Caffeoyl-CoA O-methyltransferase CcOMT2 from Citrus aurantium and its application

Abstract

This invention discloses the caffeoyl-CoA methyltransferase CcOMT2 from *Citrus reticulata* and its applications. CcOMT2 is 747 bp in length, encoding 248 amino acids. CcOMT2 exhibits high caffeoyl-CoA methyltransferase activity in vitro using 3′-OH-norhesperidin as a substrate. Alkaline conditions effectively enhance its activity, and the activity is significantly increased in the presence of certain divalent cations. CcOMT2 can serve as a target gene for engineered bacteria to catalyze the in vitro conversion of 3′-OH-norhesperidin to norihesperidin, demonstrating significant application value.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and in particular relates to a caffeoyl-CoA oxygen methyltransferase CcOMT2 of citrus aurantium, and also relates to the application of the caffeoyl-CoA oxygen methyltransferase CcOMT2 of citrus aurantium to catalyze 3′-OH-demethylnobiletin to generate nobiletin. Background Art

[0002] Chachi (Citrus Reticulata "Chachi") is a plant of the genus Citrus in the Rutaceae family. The mature peel can be used as medicine. It is mainly produced in Xinhui, Guangdong, and is also known as Xinhui orange and big red orange. The fruit is edible and the peel can be made into tangerine peel, also known as Guangdong tangerine peel (CitriReticulatae Pericarpium, CRP).

[0003] Nobiletin is one of the index components for quality control in tea-branch orange, and is also the main biologically active component of tea-branch orange. As a polymethoxylated flavonoid compound, nobiletin has better biomembrane permeability and higher bioavailability than non-polymethoxylated flavonoid compounds. It has antioxidant, anti-inflammatory, anti-cancer, anti-tumor, and anti-atherosclerotic activities. Currently, nobiletin is mainly extracted from medicinal materials or chemically synthesized, which has problems such as complex process, production of by-products, and environmental pollution.

[0004] Citrus aurantium is rich in flavonoid O-methyltransferase (FOMT), which provides a methyl donor through S-adenosyl-l-methionine (SAM) to replace the hydroxyl group on the benzene ring of flavonoids to form oxygen-methylated flavonoids. According to the molecular weight and cation dependence of OMT protein, plant OMT can be divided into two categories: caffeic acid OMT (COMT) and caffeoyl-CoAOMT (CCoAOMT). At present, the FOMTs reported for the biosynthesis of citrus flavonoids include CitOMT and CitOMT2 of the COMT subfamily, and CrOMT1 of the CCoAOMT subfamily, but none of them has the function of catalyzing 3′-OH-demethylnobiletin to produce nobiletin. Summary of the invention

[0005] In view of this, the present invention adopts molecular biological technology to clone the caffeoyl-CoA oxygen methyltransferase gene CcOMT2 related to the synthesis of nobiletin, and analyzes the nucleotide sequence and translated amino acid sequence of the gene. The function of the caffeoyl-CoA oxygen methyltransferase CcOMT2 related enzyme for the synthesis of nobiletin is verified by using the Escherichia coli prokaryotic expression system. The relevant oxygen methyltransferase obtained by protein purification can directly catalyze the synthesis of nobiletin in vitro. That is, one of the purposes of the present invention is to provide a tea branch orange caffeoyl-CoA oxygen methyltransferase CcOMT2; the second purpose of the present invention is to provide a tea branch orange caffeoyl-CoA oxygen methyltransferase gene CcOMT2; the third purpose of the present invention is to provide the use of the tea branch orange caffeoyl-CoA oxygen methyltransferase CcOMT2 in the preparation of a catalyst for converting 3′-OH-demethylnobiletin into nobiletin; the fourth purpose of the present invention is to provide the use of the tea branch orange caffeoyl-CoA oxygen methyltransferase gene CcOMT2 in the reconstruction of the nobiletin synthesis pathway in prokaryotes; the fifth purpose of the present invention is to A method for preparing a recombinant caffeoyl-CoA oxygen methyltransferase CcOMT2 is provided; a sixth object of the present invention is to provide a recombinant caffeoyl-CoA oxygen methyltransferase CcOMT2 prepared by the method; a seventh object of the present invention is to provide the use of the recombinant caffeoyl-CoA oxygen methyltransferase CcOMT2 in preparing a catalyst for converting 3′-OH-demethylnobiletin into nobiletin; an eighth object of the present invention is to provide the optimal reaction conditions for the recombinant caffeoyl-CoA oxygen methyltransferase CcOMT2 in catalyzing the conversion of 3′-OH-demethylnobiletin into nobiletin.

