent, wherein the effluent contains the target DNA.

[0032] In the present invention, the ammonolysis solution described in the first aspect is used to immerse the solid phase synthesis column, and the ammonolysis reaction can occur under mild heating conditions. The ammonolysis buffer in the sealed container is vaporized, which promotes the occurrence and continuation of the ammonolysis reaction, cuts the synthesized oligonucleotide from the solid phase carrier, removes the amino protecting group on the base, and avoids the occurrence of side reactions on the base C, which is conducive to obtaining oligonucleotide products with high purity and high yield.

[0033] Preferably, the usage ratio of the aminolysis solution and the solid synthesis column in step (1) is (0.4-2) μL:1nmol, for example, it can be 0.4 μL:1nmol, 0.8 μL:1nmol, 1.2 μL:1nmol, 1.6 μL:1nmol or 2 μL:1nmol, etc., and is not limited to the listed values, and the same applies to other values ​​within this range.

[0034] For example, in the present invention, 10 μL of the aminolysis solution can be added to 5 nmol of the solid synthesis column in step (1).

[0035] Alternatively, 20 μL of the aminolysis solution is added to 25 or 50 nmol of the solid synthesis column in step (1).

[0036] Preferably, the ammonolysis buffer solution in step (2) comprises an inorganic base or an organic amine.

[0037] Preferably, the inorganic base comprises aqueous ammonia.

[0038] In the present invention, the aminolysis buffer is vaporized into steam under heating conditions, providing a suitable aminolysis environment, which helps to improve the aminolysis efficiency; when ammonia water is used as the aminolysis buffer, the vaporized ammonia gas can not only provide a suitable aminolysis environment, but also assist liquid phase aminolysis to carry out gas phase aminolysis reaction, significantly improving the aminolysis efficiency and oligonucleotide yield, and shortening the reaction time.

[0039] Preferably, the organic amine includes any one of diethylamine, ethylenediamine or pyridine, or a combination of at least two of them. For example, the combination may be a combination of diethylamine and ethylenediamine, a combination of ethylenediamine and pyridine, etc. Any other combinations may be selected and will not be described in detail here.

[0040] In the present invention, when an organic amine is used as an aminolysis buffer, the vaporized organic amine can not only provide a suitable aminolysis environment, but also assist liquid phase aminolysis in gas phase aminolysis reaction, thereby significantly improving the aminolysis efficiency and oligonucleotide yield and shortening the reaction time.

[0041] Preferably, the volume of the aminolysis buffer solution is 16-24 mL, for example, 16 mL, 20 mL or 24 mL, etc., preferably 20 mL, but not limited to the listed values, and the same applies to other values ​​within this range.

[0042] Preferably, the heating temperature in step (2) is 50-95°C, for example, 50°C, 60°C, 70°C, 80°C, 90°C or 95°C, but is not limited to the listed values, and the same applies to other values ​​within this range.

[0043] Preferably, the heating time in step (2) is 35 to 65 minutes, for example, 35 minutes, 45 minutes, 55 minutes, 60 minutes or 65 minutes, etc., and is not limited to the listed values, and is also applicable to other values ​​within this range.

[0044] The heating process described in the present invention can make the aminolysis buffer reach the temperature of vaporization, form a steam atmosphere of the aminolysis buffer in the sealed container, so that the solid phase synthesis column is in the steam atmosphere of the aminolysis buffer, promote the aminolysis effect of the aminolysis solution, and shear the synthesized oligonucleotide from the solid phase carrier; the heating time is related to the synthesis specifications, the aminolysis solution formula, the heating temperature, the volume of the sealed container and the desired degree of completion of the aminolysis reaction, and is adjusted according to the specific implementation situation.

[0045] Preferably, the cooling in step (2) comprises an ice water bath, and the duration of the ice water bath is 8 to 15 minutes, for example, 8 minutes, 10 minutes, 12 minutes or 15 minutes, etc., but is not limited to the listed values, and the same applies to other values ​​within this range.

[0046] Preferably, the drying temperature in step (3) is 50-60°C, for example, 50°C, 53°C, 55°C, 57°C or 60°C, but is not limited to the listed values, and the same applies to other values ​​within this range.

[0047] Preferably, the drying time in step (3) is 1 to 5 minutes, for example, 1 minute, 3 minutes or 5 minutes, etc., but is not limited to the listed values, and other values ​​within this range are also applicable.

[0048] Preferably, the washing liquid in step (3) comprises acetonitrile.

[0049] Preferably, the washing liquid is pure acetonitrile or an acetonitrile solution with a volume fraction of 80-95% (for example, it can be 80%, 85%, 90% or 95%, etc., but is not limited to the listed values, and other values ​​within this range are also applicable).

[0050] Preferably, the washing is performed no less than three times.

[0051] Preferably, the centrifugal rotation speed in step (3) is not less than 3000 rpm, for example, it can be 3000 rpm, 3500 rpm, 4000 rpm or 4500 rpm, but is not limited to the listed values, and the same applies to other values ​​within this range.

[0052] Preferably, the centrifugation time in step (3) is not less than 60 s, for example, it can be 60 s, 70 s, 80 s or 90 s, etc., but is not limited to the listed values, and other values ​​within this range are also applicable.

[0053] Preferably, the elution solution in step (4) comprises water and / or Tris-HCl.

[0054] Preferably, the concentration of Tris-HCl is 10-30 mM, for example, 10 mM, 15 mM, 20 mM, 25 mM or 30 mM, etc., but is not limited to the listed values, and other values ​​within this range are also applicable.

[0055] Preferably, the pH of the Tris-HCl is 7 to 8, for example, 7.1, 7.4, 7.8 or 8, but is not limited to the listed values, and other values ​​within this range are also applicable.

