A peanut ALS mutant gene with resistance to imidazolinone herbicides and its application

Abstract

The present invention relates to the technical field of plant genetic engineering, and proposes a peanut ALS mutant gene with resistance to imidazolinone herbicides and its application. The nucleotide sequence of the peanut imidazolinone herbicide resistance gene AhALS-G1709T is a nucleotide sequence as shown in SEQ ID NO3, which consists of 2001 bases; or a nucleotide sequence with the same function obtained by replacing, deleting or inserting one or more nucleotides of the nucleotide sequence as shown in SEQ ID NO3. The peanut imidazolinone herbicide resistance gene AhALS-G1709T is obtained by in vitro site-directed mutagenesis modification of the acetolactate synthase III encoding gene AhALS, and the nucleotide sequence of the acetolactate synthase III encoding gene AhALS is shown in SEQ ID NO1. After verification and identification of transgenic Arabidopsis and peanut, the modified AhALS-G1709T gene in transgenic peanut can effectively improve the resistance of transgenic plants to imidazolinone herbicides. The modified gene can be used in the creation of peanut drug-resistant germplasm and the breeding of new varieties.

Description

Technical Field

[0001] The invention relates to the technical field of plant genetic engineering, and in particular to a peanut ALS mutant gene with resistance to imidazolinone herbicides and an application thereof. Background Art

[0002] Peanut is an important oil crop and cash crop in my country, with an average annual planting area of ​​4.5 million hm2. 2 , with an average annual output of about 16 million tons. For a long time, the contradiction between supply and demand of edible vegetable oil in my country has been prominent, the total domestic supply is seriously insufficient, and the risk of imports has increased dramatically. Compared with other major oil crops, peanuts have a large total output, high yield level, high oil yield per unit area, and high planting efficiency per unit area. They have great competitive advantages and play an irreplaceable and important role in ensuring the safe supply of edible oil in my country. However, the influence of various adverse external factors has become a serious obstacle to the development of peanut production. Peanut field weeds are of various types, huge numbers, and widespread. They compete with crops for water, fertilizer, light and other resources, change the field microclimate, and even parasitize a variety of pests and diseases, accelerating the spread of pests and diseases. In addition, most production areas have rain and heat at the same time during the growing season. High temperature and high humidity have aggravated weed damage, seriously reducing the yield and quality of peanuts. It has become a key problem that needs to be urgently solved in the mechanized production and simplified cultivation of peanuts. Chemical weeding is an economical and effective means to control weeds in farmland. However, due to the long-term application of a single herbicide or similar herbicide ingredients, a large number of resistant weeds have occurred, increasing the difficulty of weed control and aggravating the harm of weeds. On the other hand, there are not only grass weeds such as horsetail, barnyard grass, and cattle grass in peanut fields, but also broad-leaved weeds such as Amaranthus retroflexus, Purslane, and Amaranthus ferox. The simultaneous control of two weeds involves the problem of mixed use of herbicides. Since herbicides are highly selective, they can cause phytotoxicity to crops if not carefully. In addition, the accumulation of herbicide residues from previous crops in the soil can cause phytotoxicity to subsequent crops. Many studies have pointed out that planting herbicide-resistant varieties can effectively avoid these problems. At present, researchers at home and abroad have made great progress in the discovery and creation of herbicide-resistant genes and germplasm in food crops such as rice, corn, wheat, and cotton, as well as oil-producing crops including rapeseed, soybeans, and sunflowers. Some transgenic herbicide-resistant crop varieties with important value in the world have begun to be commercially planted on a large scale. However, so far, there have been no reports on peanut herbicide resistance genes at home and abroad.

[0003] Herbicides kill weeds by interfering with and inhibiting the metabolic processes of plants, which are often induced by different enzyme systems. The targets of herbicides are mostly different enzyme systems. By inhibiting the target enzymes, they ultimately interfere with the metabolism of plants, such as inhibiting plant photosynthesis, inhibiting cell division, and inhibiting fat or amino acid biosynthesis. Different types of herbicides may inhibit the same metabolic reaction, but their sites of action (target enzymes) are significantly different. Imidazolinone herbicides are herbicides developed with acetolactate synthase (ALS), also known as acetohydroxyacid synthase (AHAS), the starting enzyme for branched-chain amino acid synthesis, as the target. In addition, the herbicides currently developed with ALS as the target include sulfonylureas (SU), triazolopyrimidines (TP), pyrimidyl-benzoates (PB) and sulfonlyaminocarbonyl-triazolinones (SCT), collectively referred to as ALS inhibitor herbicides. ALS inhibitor herbicides inhibit the activity of ALS enzymes, resulting in the blockage of the synthesis of branched-chain amino acids (including valine, leucine and isoleucine), abnormal protein synthesis, and ultimately plant growth stagnation and subsequent death. ALS herbicides have the advantages of strong selectivity, broad weed control spectrum, high weed control efficiency, low dosage, and low toxicity to humans and animals. They are widely used in production and have become the second largest category of herbicides after glyphosate. Among them, imidazolinone herbicides are widely used in dryland crops such as peanuts because of their convenience in application (both soil treatment and stem and leaf treatment are possible) and their ability to kill both grass and broadleaf weeds. However, due to the large-scale and continuous use of this type of herbicide, the number of weed biotypes resistant to this type of herbicide has increased dramatically.

