A method for detecting Hg 2+ Biosensor and detection method and application thereof

Abstract

The present invention relates to the field of biological detection technology, and in particular to a method for detecting Hg 2+ Biosensor and detection method and application of Hg 2+ The biosensor comprises the following components: a hairpin probe, the hairpin probe contains a half recognition site sequence of the nicking endonuclease Nb.BbvCI and a G-quadruplex sequence; a primer probe, the primer probe is complementary to a part of the hairpin probe. 2+ The biosensor can be used for Hg in American ginseng water extract based on the cascade signal amplification strategy of primer-template switching 2+ The ultra-sensitive detection of the biosensor is achieved by combining rolling circle amplification (RCA), multiple strand displacement amplification (MRSDA) and a G-quadruplex-based turn-on fluorescent switch. The biosensor has high detection sensitivity, can effectively control background signals, has good anti-interference ability, can be used for direct detection of American ginseng water extract samples, exhibits good selectivity, and has application prospects in the detection of complex matrix samples.

Description

Technical Field

[0001] The present invention relates to the field of biological detection technology, and in particular to a method for detecting Hg 2+ Biosensors, detection methods and applications. Background Art

[0002] The information disclosed in this background technology section is only intended to enhance the understanding of the overall background of the invention, and should not necessarily be regarded as an admission or any form of suggestion that the information constitutes the prior art already known to a person skilled in the art.

[0003] The Chinese medicine American ginseng is the dried rhizome of the Araliaceae plant panacis quinquefolii radix. In the theoretical system of traditional Chinese medicine, it has the effects of replenishing qi and nourishing yin, clearing heat and promoting body fluid. As a common medicinal material, it is widely used in clinical treatment and daily health care. During the cultivation process, American ginseng will absorb and accumulate a certain degree of toxic substances due to environmental pollution. Considering that it has a high frequency and amount of use in special populations such as patients and the weak, the monitoring of toxic substances in American ginseng has become an important part of drug safety that cannot be ignored. Among them, heavy metal pollution, especially mercury (Hg) pollution, has received increasing attention due to its severe toxicity and obvious bioaccumulation. Nearly 10,000 tons of Hg are discharged into the environment every year. These Hg are difficult to be biodegraded and continue to be enriched through the food chain. After entering the human body, they can hardly be excreted and show strong toxicity, causing permanent damage to the nervous system, immune system and digestive system. Therefore, the detection of Hg in American ginseng is of great significance for regulating food and drug safety and maintaining life and health.

[0004] To meet the above detection needs, some instrumental analysis methods have been developed, including atomic absorption spectroscopy (AAS), atomic fluorescence spectroscopy (AFS) and inductively coupled plasma emission mass spectrometry (ICP-MS). However, these methods rely on expensive and sophisticated instruments and are usually unable to directly detect complex matrix samples, which limits their application in field detection to a certain extent. In recent years, T-Hg-T-based analysis methods have attracted increasing attention due to their sensitivity, simple operation and strong anti-interference ability. In particular, some T-Hg-T analysis-nucleic acid amplification combined methods convert Hg signals into significantly amplified nucleic acid signals through cyclic nucleic acid replication, assembly or hydrolysis, further improving the sensitivity of detection. These methods usually obtain amplified signals through polymerization or nicking reactions based on DNA templates. However, the added DNA templates in these methods are usually unrelated to the target, and the non-specific interactions of this non-target-dependent template with other probes or enzymes can lead to false positive or false negative signals, resulting in reduced detection accuracy. Therefore, it is still necessary to develop new detection methods to meet the needs of sensitive and accurate detection of Hg. Summary of the invention

[0005] In view of the problems existing in the prior art, the present invention aims to provide a method for detecting Hg 2+ Biosensor and detection method and application of the present invention, the detection of Hg 2+ The biosensor can be used for Hg in American ginseng water extract based on the cascade signal amplification strategy of primer-template switching 2+ The ultra-sensitive detection of the biosensor is achieved by combining rolling circle amplification (RCA), multiple strand displacement amplification (MRSDA) and a G-quadruplex-based turn-on fluorescent switch. The biosensor has high detection sensitivity, can effectively control background signals, has good anti-interference ability, can be used for direct detection of American ginseng water extract samples, exhibits good selectivity, and has application prospects in the detection of complex matrix samples.