[0056] As a preferred technical solution, the present invention provides a method for solid phase synthesis of DNA, the method comprising the following steps:

[0057] (1) adding the aminolysis solution described in the first aspect to a solid synthesis column bound with the target DNA to immerse the solid synthesis column;

[0058] (2) placing the solid synthesis column described in step (1) in a metal box filled with ammonia water / or organic amine, keeping the synthesis column from contacting the aminolysis buffer, and tightly covering the metal box and fixing it with screws to maintain a closed environment;

[0059] (3) heating the metal box obtained in step (2) at 50-95° C. for 35-65 min, and after the reaction is completed, placing it in an ice water bath and cooling it for 8-15 min;

[0060] (4) taking out the solid synthesis column, drying it at 50-60° C. for 1-5 min, and washing it with pure acetonitrile or acetonitrile solution, the washing times being no less than 3 times, and then taking out the synthesis column and centrifuging it;

[0061] (5) Taking out the solid synthetic column obtained in step (4), eluting it with water and / or Tris-HCl, and collecting the effluent, which contains the target DNA.

[0062] Compared with the prior art, the present invention has the following beneficial effects:

[0063] (1) The aminolysis solution provided by the present invention has a simple formula. Propylene diamine cooperates with alcohol and alkaline reagent to cut the synthesized oligonucleotide from the solid phase carrier and remove the protecting groups Ac, Bz, and dmf on the A, C, and G bases. The presence of the alkaline reagent can further accelerate the aminolysis reaction rate. Compared with the first-generation aminolysis solution, it can avoid the occurrence of side reactions on the base C, and further improve the purity of the oligonucleotide;

[0064] (2) The present invention uses propylenediamine, alcohol and alkaline reagent to obtain an ammonolysis solution. The components are mixed in a corresponding ratio to better exert a synergistic effect and better assist in completing the ammonolysis process. The ammonolysis solution is low in cost and can be better commercialized and industrialized. BRIEF DESCRIPTION OF THE DRAWINGS

[0065] Figure 1 is the HPLC spectrum of the 20-base oligonucleotide in Example 1;

[0066] Figure 2 is the ESI mass spectrum of the 20-base oligonucleotide in Example 1;

[0067] Figure 3 is the HPLC spectrum of the 30-base oligonucleotide in Example 1;

[0068] Figure 4 is the ESI mass spectrum of the 30-base oligonucleotide in Example 1;

[0069] Figure 5 is the HPLC spectrum of the 20-base oligonucleotide in Example 2;

[0070] Figure 6 is the HPLC spectrum of the 20-base oligonucleotide in Example 3;

[0071] Figure 7 is the HPLC spectrum of the 30-base oligonucleotide in Example 3;

[0072] Figure 8 is the HPLC spectrum of the 20-base oligonucleotide in Example 4;

[0073] Fig. 9 is the HPLC spectrum of the 30-base oligonucleotide in Example 4;

[0074] Fig.10 is the HPLC spectrum of the 20-base oligonucleotide in Example 5;

[0075] Fig.11is the HPLC spectrum of the 30-base oligonucleotide in Example 5;

[0076] Fig.12 is the HPLC spectrum of the 20-base oligonucleotide in Example 6;

[0077] Fig.13 is the HPLC spectrum of the 30-base oligonucleotide in Example 6;

[0078] Fig.14 is the HPLC spectrum of the 20-base oligonucleotide in Example 7;

[0079] Fig.15 is the ESI mass spectrum of the 20-base oligonucleotide in Example 7;

[0080] Fig.16 is the HPLC spectrum of the 30-base oligonucleotide in Example 7;

[0081] Fig.17 is the ESI mass spectrum of the 30-base oligonucleotide in Example 7;

[0082] Fig.18 is the HPLC spectrum of the 20-base oligonucleotide in Example 8;

[0083] Fig.19 is the ESI mass spectrum of the 20-base oligonucleotide in Example 8;

[0084] Fig. 20 is the HPLC spectrum of the 30-base oligonucleotide in Example 8;

[0085] Fig.21 is the ESI mass spectrum of the 30-base oligonucleotide in Example 8;

[0086] Fig. 22 is the HPLC spectrum of the 20-base oligonucleotide in Example 9;

[0087] Fig.23 is the ESI mass spectrum of the 20-base oligonucleotide in Example 9;

[0088] Fig.24 is the HPLC spectrum of the 30-base oligonucleotide in Example 9;

[0089] Fig.25 is the ESI mass spectrum of the 30-base oligonucleotide in Example 9;

[0090] Fig.26is the HPLC spectrum of the 20-base oligonucleotide in Example 10;

[0091] Fig. 27 is the ESI mass spectrum of the 20-base oligonucleotide in Example 10;

[0092] Fig.28 is the HPLC spectrum of the 30-base oligonucleotide in Example 10;

[0093] Fig.29 is the ESI mass spectrum of the 30-base oligonucleotide in Example 10;

[0094] Fig.30 This is the HPLC spectrum of oligo(dC)10 degraded by the first-generation ammonolysis solution provided in Comparative Example 1;

[0095] Fig.31 This is the HPLC spectrum of oligo(dC)10 degraded by the new generation of ammonolysis solution provided in Example 1;

[0096] Fig.32 is the HPLC spectrum of the 20-base oligonucleotide in Comparative Example 2;

[0097] Fig.33 is the ESI mass spectrum of the 20-base oligonucleotide in Comparative Example 2;

[0098] Fig.34 is the HPLC spectrum of the 30-base oligonucleotide in Comparative Example 2;

[0099] Fig.35 is the ESI mass spectrum of the 30-base oligonucleotide in Comparative Example 2;

[0100] Fig.36 is the HPLC spectrum of the 20-base oligonucleotide in Comparative Example 3;