[0006] In order to achieve the above object, the present invention provides the following technical solutions:

[0007] In the first aspect, the present invention first protects a caffeoyl-CoA oxygen methyltransferase CcOMT2, wherein the protein is any one of the following:

[0008] (A1) the amino acid sequence is shown in SEQ ID NO.2;

[0009] (A2) a protein having 95% or more identity with the protein shown in (A1) and having the same function as the protein shown in (A1) obtained by substitution and / or deletion and / or addition of amino acid residues of the amino acid sequence shown in SEQ ID NO.2;

[0010] (A3) A protein having the same function obtained by linking a cousin to the N-terminus and / or C-terminus of (A1) or (A2).

[0011] Those skilled in the art can easily mutate the nucleotide sequence encoding the protein of the present invention by using known methods, such as directed evolution or point mutation. Those artificially modified nucleotides having 95% or more identity with the nucleotide sequence of the isolated protein of the present invention are derived from the nucleotide sequence of the present invention and are equivalent to the sequence of the present invention as long as they encode the protein and have the function of the protein.

[0012] In some specific embodiments, the CcOMT2 is derived from Citrus aurantium.

[0013] In a second aspect, the present invention also protects a biological material, which is any one of the following B1) to B4):

[0014] (B1) a DNA molecule encoding the caffeoyl-CoA oxygen methyltransferase CcOMT2;

[0015] (B2) an expression cassette containing the DNA molecule described in (B1);

[0016] (B3) a recombinant vector containing the DNA molecule described in (B1), or a recombinant vector containing the expression cassette described in (B2);

[0017] (B4) A recombinant microorganism containing the DNA molecule described in (B1), or a recombinant microorganism containing the expression cassette described in (B2), or a recombinant microorganism containing the recombinant vector described in (B3).

[0018] In some specific embodiments, the DNA molecule (B1) is selected from the following (C1) or (C2):

[0019] (C1) the nucleotide sequence is shown in SEQ ID NO.1;

[0020] (C2) A DNA molecule having at least 95% or more homology with the nucleotide sequence shown in SEQ ID NO: 1 and encoding a protein having the same function.

[0021] The vectors of the present invention are well known to those skilled in the art, including but not limited to plasmids, phages, viral vectors, etc., specifically, vector pET32a.

[0022] In a third aspect, the present invention also protects the use of the aforementioned caffeoyl-CoA oxygen methyltransferase CcOMT2 and the aforementioned biomaterial in the conversion of 3′-OH-demethylnobiletin into nobiletin.

[0023] Specifically, the present invention protects the use of the aforementioned caffeoyl-CoA oxygen methyltransferase CcOMT2 as a catalyst for converting 3′-OH-demethylnobiletin into nobiletin.

[0024] More specifically, the caffeoyl-CoA oxygen methyltransferase gene CcOMT2 is a key gene that catalyzes the conversion of 3′-OH-demethylnobiletin into nobiletin.

[0025] More specifically, the optimum temperature for the catalytic reaction is 42°C, the optimum pH is Tris-HCl pH 9, and when Mg is added 2+ , Mn 2+ 、Co 2+ The activity of the reaction was significantly increased when divalent cations were present.

[0026] The invention provides a method for preparing a recombinant caffeoyl-CoA oxygen methyltransferase CcOMT2. The method comprises the following steps: connecting a caffeoyl-CoA oxygen methyltransferase gene CcOMT2 of a citrus aurantium caffeoyl-CoA oxygen methyltransferase as shown in SEQ ID NO.1 into a plasmid pET32a BamHI and XhoI restriction sites to obtain a recombinant expression vector pET32a-CcOMT2, transforming the obtained recombinant expression vector into an expression strain BL21 (DE3), inducing expression at 16°C and with a final IPTG concentration of 0.5 mM, extracting and purifying to obtain the recombinant caffeoyl-CoA oxygen methyltransferase CcOMT2 of a citrus aurantium caffeoyl-CoA oxygen methyltransferase.

[0027] The extraction method comprises collecting the bacterial cells, ultrasonically breaking them at a power of 30%, with a total ultrasonic time of 13 minutes, each ultrasonication lasting 10 seconds and a pause of 10 seconds; then centrifuging at 4°C and 4000g for 45 minutes and collecting the supernatant.