[0006] In order to achieve the above object, the technical solution of the present invention is as follows:

[0007] In a first aspect of the present invention, a method for detecting Hg 2+ The biosensor comprises the following components:

[0008] A hairpin probe, wherein the hairpin probe contains a half-recognition site sequence of a nicking endonuclease Nb.BbvCI and a G-quadruplex sequence;

[0009] A primer probe is complementary to a portion of the hairpin probe.

[0010] In one or more embodiments, the biosensor further comprises Thioflavin T, T4 ligase, Bst polymerase and nicking endonuclease Nb.BbvCI.

[0011] In one or more embodiments, the sequence of the hairpin probe is:

[0012] The bold letters in the sequence represent the recognition site of the nicking endonuclease Nb.BbvCI, and the underlined letters represent the G-quadruplex sequence.

[0013] In one or more embodiments, the sequence of the primer probe is:

[0014] AGCCACCACACCAGCAAGACGAC.

[0015] In a second aspect of the present invention, there is provided a method for detecting Hg 2+ Biosensors for detecting Hg 2+ Application in.

[0016] In a third aspect of the present invention, there is provided a method for preparing a method for preparing a water extract of American ginseng containing Hg2+ The method comprises the following steps: 2+ The biosensor detects:

[0017] 1) Boil the American ginseng slices with water, take the solution to obtain the American ginseng water extract, and fix the extract to obtain the sample to be tested;

[0018] 2) In T4 ligase reaction buffer, the hairpin probe and the sample to be tested are incubated for a period of time, and then T4 ligase is added, reacted at room temperature, and then heated to inactivate the T4 ligase;

[0019] 3) adding primer probe, deoxyribonucleoside 5'-triphosphate mixture and Bst polymerase to the mixture obtained in step 2), and reacting in the reaction buffer for a period of time; after the reaction is completed, adding nicking endonuclease Nb.BbvCI and continuing the reaction for a period of time;

[0020] 4) adding Thioflavin T to the mixture obtained in step 3) and maintaining the mixture at a certain temperature for a period of time;

[0021] 5) Performing fluorescence spectrum detection on the solution obtained in step 4).

[0022] In one or more embodiments, the composition of the T4 ligase reaction buffer in step 2) is 50 mM Tris-HCl (pH 7.5@25°C), 10 mM MgCl 2 , 10mM DTT, 1mM ATP.

[0023] In one or more embodiments, the reaction buffer in step 3) is composed of 20 mM Tris-HAc (pH 7.9), 100 μg mL -1 BSA, 50 mM KAc, 10 mM Mg(Ac) 2 ;

[0024] In one or more embodiments, KCl and H are added together with Thioflavin T in step 4). 2 O.

[0025] In one or more embodiments, the specific method of step 5) is to use a fluorescence spectrophotometer at an excitation wavelength of 425 nm to record the signal in the fluorescence spectrum region of 450-550 nm;

[0026] The present invention has the following beneficial effects:

[0027] The present invention proposes a method for detecting Hg 2+ The biosensor can be used for Hg in American ginseng water extract based on the cascade signal amplification strategy of primer-template switching 2+The biosensor in the present invention combines rolling circle amplification (RCA), multiple strand displacement amplification (MRSDA) and G-quadruplex-based turn-on fluorescence switch, both of which are based on Hg-dependent 2+ The generated template, RCA and MRSDA cascade amplification can provide higher detection sensitivity, and the target-dependent performance of the template in the cascade signal amplification can effectively control the background signal.

[0028] Hg in the American ginseng water extract of the present invention 2+ The detection method has good anti-interference ability and shows good performance in the detection of complex matrix samples. It can be successfully used for Hg in American ginseng water extract. 2+ It can be used for direct detection of American ginseng water extract samples, showing good selectivity and has application prospects in the detection of complex matrix samples.

[0029] The present invention provides a new Hg 2+ Ultrasensitive detection methods have promising application prospects in food and drug quality monitoring and health risk assessment. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] Figure 1 The cascade amplification method based on primer-template switching in the embodiment of the present invention detects Hg 2+ Schematic diagram.

[0031] Figure 2 (A) is a fluorescence spectrum diagram of different systems in the embodiment of the present invention, wherein the four curves from top to bottom are respectively positive system, Nb.BbvCI-free system, negative system, Hg-free system, 2+ and the system of Nb.BbvCI.