[0101] Fig.37 is the ESI mass spectrum of the 20-base oligonucleotide in Comparative Example 3;

[0102] Fig.38 is the HPLC spectrum of the 30-base oligonucleotide in Comparative Example 3;

[0103] Fig.39 is the ESI mass spectrum of the 30-base oligonucleotide in Comparative Example 3;

[0104] Fig.40 is the HPLC spectrum of the 20-base oligonucleotide in Comparative Example 4;

[0105] Fig.41is the ESI mass spectrum of the 20-base oligonucleotide in Comparative Example 4;

[0106] Fig.42 is the HPLC spectrum of the 30-base oligonucleotide in Comparative Example 4;

[0107] Fig.43 This is the ESI mass spectrum of the 30-base oligonucleotide in Comparative Example 4. DETAILED DESCRIPTION

[0108] To further illustrate the technical means and effects of the present invention, the present invention is further described below in conjunction with embodiments and accompanying drawings. The technical scheme of the present invention is further described below by specific implementation methods. It should be understood by those skilled in the art that the embodiments are only to help understand the present invention and should not be regarded as specific limitations of the present invention.

[0109] If no specific techniques or conditions are specified in the examples, the techniques or conditions described in the literature in the field or the product instructions are used. If no manufacturer is specified for the reagents or instruments used, they are all conventional products that can be purchased through regular channels.

[0110] Example 1

[0111] In this example, aminolysis reaction was performed on primers with lengths of 10 bases, 20 bases, and 30 bases, and the sequences were:

[0112] SEQ ID NO: 1 (10 nt), target molecular weight 2830:

[0113] CCCCCCCCCC;

[0114] SEQ ID NO: 2 (20 nt), target molecular weight 6087:

[0115] CGGCAGCGTACCCTCGATAA;

[0116] SEQ ID NO: 3 (30 nt), target molecular weight is 9119:

[0117] CGGCCTTCAGCAGGTATCTCAGCTTGCCCA.

[0118] The specific steps are as follows:

[0119] 1. Primer synthesis

[0120] A 50 nmol synthesis column was used; 0.25 M 5-ethylthiotetrazolyl (ETT) in acetonitrile was used as the activating agent; 3% trichloroacetic acid in dichloromethane was used as the deprotecting agent; 10% acetic anhydride / acetonitrile and N-methylimidazole / pyridine / acetonitrile = 14:10:76 was used as the capping agent; 0.05 M iodine in tetrahydrofuran / pyridine / water = 70:20:10 was used as the oxidizing agent. The corresponding primer sequences were synthesized on a Dr. Oligo 192 synthesizer.

[0121] 2. Liquid phase ammonolysis

[0122] (1) mixing an alkaline reagent, 1,2-propylenediamine, an alcohol, and optionally water to prepare an ammonolysis solution, wherein the formula of the ammonolysis solution is 1,2-propylenediamine, 0.5M KOH, and ethanol in a volume ratio of 0.5:1:8;

[0123] That is, the volume fraction of 1,2-propylenediamine is 5%, the molar fraction of KOH is 0.05M, and the volume fraction of ethanol is 80%;

[0124] (2) Add 20 μL of aminolysis solution to a 50 nmol solid synthesis column to submerge the solid synthesis column;

[0125] (3) The solid synthesis column described in step (1) is suspended in a 9.5 cm × 17 cm × 13 cm metal box filled with 20 mL of ammonia water, keeping the synthesis column from contacting the aminolysis buffer, and the metal box is tightly closed and fixed with screws to maintain a closed environment;

[0126] (4) heating the metal box obtained in step (2) at 90° C. for 60 min. After the reaction is completed, placing the metal box in an ice water bath and cooling it for 10 min.

[0127] (5) Take out the metal box in step (3), take out the solid synthesis column, dry it at 55°C for 3 minutes, take it out and cool it to room temperature, and wash it with 200 μL of 100% acetonitrile and 90% acetonitrile successively, take out the solid synthesis column and centrifuge it at 3000 rpm for 60 seconds; wash it twice with 100% acetonitrile and once with 90% acetonitrile;

[0128] (6) Take out the solid synthesis column obtained in step (4), elute it with 200 μL of 20 mM Tris-HCl solution with a pH of 7.2, and collect the effluent for mass spectrometry analysis.

[0129] The HPLC spectra and ESI mass spectra of the primers with a length of 20 bases are shown in Figure 2. Figure 1 and Figure 2 As shown by Figure 1 It can be seen that its purity is 95%, Figure 2It can be seen that its mass spectrometry molecular weight is consistent with the target molecular weight; the HPLC spectrum and ESI mass spectrum of the primer with a length of 30 bases are as follows: Figure 3 and Figure 4 As shown by Figure 3 It can be seen that its purity is 98%, Figure 4 It can be seen that its mass spectrometry molecular weight is consistent with the target molecular weight; the HPLC chromatogram of the primer with a length of 10 bases is as follows Fig.31 As shown, the purity is 97%. It can be seen that the HPLC purity and mass spectrum of primers of different lengths treated by the new generation of liquid phase aminolysis can meet the industry standards.

[0130] Example 2

[0131] In this example, a primer with a length of 20 bases was subjected to an aminolysis reaction, and the sequence was:

[0132] SEQ ID NO: 2 (20 nt), target molecular weight 6087:

[0133] CGGCCTTCAGCAGGTATCTCAGCTTGCCCA.

[0134] The specific steps are as follows:

[0135] 1. Primer synthesis

[0136] A 25 nmol synthesis column was used; 0.25 M 5-ethylthiotetrazolyl (ETT) in acetonitrile was used as the activator; 3% trichloroacetic acid in dichloromethane was used as the deprotection reagent; 10% acetic anhydride / acetonitrile and N-methylimidazole / pyridine / acetonitrile = 14:10:76 was used as the capping reagent; 0.05 M iodine in tetrahydrofuran / pyridine / water = 70:20:10 was used as the oxidant. The corresponding primer sequences were synthesized on a Dr. Oligo 192 synthesizer.