[0028] The purification was performed using a nickel column, and elution was performed using an eluent containing imidazole at a concentration of 250 mM.

[0029] The recombinant caffeoyl-CoA oxygen methyltransferase CcOMT2 prepared by the method. When the substrate of the prepared recombinant enzyme is 3′-OH-nomethylnobiletin, the optimal temperature of the enzymatic reaction of the expressed product is 42°C, the optimal pH is alkaline (Tris-HCl pH=9), and when Mg is added 2+ , Mn 2+ 、Co 2+ The activity of the reaction was significantly increased when divalent cations were present.

[0030] The beneficial effects of the present invention are as follows: the present invention discloses a caffeoyl-CoA oxygen methyltransferase CcOMT2 of tea citrus and its gene, and the caffeoyl-CoA oxygen methyltransferase gene CcOMT2 of tea citrus is expressed in prokaryotic cells and the enzyme activity is measured, and it is measured that it has a high caffeoyl-CoA oxygen methyltransferase activity, and its DNA base sequence and amino acid sequence are different from the reported caffeoyl-CoA oxygen methyltransferase gene sequence. Therefore, we believe that this is a new caffeoyl-CoA oxygen methyltransferase gene, which is suitable for the production of Mg 2+ , Mn 2+ 、Co 2+ The enzyme activity of its prokaryotic expression is high in the presence of divalent cations. As the target gene of engineering bacteria, the recombinant protein is prepared as a catalyst for in vitro synthesis of nobiletin, which has a good application prospect as a drug for anti-inflammatory, anti-cancer and prevention of cardiovascular and cerebrovascular diseases. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] Figure 1 : SDS-PAGE electrophoresis of CcOMT2 recombinant protein; wherein: lane 1: protein molecular weight standard; lane 2: bacteria before induction; lane 3: unpurified supernatant after induction; lane 4: purified CcOMT2-pET32a recombinant protein.

[0032] Figure 2 : HPLC (A) and mass spectrometry (B) analysis of the reaction products of CcOMT2 and 3′-OH-nobiletin.

[0033] Figure 3 :Effects of different temperatures (A), pH (B) and divalent cations (C) on the activity of CcOMT2 recombinant protein. DETAILED DESCRIPTION

[0034] The present invention will be further described below in conjunction with the accompanying drawings and specific embodiments so that those skilled in the art can better understand the present invention and implement it, but the embodiments are not intended to limit the present invention.

[0035] In the present invention, 3′-OH-demethylnobiletin and nobiletin are used as standard controls to test the enzyme activity expressed by the caffeoyl-CoA oxygen methyltransferase gene CcOMT2.

[0036] Example 1

[0037] Cloning of Caffeoyl-CoA O-methyltransferase Gene CcOMT2 from Citrus aurantium

[0038] 1.1 Extraction of total RNA from Citrus aurantium leaves and reverse transcription to synthesize cDNA

[0039] Take the leaves of the tea-branch orange, clean them, grind them in liquid nitrogen, quickly add the powder to a 1.5mL Eppendorf (EP) centrifuge tube containing lysis solution, shake it thoroughly, extract total RNA according to the instructions of the universal plant total RNA rapid extraction kit, measure the RNA concentration and purity, and store it at -80℃ for later use. Use the extracted total RNA sample as a template to synthesize cDNA using a reverse transcription kit, and use the cDNA as a subsequent cloning template.

[0040] 1.2 Full-length cloning of target gene

[0041] Primers for amplifying the caffeoyl-CoA oxygen methyltransferase gene CcOMT2 were designed based on the caffeoyl-CoA oxygen methyltransferase gene CcOMT2 (CZG_jg13019_CCH) in the tea branch orange genome. The upstream primer of CcOMT2 is: CCGGATCCATGGCTCCGAATCAAGAAGG (SEQ ID NO.3), and the downstream primer of CcOMT2 is: CCCTCGAGTCAACTAATGCGGCGACATAA (SEQ ID NO.4). Using the cDNA of tea branch orange as a template, the sequences shown in SEQ ID NO.3 and SEQ ID NO.4 were used as primers for PCR amplification to obtain the full length of the CcOMT2 gene, and the amplified product was subjected to agarose gel electrophoresis. The target gene was recovered and then connected with the pET32a vector to obtain the pET32a-CcOMT2 vector, which was then transformed into E. coli.Trans-DH5α competent cells, and the obtained positive clones were sent to GenScript Biotech Co., Ltd. for sequencing; the results showed that the nucleotide sequence of the CcOMT2 gene was as shown in SEQ ID NO.1, and the amino acid sequence encoded by it was as shown in SEQ ID NO.2.