[0032] Figure 2 (B) is a PAGE gel imaging diagram in an embodiment of the present invention, M: DNA marker; 1: primer; 2: hairpin probe; 3: negative system; 4: no Nb.BbvCI system; 5: positive system.

[0033] Figure 3 The experimental conditions of different embodiments of the present invention are shown in Table 1. 2+ Influence of detection results, where (A) is T4 DNA ligase concentration; (B) is Bst polymerase concentration; (C) is Nb.BbvCI concentration; (D) is dNTPs concentration; (E) is RCA reaction time; (F) is MRSDA reaction time; and (G) is ThT concentration.

[0034] Figure 4 (A) is 0-7.5×10 -9 Different concentrations of Hg in the range of M2+ Fluorescence spectrum of the system in the presence of .

[0035] Figure 4 (B) is the fluorescence intensity of Hg in the embodiment of the present invention 2+ The error bars show the standard deviation of three independent test results.

[0036] Figure 5 Graph showing the selectivity experiment results in an embodiment of the present invention, with the error bars representing the standard deviation of the results of three parallel experiments. DETAILED DESCRIPTION

[0037] It should be noted that the following detailed descriptions are illustrative and are intended to provide further explanation of the present application. Unless otherwise specified, all technical and scientific terms used in the present application have the same meanings as those commonly understood by those skilled in the art to which the present application belongs.

[0038] It should be noted that the terms used herein are only for describing specific embodiments and are not intended to limit the exemplary embodiments according to the present application. As used herein, unless the context clearly indicates otherwise, the singular form is also intended to include the plural form. In addition, it should be understood that when the terms "comprise" and / or "include" are used in this specification, it indicates the presence of features, steps, operations, devices, components and / or combinations thereof.

[0039] The present invention will be further explained and illustrated below in conjunction with specific embodiments.

[0040] Example

[0041] Experimental Section

[0042] Reagents and instruments: American ginseng slices were purchased from the Affiliated Hospital of Shandong University of Traditional Chinese Medicine. 4 ) 2 、BaCl 2 、NiSO 4 、MnSO 4 、Pb(NO 3 ) 2 、AlCl 3, Thioflavin T (ThT) were provided by Sigma-Aldric (St Louis, MO, USA). SYBR Gold was purchased from Invitrogen Corporation (CA). T4 ligase, deoxyribonucleoside 5'-triphosphate mixture (dNTPs), Bst polymerase and nicking endonuclease Nb.BbvCI were provided by New England Biolabs (Beijing, China). All HPLC-purified DNA oligonucleotides (Table 1) were obtained from Sangon Biotech (Shanghai, China). All other reagents were analytical grade reagents and used without further purification. All solutions were prepared with ultrapure water provided by Milli-Q water purification system (Millipore Co., USA).

[0043] Table 1 DNA sequences used in the present invention

[0044]

[0045] Note: The bold letters in the sequence represent the recognition site of the nicking endonuclease Nb.BbvCI, and the underlined letters represent the G-quadruplex sequence.

[0046] Fluorescence spectra of samples were measured using a fluorescence spectrometer (Hitachi F-7000, Japan), and gel imaging was performed using an ultraviolet imaging system (Bio-RAD Laboratories Inc., USA).

[0047] Cascade signal amplification reaction based on primer-template switching:

[0048] In T4 ligase reaction buffer [50 mM Tris-HCl (pH 7.5@25°C), 10 mM MgCl 2 , 10 mM DTT, 1 mM ATP], 100 nM hairpin probe and Hg 2+ The mixture was incubated at 37°C for 2.0 h. Then, 2.0 UL -1 T4 ligase was reacted at room temperature for 3.0 h, and then heated at 65°C for 20 min to inactivate the T4 ligase. Subsequently, 100 nM primer, 0.4 mM dNTPs and 0.08 U μL -1 Bst polymerase was used in the reaction buffer [20 mM Tris-HAc (pH 7.9), 100 μg mL -1 BSA, 50 mM KAc, 10 mM Mg(Ac) 2 ] and reacted at 37°C for 1.5h. Finally, 0.5UμL - 1Nb.BbvCI was mixed with the mixture at 37°C for 3.0 h.