[0137] 2. Liquid phase ammonolysis

[0138] (1) mixing an alkaline reagent, 1,2-propylenediamine, an alcohol, and optionally water to prepare an ammonolysis solution, wherein the formula of the ammonolysis solution is 1,2-propylenediamine, 0.5M KOH, and ethanol in a volume ratio of 0.5:1:8;

[0139] That is, the volume fraction of 1,2-propylenediamine is 5%, the molar fraction of KOH is 0.05M, and the volume fraction of ethanol is 80%;

[0140] (2) Add 20 μL of aminolysis solution to a 25 nmol solid synthesis column to submerge the solid synthesis column;

[0141] (3) The solid synthesis column described in step (1) is suspended in a 9.5 cm × 17 cm × 13 cm metal box filled with 24 mL of ammonia water, keeping the synthesis column from contacting the aminolysis buffer, and the metal box is tightly closed and fixed with screws to maintain a closed environment;

[0142] (4) heating the metal box obtained in step (2) at 91° C. for 45 min. After the reaction is completed, placing the metal box in an ice water bath and cooling it for 12 min.

[0143] (5) Take out the metal box in step (3), take out the solid synthesis column, dry it at 58°C for 2 min, take it out and cool it to room temperature, and wash it with 200 μL of 100% acetonitrile and 92% acetonitrile successively, take out the solid synthesis column and centrifuge it at 3200 rpm for 65 s;

[0144] The 100% acetonitrile was washed twice, and the 92% acetonitrile was washed once;

[0145] (6) Take out the solid synthesis column obtained in step (4), elute it with 200 μL of 25 mM Tris-HCl solution with a pH of 7.1, and collect the effluent for mass spectrometry analysis.

[0146] The HPLC spectrum of a 20-base primer is as follows: Figure 5 As shown, its purity is 99%.

[0147] Example 3

[0148] In this example, aminolysis reaction was performed on primers with a length of 20 bases and 30 bases, and the sequences were:

[0149] SEQ ID NO: 2 (20 nt), target molecular weight 6087:

[0150] CGGCAGCGTACCCTCGATAA;

[0151] SEQ ID NO: 3 (30 nt), target molecular weight is 9119:

[0152] CGGCCTTCAGCAGGTATCTCAGCTTGCCCA.

[0153] The specific steps are as follows:

[0154] 1. Primer synthesis

[0155] A 5 nmol synthesis column was used; 0.25 M 5-ethylthiotetrazolyl (ETT) in acetonitrile was used as the activator; 3% trichloroacetic acid in dichloromethane was used as the deprotection reagent; 10% acetic anhydride / acetonitrile and N-methylimidazole / pyridine / acetonitrile = 14:10:76 was used as the capping reagent; 0.05 M iodine in tetrahydrofuran / pyridine / water = 70:20:10 was used as the oxidant. The corresponding primer sequences were synthesized on a Dr. Oligo 768 synthesizer.

[0156] 2. Liquid phase ammonolysis

[0157] (1) mixing an alkaline reagent, 1,2-propylenediamine, an alcohol, and optionally water to prepare an ammonolysis solution, wherein the formula of the ammonolysis solution is 1,2-propylenediamine, 0.5M NaOH, and methanol in a volume ratio of 1:1:8;

[0158] That is, the volume fraction of 1,2-propylenediamine is 10%, the molar fraction of NaOH is 0.05M, and the volume fraction of ethanol is 80%;

[0159] (2) Add 10 μL of aminolysis solution to a 5 nmol solid synthesis column to submerge the solid synthesis column;

[0160] (3) The solid synthesis column described in step (1) is suspended in a 9.5 cm × 17 cm × 13 cm metal box filled with 22 mL of ethylenediamine, keeping the synthesis column from contacting the aminolysis buffer, and the metal box is tightly closed and fixed with screws to maintain a closed environment;

[0161] (4) heating the metal box obtained in step (2) at 95° C. for 35 min. After the reaction is completed, placing the metal box in an ice water bath and cooling it for 15 min.

[0162] (5) Take out the metal box in step (3), take out the solid synthesis column, dry it at 60°C for 1 min, take it out and cool it to room temperature, and wash it with 200 μL of 100% acetonitrile and 95% acetonitrile successively, take out the solid synthesis column and centrifuge it at 3300 rpm for 75 s;

[0163] The 100% acetonitrile was washed twice, and the 95% acetonitrile was washed once;

[0164] (6) Take out the solid synthesis column obtained in step (4), elute it with 200 μL of 30 mM Tris-HCl solution with a pH of 7, and collect the effluent for mass spectrometry analysis.

[0165] The HPLC spectrum of a primer with a length of 20 bases is as follows Figure 6 As shown, its purity is 91%; the HPLC spectrum of the primer with a length of 30 bases is as follows Figure 7 As shown, its purity is 81%.

[0166] Example 4

[0167] This embodiment provides an ammonolysis solution and an ammonolysis method, wherein the ammonolysis solution formula is 1,2-propylenediamine, 0.5M KOH and ethanol in a volume ratio of 0.5:0.8:8.2.

[0168] In this example, aminolysis reaction was performed on primers with a length of 20 bases and 30 bases, and the sequences were:

[0169] SEQ ID NO: 2 (20 nt), target molecular weight 6087:

[0170] CGGCAGCGTACCCTCGATAA;

[0171] SEQ ID NO: 3 (30 nt), target molecular weight is 9119:

[0172] CGGCCTTCAGCAGGTATCTCAGCTTGCCCA.