[0004] Studies have found that most resistant weeds are caused by mutations in target gene sites. These sites exist in multiple discontinuous conserved functional domains of the target protein. These functional domains are key sites for the binding of the ALS enzyme to different herbicides. After the mutation, the herbicide molecules cannot bind to the mutant ALS enzyme to form a complex or its binding activity decreases, but the mutant can still synthesize branched-chain amino acids and grow normally, thus showing ALS resistance based on target site changes. Because the binding sites of different herbicides and ALS enzymes may overlap, mutations in key sites may lead to resistance to two or more herbicides. Studies on the Arabidopsis ALS gene have shown that most resistance mutations occur at residue sites such as Ala122, Pro197, Ala205, Trp574, and Ser653.

[0005] ALS enzyme is a common target of many herbicides such as imidazolinones. Researchers at home and abroad have tried to use various strategies to use ALS enzyme genes to cultivate herbicide-resistant crops, mainly including traditional breeding techniques and modern biotechnology.

[0006] Traditional breeding technology mainly uses conventional hybrid breeding methods to introduce the genes of resistant parents into hybrid offspring through multiple backcrossing and recurrent selection between sensitive parents and resistant parents, so that the good genes are homozygous from generation to generation and the comprehensive traits are enhanced. However, this method can only be successful in hybrid-compatible varieties, and resistant germplasm resources have not yet been discovered in peanuts. Therefore, it is particularly difficult to cultivate new herbicide-resistant varieties using conventional hybrid breeding technology.

[0007] Modern biotechnology provides an effective way to breed herbicide-resistant crop varieties. Currently, there are two main effective methods used to improve crop resistance. One is to introduce exogenous ALS mutant genes into target crops through transgenic technology, but the resistance of ALS mutant sequences from different crop sources to the introduced transgenic plants varies; the second is to use artificial mutagenesis, which can be summarized into three approaches, namely chemical mutagenesis, genome editing, and PCR-mediated in vitro site-directed mutagenesis. The principle is to change the ALS enzyme herbicide recognition site, that is, to change the amino acid sequence of the enzyme protein through gene point mutation, so that the herbicide cannot recognize the site of the ALS enzyme, and thus cannot act on the crop. Of course, this is to ensure that the main structure and function of the enzyme do not change. Although EMS mutagenesis has been successful in creating herbicide-resistant crops in some crops, it still has certain limitations, such as too strong randomness, low efficiency of induced mutations, and few beneficial mutations, and cannot achieve true directed mutagenesis breeding. The genome editing system represented by CRISPR / Cas9 can complete the cutting reaction at specific sites on the complete genome through RNA-mediated Cas9 enzyme cleavage, and can achieve efficient and precise site-specific modification of the genome (including base mutations, insertions and deletions), which brings new hope for the breeding of herbicide-resistant crops. However, for peanuts, which are allotetraploid crops and have a large and complex genome, this method still faces challenges in genetic modification and improvement. On the other hand, in a series of studies on model plants, crops and weeds, it was found that the resistance effect of plants resistant to ALS inhibitor herbicides depends on the location of the ALS amino acid mutation (different sites), the type of mutated amino acids and the number of mutated amino acids, and the herbicide resistance effect produced by amino acid mutations at the same position under different genetic backgrounds is also very different. For peanuts, mutants with herbicide resistance have not yet been obtained, and the genes that play a decisive role in resistance have not been identified. This has become a key bottleneck problem that needs to be urgently solved in the breeding of herbicide-resistant peanuts using genetic engineering technology. Therefore, the creation of herbicide resistance genes with breeding value is of great significance for the selection and breeding of peanut herbicide-resistant varieties. However, there are no reports on peanut ALS inhibitor herbicide resistance genes and their applications. Summary of the invention

[0008] The present invention proposes a peanut ALS mutant gene with resistance to imidazolinone herbicides and its application, which solves the problem of lack of peanut herbicide resistance genes and peanut herbicide-resistant varieties in the related art, and provides a theoretical basis for breeding excellent peanut varieties with high resistance to imidazolinone herbicides.