[0049] Fluorescence spectrum measurement:

[0050] To the mixture prepared above, 0.2 M KCl, 20 μM ThT and H 2 O and kept at 37 °C for 40 min. The fluorescence spectrum of the sample was measured using a Hitachi F-7000 fluorescence spectrometer. At an excitation wavelength of 425 nm, the signal in the 450-550 nm fluorescence spectrum region was recorded. The excitation and emission bandwidths were both 5.0 nm, and the photomultiplier voltage was 700 V.

[0051] Gel electrophoresis analysis:

[0052] The reaction products were analyzed by 12% non-denaturing polyacrylamide gel electrophoresis (PAGE). In the present invention, the dyeing material was SYBR Gold, and the working buffer was 1×TBE buffer (89mM boric acid, 2.0mM EDTA, 89mM Tris, pH 8.3). Gel electrophoresis was performed under the conditions of constant current 30mA, constant temperature 15°C, and running time 1.0h. After the gel was stained in a dark place for 40min, it was photographed with a UV imaging system.

[0053] Hg in American ginseng water extract 2+ Detection

[0054] Weigh 1.0 g of American ginseng slices, add 20 mL of distilled water, heat and keep boiling for 1 hour. After cooling, transfer part of the solution to a 25 mL volumetric flask and dilute with water to obtain the American ginseng water extract. 2+ According to the method in the above experimental part, Hg in the test solution was detected. 2+ .

[0055] Results and Discussion

[0056] Figure 1 The present invention describes the detection of Hg 2+ The working principle of the biosensor is based on the cascade amplification strategy of primer-template switching. The entire sensing process includes two steps: target-dependent RCA and subsequent MRSDA. In the target-dependent RCA process, two DNA probes, namely hairpin probes and primer probes, are designed. The hairpin probe contains the half-recognition site sequence of the nicking endonuclease Nb.BbvCI and the G-quadruplex sequence. The primer probe is a short DNA sequence complementary to a part of the hairpin probe. Hg 2+When present, it mediates T-Hg-T mismatch hybridization, causing the hairpin probe to fold into a dumbbell-shaped probe. The dumbbell probe is then circularized with the assistance of T4 ligase. With the circularized dumbbell probe as a template, RCA occurs under the action of an external primer and Bst polymerase to generate multiple copies of repetitions. Then, the nicking endonuclease Nb.BbvCI is added to nick the RCA template into a linear DNA chain, which serves as a primer for the subsequent MRSDA. Before the MRSDA step, under the action of Bst polymerase, DNA polymerization occurs with the cut RCA template as a primer and the RCA product as a template to form dsDNA. Afterwards, the MRSDA cycle reaction is initiated by the nicking action of the nicking endonuclease Nb.BbvCI. Once a nicking site is generated, the Bst polymerase starts polymerization at the 3' end of the nicking site, then displaces and releases multiple copies of the ssDNA repeat reporter containing a G-quadruplex structure, and finally generates enhanced fluorescence by inserting thioflavin T (ThT) into the G-quadruplex. On the contrary, in the absence of Hg 2+ In the case of , probe folding and cyclization will not occur. Therefore, subsequent RCA and MRSDA will not occur. The present invention has significant advantages in sensitivity by running two amplification reactions in series. In particular, MRSDA achieves significant amplification of G-quadruplex sequences through repeated cycles of cutting-extension-strand displacement at multiple sites. In addition, the target dependence of the template in the cascade amplification enables the background signal to be controlled.

[0057] 1. Feasibility study

[0058] In order to verify the feasibility of this method, the fluorescence spectra under different experimental conditions were measured. Figure 2 As shown in (A), when there is no Hg in the system 2+ When Nb.BbvCI is used, the fluorescence intensity of the system is very low because of the lack of Hg 2+ When Nb.BbvCI and Hg were used, RCA templates and strand displacement reactions could not be generated. 2+ In the absence of Hg, the system outputs a weak signal, indicating that almost no amplification reaction produces G-quadruplexes. This is because there is no Hg 2+ Without the participation of Hg 2+ When Hg 2+ In the presence of Hg, the RCA template was successfully generated and the subsequent cascade signal amplification proceeded as expected. 2+ However, the signal of the system without Nb.BbvCI is weak, indicating that MRSDA hardly occurs in the absence of Nb.BbvCI, indicating that MRSDA makes a major contribution to signal amplification and signal output.