[0173] The process parameters of the ammonolysis method are the same as those in Example 1.

[0174] The HPLC spectrum of a primer with a length of 20 bases is as follows Figure 8 As shown, its purity is 96%; the HPLC spectrum of the primer with a length of 30 bases is as follows Fig. 9 As shown, its purity is 87%.

[0175] Example 5

[0176] This embodiment provides an ammonolysis solution and an ammonolysis method, wherein the ammonolysis solution formula is 1,2-propylenediamine, 0.5M NaOH and ethanol in a volume ratio of 2:1.2:7.8.

[0177] In this example, aminolysis reaction was performed on primers with a length of 20 bases and 30 bases, and the sequences were:

[0178] SEQ ID NO: 2 (20 nt), target molecular weight 6087:

[0179] CGGCAGCGTACCCTCGATAA;

[0180] SEQ ID NO: 3 (30 nt), target molecular weight is 9119:

[0181] CGGCCTTCAGCAGGTATCTCAGCTTGCCCA.

[0182] The process parameters of the ammonolysis method are the same as those in Example 1.

[0183] The HPLC spectrum of a primer with a length of 20 bases is as follows Fig.10 The purity is 93% as shown in FIG. 1 ; the HPLC spectrum of the primer with a length of 30 bases is shown in FIG. Fig.11 As shown, its purity is 85%.

[0184] Example 6

[0185] This embodiment provides an ammonolysis solution and an ammonolysis method, wherein the ammonolysis solution has a formula of 1,2-propylenediamine, 0.5M NaOH and ethanol in a volume ratio of 0.8:0.95:8.05.

[0186] In this example, aminolysis reaction was performed on primers with a length of 20 bases and 30 bases, and the sequences were:

[0187] SEQ ID NO: 1 (20 nt), target molecular weight 6087:

[0188] CGGCAGCGTACCCTCGATAA;

[0189] SEQ ID NO: 2 (30 nt), target molecular weight is 9119:

[0190] CGGCCTTCAGCAGGTATCTCAGCTTGCCCA.

[0191] The process parameters of the ammonolysis method are the same as those in Example 1.

[0192] The HPLC spectrum of a primer with a length of 20 bases is as follows Fig.12 As shown, its purity is 96%; the HPLC spectrum of the primer with a length of 30 bases is as follows Fig.13 As shown, its purity is 88%.

[0193] Example 7

[0194] This embodiment provides an ammonolysis solution and an ammonolysis method, wherein the ammonolysis solution has a formula of 1,2-propylenediamine, 0.5M KOH and ethanol in a volume ratio of 1.5:1.05:7.95.

[0195] In this example, aminolysis reaction was performed on primers with a length of 20 bases and 30 bases, and the sequences were:

[0196] SEQ ID NO: 2 (20 nt), target molecular weight 6087:

[0197] CGGCAGCGTACCCTCGATAA;

[0198] SEQ ID NO: 3 (30 nt), target molecular weight is 9119:

[0199] CGGCCTTCAGCAGGTATCTCAGCTTGCCCA.

[0200] The process parameters of the ammonolysis method are the same as those in Example 1.

[0201] The HPLC spectrum and ESI mass spectrum of the primer with a length of 20 bases are shown as follows: Fig.14 and Fig.15 As shown by Fig.14 It can be seen that its purity is 95%, Fig.15 It can be seen that its mass spectrometry molecular weight is consistent with the target molecular weight; the HPLC spectrum and ESI mass spectrum of the primer with a length of 30 bases are as follows: Fig.16 and Fig.17 As shown by Fig.16 It can be seen that its purity is 87%. Fig.17 It can be seen that its mass spectrometry molecular weight is consistent with the target molecular weight.

[0202] Example 8

[0203] This embodiment provides an ammonolysis solution and an ammonolysis method, wherein the ammonolysis solution has a formula of 1,2-propylenediamine, 0.2M KOH and ethanol in a volume ratio of 1:1:8.

[0204] In this example, aminolysis reaction was performed on primers with a length of 20 bases and 30 bases, and the sequences were:

[0205] SEQ ID NO: 2 (20 nt), target molecular weight 6087:

[0206] CGGCAGCGTACCCTCGATAA;

[0207] SEQ ID NO: 3 (30 nt), target molecular weight is 9119:

[0208] CGGCCTTCAGCAGGTATCTCAGCTTGCCCA.

[0209] The process parameters of the ammonolysis method are the same as those in Example 1.

[0210] The HPLC spectrum and ESI mass spectrum of the primer with a length of 20 bases are shown as follows: Fig.18 and Fig.19 As shown by Fig.18 It can be seen that its purity is 97%. Fig.19 It can be seen that its mass spectrometry molecular weight is consistent with the target molecular weight; the HPLC spectrum and ESI mass spectrum of the primer with a length of 30 bases are as follows: Fig. 20 and Fig.21 As shown by Fig. 20 It can be seen that its purity is 83%. Fig.21 It can be seen that its mass spectrometry molecular weight is consistent with the target molecular weight.

[0211] Example 9

[0212] This embodiment provides an ammonolysis solution and an ammonolysis method, wherein the ammonolysis solution has a formula of 1,2-propylenediamine, 0.8M KOH and ethanol in a volume ratio of 1:1:8.

[0213] In this example, aminolysis reaction was performed on primers with a length of 20 bases and 30 bases, and the sequences were:

[0214] SEQ ID NO: 2 (20 nt), target molecular weight 6087:

[0215] CGGCAGCGTACCCTCGATAA;

[0216] SEQ ID NO: 3 (30 nt), target molecular weight is 9119:

[0217] CGGCCTTCAGCAGGTATCTCAGCTTGCCCA.

