Multiplex PCR marker primer set for simultaneous detection of wheat scab resistance genes Fhb1 and Fhb7 and its application

Abstract

The present application discloses a set of multiplex PCR marker primer sets capable of simultaneously detecting wheat fusarium head blight resistance genes Fhb1 and Fhb7, wherein the primer set is composed of primers whose nucleotide sequences are sequentially shown as SEQ ID NO.1-SEQ ID NO.4; the primer set realizes the simultaneous detection of multiplex PCR markers of wheat fusarium head blight resistance genes Fhb1 and Fhb7 for the first time, and the two resistance genes can be detected by one PCR, thereby improving the molecular marker-assisted selection efficiency and accelerating the wheat breeding process; in addition, the molecular marker primer pair is obtained by manual comparison and correction, and has a high amplification efficiency and a good specificity of the amplification result, thereby further improving the accuracy of molecular marker-assisted selection.

Description

Technical Field

[0001] The present invention relates to the field of molecular markers, in particular to a method for simultaneously detecting wheat scab resistance genes. Fb1 and Fb7 Multiplex PCR labeled primer sets and their applications. Background Art

[0002] Wheat is one of the most important food crops, and its production safety is of great significance to social and economic stability. Wheat production is susceptible to a variety of diseases. Fusarium graminearum-caused scab and powdery mildew caused by Blumeria graminis f.sp.tritici seriously affect wheat yield and quality (Parry DW, Jenkinson P, Mcleod L. Fusarium Ear Blight (Scab) in Small Grain Cereals-a Review. Plant Pathology, 1995, 44: 207-238; Zhao Z, Sun H, Song W,Lu M, Huang J, Wu L, Wang X, Li H. Genetic analysis and detection of thegeneMlLX99on chromosome 2BL conferring resistance to powdery mildew in thewheat cultivar Liangxing 99. Theoretical&Applied Genetics, 2013, 126: 3081-3089.). In my country, wheat fusarium rust used to occur mainly in the wheat-growing areas in the middle and lower reaches of the Yangtze River, the winter wheat-growing areas in south China, and the spring wheat-growing areas in northeast China. In recent years, it has spread to the Huanghuai wheat-growing areas, the northern wheat-growing areas, the southwestern wheat-growing areas, and the northwestern wheat-growing areas.

[0003] Fb1 and Fb7Li G, Zhou J, JiaH, Gao Z, Fan M, Luo Y, Zhao P, Xue S, Li N, Yuan Y, Ma S, Kong Z, Jia L, AnX, Jiang G, Liu W, Cao W, Zhang R, Fan J, Xu X, Liu Y, Kong Q, Zheng S, WangY, Qin B, Cao S, Ding Y, Shi J, Yan H, Wang X, Ran C, Ma Z. Mutation of aHistidine-Rich Calcium-Binding-Protein Gene in Wheat Confers Resistance toFusarium Head Blight. 51: 1106-1112; Fb1Resistance to Fusarium Head Blight in Wheat. Nature Genetics, 2019, 51: 1099-1105;WANG HW, SUN SL, GE WY, ZHAO LF, HOU BQ, WANG K, LYU ZF, CHEN LY, XU SS, GOUJ, LI M, SU PS, LI XF, WANG GP, BO CY, FANG XJ, ZHUANG WW, CHENG XX,WU JW, DONG LH, CHEN WY, LI W, XIAO GL, ZHAO JX, HAO YC, XU Y, GAO Y,LIU WJ, Liu, YH, Yin, HY, Li JZ, Li X, Zhao, Y, Wang XQ, Ni F, Ma X, LiA F, Xu, SS, Bai, GH, Nevo, E, Gao, CX, Ohm, H, Kong, LR. Horizontal gene transfer of Fb7 from fungus underlies Fusarium head blight resistance inwheat. Science, 2020, 368:eaba5435). in, Fb1 Located on the short arm of chromosome 3B, it is currently the most widely used and successful disease resistance locus in wheat breeding for Fusarium head blight resistance (Xie GQ, Zhang MC, ChakrabortyS, Liu CJ. The effect of 3BS locus of Sumai 3 on Fusarium head blight resistance in Australian wheats. Animal Production Science. 2007, 47:603-607). Its diagnostic marker has been widely used (Zhu Zhanwang, Xu Dengan, Cheng Shunhe, Gao Chunbao, Xia Xianchun, Hao Yuanfeng, He Zhonghu. Genes for Fusarium head blight resistance in Chinese wheat varieties Fb1 Identification and traceability of Fusarium fusiformis. Acta Agronomica Sinica, 2018, 44: 473-482), which plays an important role in promoting breeding work against Fusarium fusarium. Fb7 Derived from the wheat relative Thinopyrum longipedum ( Thinopyrum ponticum)7EL chromosome. Through continuous backcrossing, researchers have successfully created a small segment substitution line of wheat-Elygropyrum longipedula that carries this locus. It has been successfully applied to wheat breeding. Fb7 The first wheat variety of the program was approved in 2021. Wheat fusarium head blight resistance is a quantitative trait regulated by multiple genes. Aggregating different resistance genes can promote the production of long-lasting and stable resistance, which is of great significance to wheat fusarium head blight resistance breeding.