[0059] To further verify the feasibility, the present invention embodiment carried out PAGE test on DNA in the system under different conditions. Figure 2 As shown in (B), lanes 1 to 5 represent primers, hairpin probes, negative system products, system products without Nb.BbvCI, and positive system products, respectively. Since the primer is a short single-stranded DNA, and the PAGE dye is mainly stained by inserting into double-stranded DNA, the primer bands in the PAGE imaging diagram are not obvious (lane 1). The hairpin probe contains double-stranded DNA, so it can insert the dye to produce obvious bands (lane 2). For the negative system product (lane 3), the hairpin probe band disappears, and a band with a migration rate slightly slower than that of the hairpin probe appears, and the band brightness is deeper than that of the hairpin probe. This shows that under the action of Bst polymerase, the stem of the hairpin probe is extended, and this hairpin structure cannot be cyclized by T4 ligase to form an RCA template, and will not trigger subsequent RCA. In lane 4, the hairpin probe band disappears, and multiple bands with slow migration speeds appear. This result shows that the RCA process has occurred, generating high molecular weight products with different mobility. Compared with lane 4, lane 5 has more bands and a wider molecular weight distribution, indicating that MRSDA produces amplification products of different molecular weights. Therefore, the fluorescence and PAGE analysis results confirm that the established method can be used for Hg 2+ Feasibility of detection.

[0060] 2. Optimize conditions

[0061] In the cascade amplification strategy based on primer-template switching of the present invention, ligation reaction, RCA and MRSDA are three key processes that affect the overall detection performance. In order to obtain better analytical performance, some key experimental conditions were optimized, including T4 ligase concentration, Bst polymerase concentration, nicking endonuclease Nb.BbvCI concentration, dNTPs concentration and RCA reaction time. F / F 0 (F and F 0 Represents the presence or absence of Hg 2+ The signal intensity at the time of ) is used as an indicator to evaluate the performance of different parameters. This example examines five levels of each parameter, and comprehensively examines the negative signal intensity, positive signal intensity and F / F of the system under different levels of parameters. 0 to select the optimal parameters.

[0062] T4 ligase is an important component that catalyzes the formation of RCA circular templates. Insufficient T4 ligase will result in the failure to complete the circularization of the RCA template within the specified time, resulting in false negative results and seriously reducing the accuracy of the test. Excessive T4 ligase may interact non-specifically with other reagents and affect the detection performance. This example studies the effect of 0.2, 0.4, 1.0, 2.0 and 4.0 U / μL T4 ligase concentrations on the detection results. Figure 3As shown in (A), with the increase of T4 ligase concentration, the negative signal remained almost unchanged, indicating that T4 ligase had almost no effect on the negative result; the positive signal line increased and then decreased. At 2.0 U / μL, F / F 0 Therefore, T4 ligase with a concentration of 2.0 U / μL was selected for subsequent detection.

[0063] Bst polymerase plays a chain extension role in RCA and MRSDA reactions. Insufficient Bst polymerase concentration will lead to reduced signal amplification efficiency and limit the sensitivity of detection; while excessive Bst concentration may cause unexpected effects due to non-specific interactions with the probe. Similarly, this example studies the effect of different Bst polymerase concentrations (0.02, 0.04, 0.08, 0.16 and 0.32 U / μL) on the results. The experimental results are shown in Figure 2. Figure 3 As shown in (B). As the concentration of Bst enzyme increases, the negative signal hardly changes, while the positive signal increases first and then decreases significantly. When the concentration of Bst polymerase is 0.08U / μL, F / F 0 The peak value was reached, and 0.08U / μL was selected as the optimal Bst polymerase concentration.

[0064] Nb.BbvCI plays a key role in the primer-template conversion process. Insufficient Nb.BbvCI will slow down or even interrupt the primer-template conversion, inhibit the amplification efficiency of MRSDA, and reduce the detection sensitivity. Figure 3 As shown in (C), five levels of Nb.BbvCI concentration were investigated: 0.3, 0.4, 0.5, 0.6, and 0.7 U / μL. As the concentration of Nb.BbvCI increased, the negative signal remained almost unchanged, while the positive signal increased first and then entered a plateau phase. The F / F obtained at a concentration of 0.5 U / μL 0 The highest, indicating that a Nb.BbvCI concentration of 0.5U / μL is sufficient to complete the primer-template conversion, so 0.5U / μL is selected as the optimal Nb.BbvCI concentration.