[0042] Example 2

[0043] Construction of recombinant vector, prokaryotic expression and purification of recombinant protein of caffeoyl-CoA O-methyltransferase gene CcOMT2 from Citrus aurantium

[0044] The target gene CcOMT2 cloned in Example 1 and the pET32a empty plasmid were double-digested with BamHI and XhoI respectively, and the products were recovered and ligated with T4 DNA ligase to obtain the recombinant plasmid pET32a-CcOMT2. The recombinant plasmid was transformed into Escherichia coli DH5α competent cells. The correct pET32a-CcOMT2 was sent to GenScript Biotech Co., Ltd. for sequencing, and the sequencing results were consistent with the target sequence.

[0045] Extract the pET32a-CcOMT2 plasmid and transfer it into the expression bacteria BL21 (DE3). Add 800 μL of LB medium containing ampicillin resistance to a 1.5 mL centrifuge tube, expand the culture into a conical flask at a ratio of 1:100, and culture at 37°C, 200 rpm shaking until OD600 is about 0.6. Take 1 mL of bacterial solution and save it as a positive control before induction. Add IPTG for induction. The final concentration of IPTG is 0.5 mM. Induce at 16°C for 20 h. After induction, centrifuge the bacterial solution at 4000 g for 10 min to collect the bacteria, discard the supernatant, resuspend the bacteria with 10 mM lysis buffer, and ultrasonically break them. The ultrasonic power is 30%, and the total ultrasonic time is 13 min; 4°C, 4000 g, 45 min, take the supernatant into a centrifuge tube containing a treated nickel column, and then use 20 mM wash buffer and 250 mM elution buffer to elute in turn. The buffer eluate was further desalted and concentrated using a Millipore ultrafiltration centrifuge tube to obtain the purified protein. The previously stored pre-induction bacterial solution was centrifuged at 12000g for 1 min, the precipitate was resuspended in pure water, and an appropriate amount of 5× loading buffer was added. The supernatant after crushing and centrifugation and the purified protein were added with an appropriate amount of 5× loading buffer. These samples were boiled at 99℃ for 10min, and then the target protein was detected by SDS-PAGE, the protein electrophoresis diagram was observed and photographed for preservation. An appropriate amount of glycerol was added to the purified protein, and then stored at -80℃ for later use.

[0046] like Figure 1 As shown, the size of the purified protein sample is about 44 kDa, which is consistent with the theoretical calculated value of pET32a-CcOMT2 recombinant protein (44.37 kDa) and can be used for the next enzyme activity study.

[0047] Example 3

[0048] CcOMT2 in vitro enzyme activity assay

[0049] 3.1 Determination of CcOMT2 enzyme activity using 3′-OH-nomethylnobiletin as substrate

[0050] The enzymatic properties of CcOMT2 were analyzed using 3′-OH-nomethylnobiletin as substrate and SAM as methyl donor. The enzyme activity reaction system was 100 μL, including 35 μL of recombinant protein, 5 mM SAM, 200 μM substrate, 2 mM MgCl2, 1 mM DTT, 1% (v / v) glycerol, and the reaction buffer was Tris-HCl (pH 9). The reaction solution was mixed and placed in a 42°C metal bath at 300 rpm for 4 hours. 100 μL of methanol was added to mix well to terminate the reaction. The supernatant was centrifuged and the solvent was evaporated to dryness in a solvent evaporation workstation. After re-dissolving with 80 μL of anhydrous ethanol, the supernatant was centrifuged and used for subsequent high performance liquid chromatography (HPLC) and mass spectrometry analysis.

[0051] HPLC analysis conditions: Agilent 1260HPLC system; BDS HYPERSIL C18 chromatographic column (4.6mm×250mm, 5μm); mobile phase: purified water containing 0.1% formic acid (A), acetonitrile (B); flow rate: 1mL / min; elution gradient: (1) 0-3min, 25-50% B; (2) 3-7min, 50-58% B; (3) 7-11min, 58-58% B; (4) 11-15min, 58-70% B; injection volume 10μL; column temperature: 30℃; detector: DAD detector; detection wavelength: 330nm.