[0004] Multiplex PCR can identify multiple gene loci in the same reaction system, greatly saving time and reagents. It is efficient and economical (Xu Likui, Pan Binrong, Yue Gaohong, Mei Xixue, Liu Yongan, Zhang Zongchen, Zhou Zhihui. Multiplex PCR molecular identification technology for glutinous wheat resistant to powdery mildew [J]. Journal of Nuclear Agricultural Sciences, 2014, 28: 1203-1207). However, there are relatively few multiplex PCR primers that have been successfully applied in wheat. This is because the primers for multiplex PCR are not a simple mixture of single PCR primers. When designing the primer combination, the following considerations need to be considered: (1) Avoiding the formation of dimers between primers, which affects the amplification and detection of the target fragment; (2) There is no significant complementarity between each primer and other amplified fragments and templates, and the homology between amplified fragments cannot be too high; (3) The annealing temperature of the primers is as close as possible, and the length difference cannot be too large; (4) There is a certain difference in the size of the amplified fragments to facilitate electrophoresis detection. Multiplex PCR primers that meet all these requirements are difficult to obtain, which in turn affects the application of multiplex PCR primers. At present, there are many problems in the application of multiplex PCR primers. Fb1 and Fb7 Both genes were identified by PCR separately, and there are no reports on multiplex PCR markers for simultaneous identification of two genes. Summary of the invention

[0005] In view of the above problems, the present application provides a method for simultaneously detecting wheat scab resistance genes. Fb1 and Fb7 A multiplex PCR marker primer set was developed to achieve a one-time detection of wheat ergot resistance genes and improve the efficiency of wheat breeding selection.

[0006] Specifically, the present application is implemented through the following technical solutions:

[0007] First, this application provides a set of genes that can simultaneously detect wheat scab resistance Fb1 and Fb7 A multiplex PCR labeling primer set, the primer set includes four sets of primers whose nucleotide sequences are respectively shown as SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3, and SEQ ID NO.4.

[0008] Secondly, the present application also provides the above-mentioned multiple PCR marker primer set for simultaneously detecting wheat scab resistance genes Fb1and Fb7 The specific steps are as follows: using wheat genomic DNA as a template, performing PCR amplification with primers with nucleotide sequences as shown in SEQ ID NO.1-SEQ ID NO.4, and then performing electrophoresis on the amplified product; if a band of 226 bp appears in the electrophoresis product, it is determined that the wheat carries the wheat scab resistance gene Fhb1; If a band of 449 bp appears, it is determined that the wheat carries the ergot resistance gene. Fb7 If two bands of 226 bp and 449 bp appear at the same time, it is determined that the wheat carries the wheat scab resistance gene at the same time. Fb1 and Fhb7; If the two bands of 226 bp and 449 bp do not appear, it is considered that the wheat does not carry the wheat scab resistance gene. Fb1 and Fhb7. Among them, the 226bp band corresponds to the gene Fb1 , the 449 bp band corresponds to the gene Fb7 .

[0009] Further, the above PCR amplification system (10 μL): 2× Rapid Taq Master Mix 5 μl (Nanjing Novozyme Biotechnology Co., Ltd.), 0.25 μl of each of the four primers at a concentration of 10 μM, and a concentration of 50 ng μL ‒1 3 µl of template DNA, supplemented with ddH2O to 10 µl; the nucleotide sequences of the primers are shown in SEQ ID NO.1-SEQ ID NO.4;

[0010] PCR amplification procedure: step 1: 94°C, 3 min; step 2: 94°C 15 s, 58°C 30 s, 72°C 30 s extension, 35 cycles; step 3: 72°C extension for 5 min; amplification products were detected by 1.5% agarose gel electrophoresis.