[0218] The process parameters of the ammonolysis method are the same as those in Example 1.

[0219] The HPLC spectrum and ESI mass spectrum of the primer with a length of 20 bases are shown as follows: Fig. 22 and Fig.23 As shown by Fig. 22 It can be seen that its purity is 97%. Fig.23 It can be seen that its mass spectrometry molecular weight is consistent with the target molecular weight; the HPLC spectrum and ESI mass spectrum of the primer with a length of 30 bases are as follows: Fig.24 and Fig.25 As shown by Fig.24 It can be seen that its purity is 88%. Fig.25 It can be seen that its mass spectrometry molecular weight is consistent with the target molecular weight.

[0220] Example 10

[0221] This embodiment provides an ammonolysis solution and an ammonolysis method, which are the same as those in Embodiment 1 except that the volume fraction of 1,2-propylenediamine in the formula of the ammonolysis solution is 20%.

[0222] In this example, aminolysis reaction was performed on primers with a length of 20 bases and 30 bases, and the sequences were:

[0223] SEQ ID NO: 2 (20 nt), target molecular weight 6087:

[0224] CGGCAGCGTACCCTCGATAA;

[0225] SEQ ID NO: 3 (30 nt), target molecular weight is 9119:

[0226] CGGCCTTCAGCAGGTATCTCAGCTTGCCCA.

[0227] The HPLC spectrum and ESI mass spectrum of the primer with a length of 20 bases are shown as follows: Fig.26 and Fig. 27 As shown by Fig.26 It can be seen that its purity is 93%. Fig. 27 It can be seen that its mass spectrometry molecular weight is consistent with the target molecular weight; the HPLC spectrum and ESI mass spectrum of the primer with a length of 30 bases are as follows: Fig.28 and Fig.29 As shown by Fig.28 It can be seen that its purity is 93%. Fig.29 It can be seen that its mass spectrometry molecular weight is consistent with the target molecular weight.

[0228] Comparative Example 1

[0229] This comparative example adopts a first-generation liquid phase aminolysis formula (the first-generation aminolysis solution formula is the aminolysis solution disclosed in CN111704644A, and accordingly, the aminolysis solution provided in the present invention is called a new generation aminolysis solution) to perform an aminolysis reaction on a primer with a length of 10 bases, and the sequence is:

[0230] SEQ ID NO: 1 (10 nt), target molecular weight 2830:

[0231] CCCCCCCCCC.

[0232] The specific steps are as follows:

[0233] 1. Primer synthesis

[0234] A 50 nmol synthesis column was used; 0.25 M 5-ethylthiotetrazolyl (ETT) in acetonitrile was used as the activating agent; 3% trichloroacetic acid in dichloromethane was used as the deprotecting agent; 10% acetic anhydride / acetonitrile and N-methylimidazole / pyridine / acetonitrile = 14:10:76 was used as the capping agent; 0.05 M iodine in tetrahydrofuran / pyridine / water = 70:20:10 was used as the oxidizing agent. The corresponding primer sequences were synthesized on a Dr. Oligo 192 synthesizer.

[0235] 2. First-generation liquid phase ammonia solution

[0236] (1) Add 20 μL of ammonolysis solution to a 50 nmol solid synthesis column to submerge the solid synthesis column. The formula of the ammonolysis solution is n-butylamine: n-butanol: 1-aminopentanol = 7:2:1;

[0237] (2) The solid synthesis column described in step (1) is suspended in a 9.5 cm × 17 cm × 13 cm metal box filled with 20 mL of ammonia water, keeping the synthesis column from contacting the aminolysis buffer, and the metal box is tightly closed and fixed with screws to maintain a closed environment;

[0238] (3) heating the metal box obtained in step (2) at 90° C. for 60 min. After the reaction is completed, placing the metal box in an ice water bath and cooling it for 10 min.

[0239] (4) Take out the metal box in step (3), take out the solid synthesis column, dry it at 55°C for 3 min, take it out and cool it to room temperature, and wash it with 200 μL of 100% acetonitrile and 90% acetonitrile successively, take out the solid synthesis column and centrifuge it at 3000 rpm for 65 s;

[0240] The 100% acetonitrile was washed twice, and the 90% acetonitrile was washed once;

[0241] (5) Take out the solid synthesis column obtained in step (4), elute it with 200 μL of 20 mM Tris-HCl solution with a pH of 7.2, and collect the effluent for mass spectrometry analysis.

[0242] High performance liquid chromatography Fig.30 As shown, its purity is 69%. Compared with the first-generation liquid phase ammonolysis provided in Comparative Example 1, the HPLC purity of oligo(dC)10 obtained by using the new-generation ammonolysis solution provided in Example 1 is 97% ( Fig.31 ), its HPLC purity is higher and the side reaction products are significantly reduced (among which, the peaks at 2.07 and 2.38 minutes represent side reaction products), indicating that the purity of the oligo primers obtained by using a new generation of liquid phase aminolysis solution can be further improved.

[0243] Comparative Example 2

[0244] This comparative example provides an ammonolysis solution and an ammonolysis method, wherein the ammonolysis solution formula is a volume ratio of 1,2-propylenediamine to ethanol of 1:9.

[0245] In this comparative example, primers with lengths of 20 bases and 30 bases were subjected to aminolysis reaction, and the sequences were:

[0246] SEQ ID NO: 2 (20 nt), target molecular weight 6087:

[0247] CGGCAGCGTACCCTCGATAA;

[0248] SEQ ID NO: 3 (30 nt), target molecular weight is 9119:

[0249] CGGCCTTCAGCAGGTATCTCAGCTTGCCCA.

[0250] The process parameters of the ammonolysis method are the same as those in Example 1.