[0065] In addition, the effects of dNTPs concentration, RCA reaction time, MRSDA reaction time and ThT concentration on the fluorescence signal were also investigated. Figure 3 (D) shows that as the concentration of dNTPs increases, both the negative signal and the positive signal increase first and then decrease. When the concentration of dNTPs is 0.4 mM, F / F 0 The maximum value was reached, and 0.4 mM was selected as the optimal dNTPs concentration. It should be noted that when the dNTPs concentration exceeds 1.0 mM, the continued increase in its concentration will lead to a decrease in F / F 0 This may be related to the inhibitory effect of excess dNTPs on some enzymes.

[0066] The RCA process provides a template for the subsequent MRSDA. If the RCA reaction time is too short, the template for the subsequent MRSDA will be insufficient, which will reduce the amplification effect and inhibit the detection sensitivity. Sufficient RCA reaction time is an important parameter to ensure efficient MRSDA amplification. This example investigates the effect of different RCA times on the results. Figure 3 (E) F / F 0 It gradually increased between 0.5h and 1.5h, and reached a stable state after 1.5h. 1.5h was selected as the optimal RCA reaction time.

[0067] MRSDA is a key process for generating G-quadruplex signal molecules, and the MRSDA reaction time is a key parameter to ensure the detection sensitivity. This example investigates the effect of different MRSDA reaction times on the results. Figure 3 As shown in (F), as the MRSDA reaction time increases, the negative signal hardly changes, while the positive signal increases first and then enters a plateau phase. When the MRSDA reaction time is 3.0 h, F / F 0 To reach a steady state, 3.0 h was selected as the optimal MRSDA reaction time. In addition, the extension of the MRSDA reaction time did not lead to an increase in the negative signal, indicating that the background signal of the method of this embodiment can be effectively controlled, which is due to the target dependence of the amplification template.

[0068] As a fluorescent dye, the change of ThT concentration has a direct impact on the results and is an important parameter to be optimized. In this example, five levels of ThT concentration were selected to examine their effects on the results. Figure 3 As shown in (G), with the increase of ThT concentration, the negative signal slowly increased, which was related to the accumulation of ThT autofluorescence; the positive signal first increased and then decreased significantly, which may be caused by the self-quenching effect of the dye. When the ThT concentration was 20 μM, F / F 0 The maximum value was reached, and 20 μM was selected as the optimal ThT concentration.

[0069] 3. Sensitivity test

[0070] By measuring different concentrations of Hg 2+ The fluorescence intensity of the system when Hg 2+ The detection sensitivity and linear range of Hg 2+ The concentration ranged from 0 to 7.5 × 10 -9 M range, the fluorescence intensity increases with Hg 2+ The concentration gradually increases ( Figure 4 A). At 3.0×10 -12 -1.5×10 -9 In the range of M, the fluorescence intensity is related to Hg 2+The concentration showed a good linear relationship, and the linear equation was F = 5.0 × 10 11 x+94.6, correlation coefficient (R 2 ) is 0.996( Figure 4 B) According to the 3σ rule, the detection limit is 0.8×10 -12 M (0.8 pM).

[0071] Table 2 summarizes the Hg in the embodiments of the present invention and the prior art. 2+ Compared with the methods in the prior art, the Hg 2+ The detection method showed similar or even superior sensitivity. This is due to efficient signal amplification and excellent background control: the synergy of the two amplification technologies (RCA and MRSDA) provided good detection sensitivity; the generation of templates for the cascade amplification reaction in this method was dependent on the target, which effectively suppressed the background signal.

[0072] Table 2 Correlation between Hg and the prior art 2+ Comparison of detection methods

[0073]

[0074] 4. Selective Experiment

[0075] Selectivity is an important indicator for evaluating the reliability of a detection method. The interaction between non-target ions and probe DNA may lead to false positive / false negative signals, reducing the accuracy of the detection. This example conducted a selectivity experiment to examine the signal output of the biosensor in the present invention in response to different types of metal ions. 2+ 、Ni 2+ , Pb 2+ , Mn 2+ 、Al 3 + It is widely distributed in the natural environment and is enriched to a certain extent in American ginseng. This example investigates the signal output when the above five interfering ions exist. Figure 5 As shown in the figure, the five interfering ions only output weak fluorescence signals during detection, while Hg 2+ These results show that the detection of Hg 2+ Biosensors for Hg 2+ The detection has good selectivity.