[0011] In wheat disease resistance breeding, the resistance of wheat can be selected in the early generation through the detection results of the molecular marker, thus accelerating the breeding process. Fb1 and Fb7 Simultaneous detection of multiple PCR markers improves the efficiency of molecular marker-assisted selection. In addition, the molecular marker primer pair of the present invention is obtained by manual comparison and correction, and has high amplification efficiency and good specificity of amplification results, further improving the accuracy of molecular marker-assisted selection. BRIEF DESCRIPTION OF THE DRAWINGS

[0012] Figure 1 Comparative electropherograms were developed for the M1P7 primer set in Example 1.

[0013] Figure 2 This is the comparative electrophoresis diagram for the verification of the M1P7 primer set in Example 1.

[0014] Figure 3 This is the electrophoresis diagram of the 92 strain materials detected in Example 2. DETAILED DESCRIPTION

[0015] The Ningmai 9, Yangmai 158, Shannong A064 and Yangmai 18 involved in the following examples were stored and provided by the wheat genetics and breeding team of Jiangsu Academy of Agricultural Sciences. The 92 strain materials were Ningmai 13 (carrying Fb1 ) (see the literature "Jiang Peng, Zhang Peng, Yao Jinbao, Wu Lei, He Yi, Li Chang, Ma Hongxiang, Zhang Xu. Characteristic characteristics and related gene loci analysis of Ningmai series wheat varieties. Chinese Agricultural Science, 2022, 55: 233-247") and Shannong A064 (carrying Fb7 ), the hybrid offspring used in the embodiment is the F5 generation, which was hybridized and provided by the wheat genetics and breeding team of Jiangsu Academy of Agricultural Sciences.

[0016] Example 1

[0017] 1. Materials and methods

[0018] The test materials include Ningmai No. 9 (only Fb1 )、Yangmai 158 (without carrying Fb1 and Fb7 )、Shannong A064 (carry only Fb7 ) and Yangmai 18 (carry only Fb1 ) (see the literature "Jiang Peng, Zhang Peng, Yao Jinbao, Wu Lei, He Yi, Li Chang, Ma Hongxiang, Zhang Xu. Trait characteristics and related gene loci analysis of Ningmai series wheat varieties. Chinese Agricultural Science, 2022, 55: 233-247; Jiang Zhengning, Lv Guofeng, Wang Ling, Chen Tiantian, Jiang Wei, Li Dongsheng, Gao Derong, Zhang Yong. Molecular detection of extended resistance genes for Fusarium head blight in Yangmai varieties (lines) and their resistance evaluation. Journal of Wheat Crops, 2019, 39(12): 1406-1415") and 92 advanced generation lines (F5 generation).

[0019] In this example, Primer 6.0 primer design software was used to design multiplex PCR primers. All primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0020] All wheat seeds of the experimental materials were germinated at room temperature for about 7 days, young leaves were cut, and genomic DNA was extracted using the CTAB method (for this extraction method, see the literature "Porebski S, Bailey L, Baum B. Modification of CtabDNA Extraction Protocol for Plants Containing High Polysaccharide and Polyphenol Components. Plant Molecular Biology Reporter, 1997, 15: 8-15").

[0021] Used as a comparative example Fb1 The diagnostic marker JAASM395 (see Chinese patent ZL201811515195.8) and Fb7 Diagnostic flags for X, HAO YC, XU Y, GAO Y, LIU WJ, Liu, YH, Yin, HY, Li JZ, Li X, Zhao,Y, Wang XQ, Ni F, Ma 2020, 368:eaba5435”) was performed using the PCR procedure and system reported in the literature.

[0022] 2. Development and validation of multiplex PCR markers

[0023] When using existing software to design primers, usually a single marker is developed and then the primers are mixed, but this method is prone to primer binding and ineffective amplification. Therefore, in the primer design process of this embodiment, based on the results provided by the software, each primer is manually adjusted and evaluated to avoid specific binding between different primers and increase the amplification efficiency of the target fragment.

[0024] Table 1

[0025]

[0026] PCR amplification system (10 μL): 2× Rapid Taq Master Mix 5 μl (P222-AA, Vazyme), 0.25 μl of each of the forward and backward primers at a concentration of 10 μM, and a concentration of 50 ng / μL 3 µl of template DNA, add ddH2O to 10 µl;

[0027] PCR amplification program: Step 1: 94°C, 3 min; Step 2: 94°C 15 s, 58°C 30 s, 72°C 30 s extension, 35 cycles; Step 3: 72°C extension for 5 min. The amplified products were detected by 1.5% agarose gel electrophoresis.