[0251] The HPLC spectrum and ESI mass spectrum of the primer with a length of 20 bases are shown as follows: Fig.32 and Fig.33 As shown by Fig.32 It can be seen that its purity is 91%. Fig.33 It can be seen that its mass spectrometry molecular weight is consistent with the target molecular weight; the HPLC spectrum and ESI mass spectrum of the primer with a length of 30 bases are as follows: Fig.34 and Fig.35 As shown by Fig.34 It can be seen that its purity is 82%. Fig.35 It can be seen that its mass spectrometry molecular weight is consistent with the target molecular weight.

[0252] Comparative Example 3

[0253] This comparative example provides an ammonolysis solution and an ammonolysis method, wherein the ammonolysis solution formula is a volume ratio of 1,2-propylenediamine to 0.5M KOH of 1:9.

[0254] In this comparative example, primers with lengths of 20 bases and 30 bases were subjected to aminolysis reaction, and the sequences were:

[0255] SEQ ID NO: 2 (20 nt), target molecular weight 6087:

[0256] CGGCAGCGTACCCTCGATAA;

[0257] SEQ ID NO: 3 (30 nt), target molecular weight is 9119:

[0258] CGGCCTTCAGCAGGTATCTCAGCTTGCCCA.

[0259] The process parameters of the ammonolysis method are the same as those in Example 1.

[0260] The HPLC spectrum and ESI mass spectrum of the primer with a length of 20 bases are shown as follows: Fig.36 and Fig.37 As shown by Fig.36 It can be seen that its purity is 98%, Fig.37 It can be seen that its mass spectrometry molecular weight is consistent with the target molecular weight; the HPLC spectrum and ESI mass spectrum of the primer with a length of 30 bases are as follows: Fig.38 and Fig.39 As shown by Fig.38 It can be seen that its purity is 85%, Fig.39It can be seen that its mass spectrometry molecular weight is consistent with the target molecular weight.

[0261] Comparative Example 4

[0262] This comparative example provides an ammonolysis solution and an ammonolysis method, wherein the ammonolysis solution formula is a 1,2-propylenediamine and a 0.5M KOH ethanol solution with a volume ratio of 1:9.

[0263] In this comparative example, primers with lengths of 20 bases and 30 bases were subjected to aminolysis reaction, and the sequences were:

[0264] SEQ ID NO: 2 (20 nt), target molecular weight 6087:

[0265] CGGCAGCGTACCCTCGATAA;

[0266] SEQ ID NO: 3 (30 nt), target molecular weight is 9119:

[0267] CGGCCTTCAGCAGGTATCTCAGCTTGCCCA.

[0268] The process parameters of the ammonolysis method are the same as those in Example 1.

[0269] The HPLC spectrum and ESI mass spectrum of the primer with a length of 20 bases are shown as follows: Fig.40 and Fig.41 As shown by Fig.40 It can be seen that its purity is 89%. Fig.41 It can be seen that its mass spectrometry molecular weight is consistent with the target molecular weight; the HPLC spectrum and ESI mass spectrum of the primer with a length of 30 bases are as follows: Fig.42 and Fig.43 As shown by Fig.42 It can be seen that its purity is 79%. Fig.43 It can be seen that its mass spectrometry molecular weight is consistent with the target molecular weight.

[0270] The yield and purity of the primers obtained in Examples 1-10 and Comparative Examples 1-4 are shown in Table 1.

[0271] Table 1

[0272]

[0273]

[0274] Combined with the above table, it can be seen that compared with Comparative Example 1, the HPLC purity of the primers obtained by using the new generation of ammonolysis solution is higher, and the side reaction products are significantly reduced, indicating that the purity of the primers of Oligo obtained by using the new generation of liquid phase ammonolysis solution can be further improved;

[0275] Compared with Example 2, the purity of the primer obtained in Example 1 is significantly better than that in Comparative Example 2, indicating that the effects of propylenediamine and alkaline reagents in the aminolysis process are complementary, and the lack of any one of them will reduce the effect of aminolysis;

[0276] Comparing Example 1 with Comparative Example 3, the product of Example 1 is a transparent colloid, while the product of Comparative Example 3 is a white solid, indicating that excessive KOH will cause more KOH to be mixed in the product, which cannot be removed by conventional steps; Comparative Example 3 has more incomplete aminolysis products than Example 1, indicating that ethanol has a certain auxiliary effect in the aminolysis process, and its lack will reduce the aminolysis effect;

[0277] Compared with Example 4, Example 1 has less incomplete ammonolysis products than Example 4, indicating that a certain amount of water has the effect of promoting ammonolysis in the reaction;

[0278] Compared with Examples 2-10, Example 1 shows that the selection and concentration of the alkaline reagent, the selection of the alcohol, and the volume fraction of propylenediamine will affect the aminolysis effect, thereby affecting the primer purity and yield of the obtained Oligo.

[0279] In summary, the HPLC purity and mass spectrum of the oligo products obtained by treating oligos of different lengths with the new generation of liquid-phase ammonolysis solution through the synergistic combination of 1,2-propylenediamine, alcohol and alkaline reagent in a specific ratio can meet the shipping standards, which proves that this method can have a good ammonolysis effect on oligos of different lengths. Compared with the first-generation ammonolysis solution, under the premise of reducing the reaction cost, the side reaction products of the HPLC spectrum of the obtained oligo are significantly reduced, which further improves the purity of the oligo product.