[0076] 5. Hg in American ginseng water extract 2+ Detection

[0077] Water extract is a common preparation form of American ginseng, which usually contains a variety of water-soluble substances, including metal ions, small organic molecules, polysaccharides, nucleic acids and proteins. In instrumental analysis, such as AAS, AFS and ICP-MS, these water-soluble substances will affect the atomization or ionization process, and some will seriously contaminate the injector, which will have a great influence on Hg 2+ In order to verify the Hg 2+ The feasibility of the detection method in the detection of complex matrix samples was investigated by 2+ Added to the American ginseng water extract for recovery experiments. 2+ The recovery rate was investigated, that is, 1.5×10 -11 , 1.5×10 -10 and 1.5×10 -9 The recoveries were 85.3%, 87.4% and 98.3% respectively, and the relative standard deviations of the measured values ​​at each level were 6.2%, 5.9% and 3.5% (n=3) (see Table 3). The results show that the detection method of the present invention exhibits acceptable stability and accuracy when detecting complex matrix samples.

[0078] Table 3 Different concentrations of Hg 2+ Acceptability results (n=3).

[0079]

[0080] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. For those skilled in the art, the present invention may have various modifications and variations. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. A method for detecting Hg 2+ A biosensor, characterized in that Includes the following components: A hairpin probe, wherein the hairpin probe contains a half-recognition site sequence of a nicking endonuclease Nb.BbvCI and a G-quadruplex sequence; a primer probe, wherein the primer probe is complementary to a portion of the hairpin probe; The biosensor also includes Thioflavin T, T4 ligase, Bst polymerase and nicking endonuclease Nb.BbvCI; The sequence of the hairpin probe is: P-GTTGT TAGGGATAGGGATAGGGATAGGGAT TCTTCGTCGTCTTGCTGGT GTGGTGGCTGCTGAGGAAGACGAC, the bold letters in the sequence represent the recognition site of the nicking endonuclease Nb.BbvCI, and the underlined letters represent the G-quadruplex sequence; The sequence of the primer probe is: AGCCACCACACCAGCAAGACGAC; The sensor also includes a deoxyribonucleoside 5'-triphosphate mixture.

2. The method for detecting Hg according to claim 1 2+ Biosensors for detecting Hg 2+ Application in.

3. Hg in a water extract of American ginseng 2+ The detection method is characterized in that The method comprises using the detection method of Hg according to any one of claims 1-2 2+ The biosensor detects: 1) Boil the American ginseng slices with water, take the solution to obtain the American ginseng water extract, and adjust the extract to a fixed volume to obtain the sample to be tested; 2) In T4 ligase reaction buffer, incubate the hairpin probe and the sample to be tested for 2.0 h, then add T4 ligase, react at room temperature, and then heat to inactivate T4 ligase; 3) Add primer probe, deoxyribonucleoside 5'-triphosphate mixture and Bst polymerase to the mixture obtained in step 2), and react in reaction buffer for 1.5 h; after the reaction is completed, add nicking endonuclease Nb.BbvCI and continue the reaction for 3.0 h; 4) adding Thioflavin T to the mixture obtained in step 3) and maintaining the mixture at 37°C for 40 min; 5) Perform fluorescence spectrum detection on the solution obtained in step 4).

4. The detection method according to claim 3, characterized in that The composition of the T4 ligase reaction buffer in step 2) is 50 mM Tris-HCl, pH 7.5, 10 mM MgCl2, 10 mM DTT, 1 mM ATP.

5. The detection method according to claim 3, characterized in that: The composition of the reaction buffer in step 3) is 20 mM Tris-HAc, pH 7.9, 100 μg mL -1 BSA, 50 mM KAc, 10 mM Mg(Ac)2.

6. The detection method according to claim 3, characterized in that: In step 4), KCl and H2O are added together with Thioflavin T.

7. The detection method according to claim 3, characterized in that: The specific method of step 5) is to use a fluorescence spectrophotometer at an excitation wavelength of 425 nm to record the signal in the fluorescence spectrum region of 450-550 nm.

Images