[0028] Table 1 Primer amplification results Figure 1 shown. Figure 1 In the figure, M is DL2000 marker, lanes 1-19 are randomly selected lines from 92 hybrid offspring of Ningmai 13 and Shannong A064, and the following lanes are Ningmai 9, Yangmai 158, Yangmai 18 and Shannong A064 (repeated 2 times). The amplification results of primer set A are in line with expectations, that is, Ningmai 9 and Yangmai 18 can amplify the target band of Fhb1, Yangmai 158 cannot amplify two target bands, and Shannong A064 can amplify the target band of Fhb7. The amplification results of primer set B are not in line with expectations. Yangmai 158 and Shannong A064 of primer set C have weak positive bands of Fhb1, which will affect the interpretation of the results. Therefore, primer set A can be used as a multiplex PCR primer set, and the applicant named it M1P7.

[0029] We further used 20 high-generation lines (F5 generation) of wheat materials to investigate the relationship between JAASM395, Fb7 Diagnostic markers, M1P7 primer comparison test, the results are as follows Figure 2 and as shown in Table 2 below.

[0030] Table 2

[0031]

[0032] Figure 2 In the Fb1 Amplification of diagnostic marker JAASM395 (SEQ ID NO.13, primer F: GTCTCCGTTCAATTCGGTGAGT; SEQ ID NO.14 primer R: GACAATGTGAAGGCGTTGTCTA), B is Fb7 Amplification of diagnostic markers (SEQ ID NO.15 primer F: AACATGCTGCGCCGTCAACCCTTGG; SEQ ID NO.16 primer R: ATCCAAGGGAAGTCCGTGGACCATG), C is the amplification of multiple PCR marker M1P7, the 20 wheat materials shown in lanes 1-20 are high-generation lines (F5 generation) randomly selected from 92 hybrid progenies of Ningmai 13 and Shannong A064, lane 21 is Ningmai 9, 22 is Yangmai 158, 23 is Shannong A064, and 24 is Yangmai 18. The 226 bp band corresponds to Fb1 , 449bp band corresponds to Fb7 , Ningmai No. 9, Yangmai 18 Fb1 , only a 226bp band can be amplified, Shannong A064 carries Fb7 , only a 449 bp band could be amplified, and Yangmai 158 did not carry Fb1 and Fb7 , two target bands could not be amplified. Multiple PCR markers M1P7 and JAASM395 and Fb7 The results of diagnostic marker amplification were completely consistent (Table 2).

[0033] Example 2 Application of multiplex PCR marker primer set M1P7

[0034] 92 hybrid F5 generation materials of Ningmai 13 and Shannong A064 were rapidly identified, and the PCR system and amplification procedure were the same as in Example 1. The test results are as follows Figure 3 As shown in Table 3.

[0035] Table 3

[0036]

[0037] From Table 3 and Figure 3 The test results show that among these 92 materials, F 1. There are 60 copies of materials, carry Fb7 There were 51 samples with both loci, and 37 samples with both loci. These identification results were obtained by one PCR test, which improved the detection efficiency and provided support for wheat disease resistance breeding.

Claims

1. Multiple PCR marker primer sets for simultaneous detection of wheat scab resistance genes Fb1 and Fb7 The application is characterized in that The application refers to using wheat genomic DNA as a template and a multiplex PCR marker primer set as a primer for PCR amplification followed by electrophoresis; If a band of 226 bp appears in the electrophoresis product, it is determined that the wheat carries the wheat scab resistance gene Fhb1; If a band of 449 bp appears, it is determined that the wheat carries the ergot resistance gene. Fb7 If two bands of 226 bp and 449 bp appear at the same time, it is determined that the wheat carries the wheat scab resistance gene at the same time. Fb1 and Fhb7; The multiplex PCR marker primer set consists of a primer F1 having a nucleotide sequence as shown in SEQ ID NO.1, a primer F2 having a nucleotide sequence as shown in SEQ ID NO.2, a primer R1 having a nucleotide sequence as shown in SEQ ID NO.3, and a primer R2 having a nucleotide sequence as shown in SEQ ID NO.

4. 。 2. The use according to claim 1, characterized in that The PCR amplification refers to: PCR amplification system: 2× Rapid Taq Master Mix 5 µl, 10 µM primer F1 0.25 µl, 10 µM primer F2 0.25 µl, 10 µM primer R1 0.25 µl, 10 µM primer R2 0.25 µl, 50 ng / µL template DNA 3 µl, ddH2O to make up to 10 µl; PCR amplification program: Step 1: 94°C, 3 min; Step 2: 94°C for 15 s, 58°C for 30 s, 72°C for 30 s, 35 cycles; Step 3: 72°C for 5 min.

Images