[0052] High-resolution mass spectrometry analysis conditions: Agilent 1290-6545UPLC-QTOF system; mass spectrometry analysis was performed in positive ion mode.

[0053] 3.2 Effects of temperature, pH and divalent cations on the catalytic rate of CcOMT2

[0054] Determination of the effect of temperature on enzyme catalytic rate: the reaction buffer and time were Tris-HCl (pH 8.0) and 4 h, respectively, and 10 temperature gradients were set (16°C, 25°C, 30°C, 37°C, 42°C, 50°C, 55°C, 60°C, 65°C, 70°C). Determination of the effect of pH on enzyme catalytic rate: the reaction temperature and time were 42°C and 4 h, respectively, and 9 pH gradients were set (4, 5, 6, 7, 8, 9, 10, 11, 12), including citric acid-sodium citrate buffer pH (4-6), sodium dihydrogen phosphate-disodium hydrogen phosphate buffer pH (6-8), Tris-HCl pH (7-9), disodium hydrogen phosphate-sodium hydroxide buffer pH (9-12). Determination of the effect of divalent cations on enzyme catalytic rate: the reaction temperature, buffer and time were 42°C, Tris-HCl (pH 8) and 4 h, respectively, and 10 divalent cations (Ca 2+ , Mn 2+ , Cu 2+ , Ba2+ , Sr 2+ , Fe 2+ 、Ni 2+ 、Co 2+ Mg 2+ 、Zn 2+ ) and metal ion chelator EDTA. After the above reaction is completed, 200 μL of methanol is added to fully mix to terminate the reaction, the supernatant is centrifuged and the solvent is evaporated to dryness in a solvent evaporation workstation, 80 μL of anhydrous ethanol is added for re-dissolution and centrifuged to obtain the supernatant for HPLC analysis to determine the amount of product generated. The chromatographic conditions are the same as above.

[0055] like Figure 2 As shown in the figure, after the CcOMT2 recombinant protein was incubated with the substrate 3′-demethylnobiletin, a new substance peak was detected in HPLC, and the reaction product was further confirmed to be nobiletin using mass spectrometry. Figure 3 It can be seen that when 3′-nomethylnobiletin is used as a substrate, the reaction rate of CcOMT2 recombinant protein is the highest when the temperature is 42°C and the reaction buffer is Tris-HCl (pH 9), and the protein prefers alkaline buffer. 2+ , Mn 2+ 、Co 2+ The activity of the enzyme was significantly increased by the addition of divalent cations, while the activity decreased after the addition of EDTA, indicating that the enzyme was dependent on divalent cations.

[0056] The protection content of the present invention is not limited to the above embodiments. Without departing from the spirit and scope of the inventive concept, changes and advantages that can be thought of by those skilled in the art are included in the present invention and are protected by the attached claims.

Claims

1. A caffeoyl-CoA oxygen methyltransferase CcOMT2, characterized in that: The amino acid sequence of the protein is shown in SEQ ID NO.

2.

2. The caffeoyl-CoA oxygen methyltransferase CcOMT2 according to claim 1, characterized in that The CcOMT2 is derived from Citrus aurantium.

3. A biomaterial, characterized in that: The biological material is any one of the following (B1) to (B4): (B1) a DNA molecule encoding the caffeoyl-CoA oxygen methyltransferase CcOMT2 according to claim 1 or 2; (B2) an expression cassette containing the DNA molecule described in (B1); (B3) a recombinant vector containing the DNA molecule described in (B1), or a recombinant vector containing the expression cassette described in (B2); (B4) A recombinant microorganism containing the DNA molecule described in (B1), or a recombinant microorganism containing the expression cassette described in (B2), or a recombinant microorganism containing the recombinant vector described in (B3).

4. The biomaterial according to claim 3, wherein the nucleotide sequence of the DNA molecule (B1) is as shown in SEQ ID NO:

1.

5. Use of the caffeoyl-CoA oxygen methyltransferase CcOMT2 according to any one of claims 1-2, or the biomaterial according to any one of claims 3-4, in the conversion of 3¢-OH-demethylnobiletin into nobiletin.

6. The use according to claim 5, characterized in that The CcOMT2 is a key enzyme gene that catalyzes the conversion of 3¢-OH-demethylnobiletin into nobiletin. The optimum temperature of the catalytic reaction is 42°C, and the optimum pH is Tris-HCl pH9.

Images