[0280] The applicant declares that the above is only a specific implementation mode of the present invention, but the protection scope of the present invention is not limited thereto. Those skilled in the art should understand that any changes or substitutions that can be easily thought of by those skilled in the art within the technical scope disclosed by the present invention shall fall within the protection scope and disclosure scope of the present invention. SEQUENCE LISTING <110> Suzhou Jinweizhi Biotechnology Co., Ltd. <120> A kind of aminolysis solution and its preparation method and application in DNA solid phase synthesis <130> 20210915 <160> 3 <170> PatentIn version 3.3 <210> 1 <211> 10 <212> DNA <213> Synthesis <400> 1 cccccccccc 10 <210> 2 <211> 20 <212> DNA <213> Synthesis <400> 2 cggcagcgta ccctcgataa 20 <210> 3 <211> 30 <212> DNA <213> Synthesis <400> 3 cggccttcag caggtatctc agcttgccca 30

Claims

1. An ammonolysis solution, characterized in that The ammonolysis solution is composed of: 1,2-propylenediamine, alkaline aqueous solution and alcohol, wherein the alkaline agent is mixed with water to obtain the alkaline aqueous solution; The volume concentration of 1,2-propylenediamine in the ammonolysis solution is 5% to 20%; The alkaline reagent is selected from any one or a combination of at least two of KOH reagent, LiOH reagent, NaOH reagent, Be(OH)2 reagent, Mg(OH)2 reagent or Ca(OH)2 reagent; The concentration of the alkaline reagent in the ammonolysis solution is 0.02 to 0.08 M; The alcohol is selected from any one of methanol, ethanol, propanol, and butanol, or a combination of at least two thereof; The volume fraction of alcohol in the ammonolysis solution is 50% to 90%.

2. A method for preparing the ammonolysis solution as claimed in claim 1, characterized in that: The preparation method comprises: The ammonolysis solution is prepared by mixing an alkaline reagent, 1,2-propylenediamine, alcohol and water.

3. The preparation method according to claim 2, characterized in that: The preparation method specifically comprises: An alkaline reagent is mixed with water to obtain an alkaline aqueous solution; and the alkaline aqueous solution is then mixed with 1,2-propylenediamine and alcohol to obtain the ammonolysis solution.

4. The preparation method according to claim 3, characterized in that: The molar concentration of the alkaline agent in the alkaline aqueous solution is 0.1-0.5 M.

5. The preparation method according to claim 3, characterized in that: The volume ratio of the 1,2-propylenediamine, the alkaline aqueous solution and the alcohol is (0.5-2):(0.8-1.2):(7.8-8.2).

6. A use of the ammonolysis solution as claimed in claim 1, characterized in that: The applications include application in solid phase DNA synthesis.

7. The use according to claim 6, characterized in that: The method for solid phase DNA synthesis comprises the following steps: (1) adding the aminolysis solution as described in claim 1 to a solid synthesis column bound with the target DNA; (2) placing the solid synthesis column described in step (1) in a sealed container filled with an aminolysis buffer solution, heating it, and then cooling it; (3) taking out the solid synthesis column obtained in step (2), and sequentially performing drying, washing and centrifugation operations; (4) Eluting the solid synthesis column obtained in step (3) and collecting the effluent, wherein the effluent contains the target DNA.

8. The use according to claim 7, characterized in that: The ratio of the amount of the aminolysis solution to the amount of the solid synthesis column used in step (1) is (0.4-2) μL:1 nmol.

9. The use according to claim 7, characterized in that: The ammonolysis buffer solution in step (2) is an inorganic base or an organic amine.

10. The use according to claim 9, characterized in that: The inorganic base is aqueous ammonia.

11. The use according to claim 9, characterized in that: The organic amine is any one of diethylamine, ethylenediamine or pyridine, or a combination of at least two of them.

12. The use according to claim 7, characterized in that: The heating temperature in step (2) is 50-95°C.

13. The use according to claim 7, characterized in that: The heating time in step (2) is 35 to 65 minutes.

14. The use according to claim 7, characterized in that: The cooling in step (2) comprises an ice water bath.

15. The use according to claim 14, characterized in that: The ice water bath time is 8 to 15 min.

16. The use according to claim 7, characterized in that: The drying temperature in step (3) is 50-60°C.

17. The use according to claim 7, characterized in that: The drying time in step (3) is 1 to 5 minutes.

18. The use according to claim 7, characterized in that: The washing liquid in step (3) is acetonitrile.

19. The use according to claim 18, characterized in that The washing liquid is pure acetonitrile or an acetonitrile solution with a volume fraction of 80 to 95%.

20. The use according to claim 7, characterized in that: The washing is performed no less than three times.

21. The use according to claim 7, characterized in that: The centrifugal speed in step (3) is not less than 3000 rpm.

22. The use according to claim 7, characterized in that: The centrifugation time in step (3) is not less than 60 s.

23. The use according to claim 7, characterized in that: The elution solution in step (4) is selected from water and / or Tris-HCl buffer.

24. The use according to claim 23, characterized in that The concentration of the Tris-HCl buffer is 10-30 mM.

25. The use according to claim 23, characterized in that The pH of the Tris-HCl buffer is 7-8.

26. The use according to claim 6, characterized in that The method for solid phase DNA synthesis comprises the following steps: (1) adding the aminolysis solution as described in claim 1 to a solid synthesis column bound with the target DNA to immerse the solid synthesis column; (2) placing the solid synthesis column described in step (1) in a metal box filled with ammonia water or organic amine, keeping the synthesis column from contacting the aminolysis buffer, and tightly covering the metal box and fixing it with screws to maintain a closed environment; (3) heating the metal box obtained in step (2) at 50-95°C for 35-65 min. After the reaction is completed, placing it in an ice water bath and cooling it for 8-15 min. (4) taking out the solid synthesis column, drying it at 50 to 60° C. for 1 to 5 min, and washing it with a washing solution, the washing number of times being no less than 3 times, and then taking out the solid synthesis column and centrifuging it; (5) Eluting the solid synthetic column obtained after the centrifugation in step (4) with water and / or Tris-HCl buffer, and collecting the effluent, which contains the target DNA.

Images