[0009] The technical solution of the present invention is as follows:

[0010] The present invention provides a peanut imidazolinone herbicide resistance gene AhALS-G1709T, the nucleotide sequence of the peanut imidazolinone herbicide resistance gene AhALS-G1709T is as follows 1) or 2):

[0011] 1) The nucleotide sequence shown in SEQ ID NO.3, consisting of 2001 bases;

[0012] 2) A nucleotide sequence with the same function obtained by replacing, deleting or inserting one or more nucleotides of the nucleotide sequence shown in SEQ ID NO.3.

[0013] As a further technical solution, the peanut imidazolinone herbicide resistance gene AhALS-G1709T is obtained by in vitro site-directed mutagenesis of the acetolactate synthase III encoding gene AhALS, and the nucleic acid sequence of the acetolactate synthase III encoding gene AhALS is shown in SEQ ID NO.1.

[0014] As a further technical solution, the primer sequences used in the amplification of the acetolactate synthase III encoding gene AhALS are as follows:

[0015] AhALS-F: 5'—ATGGCTGCCACTGCTTCCA—3';

[0016] AhALS-R: 5'—GGATATCAATATTTTGTTCTGCCATCG—3'.

[0017] The site-directed mutagenesis was carried out by using PCR-based site-directed mutagenesis to introduce base mutations. The primer sequences used in the PCR amplification of the mutant gene AhALS-G1709T are as follows:

[0018] AhALS_G1709T-F: 5'—GATCGTTTCTATAAAATCCAATAGG—3';

[0019] AhALS_G1709T-R: 5'—CTCCaATTGAACAACCATA—3'.

[0020] As a further technical solution, it is characterized in that the acetolactate synthase III encoding gene AhALS is derived from peanut, and compared with the nucleotide sequence of peanut acetolactate synthase III from other sources, the 1709th base G of the peanut imidazolinone herbicide resistance gene AhALS-G1709T is changed to T.

[0021] As a further technical solution, the amino acid sequence encoded by the acetolactate synthase III encoding gene AhALS is shown in SEQ ID NO.2, and the codon TGG encoding the 570th amino acid is changed to TTG.

[0022] The present invention also provides a protein encoded by the peanut imidazolinone herbicide resistance gene AhALS-G1709T, the amino acid sequence of the protein AhALS-W570L is as follows 1) or 2):

[0023] 1) The amino acid sequence as shown in SEQ ID NO.4, consisting of 666 amino acid residues, and the amino acid residue at the 570th or equivalent position of the encoded protein sequence is leucine L;

[0024] 2) An amino acid sequence with the same function obtained by replacing, deleting or inserting one or more amino acids in the amino acid sequence shown in SEQ ID NO.4.

[0025] The present invention also proposes a recombinant plasmid, characterized in that it contains the peanut imidazolinone herbicide resistance gene AhALS-G1709T, and the construction method of the recombinant plasmid comprises the following steps: cloning the peanut imidazolinone herbicide resistance gene AhALS-G1709T into a plant expression vector, using the CaMV 35S promoter to drive the peanut imidazolinone herbicide resistance gene AhALS-G1709T, and constructing an expression vector of the recombinant plasmid, wherein the plant expression vector is pBarF3.

[0026] The present invention also proposes the use of the peanut imidazolinone herbicide resistance gene AhALS-G1709T in constructing plants with imidazolinone herbicide resistance.

[0027] As a further technical solution, the peanut imidazolinone herbicide resistance gene AhALS-G1709T is introduced into plant cells or tissues to obtain transgenic plants with imidazolinone herbicide resistance.

[0028] The peanut imidazolinone herbicide resistance gene AhALS-G1709T is introduced into plants that have no resistance to imidazolinone herbicides by using a transgenic method, so as to improve the tolerance of the introduced host plant to imidazolinone herbicides.

[0029] As a further technical solution, the plant is Arabidopsis thaliana or peanut.

[0030] As a further technical solution, the peanut imidazolinone herbicide resistance gene AhALS-G1709T is introduced into Arabidopsis thaliana by Agrobacterium-mediated inflorescence infection or peanut embryonic callus is transformed by gene gun using a plant expression vector, and positive transformation regeneration plants are obtained through screening, differentiation and rooting induction. The target gene is detected by PCR reaction, and transgenic positive plants and positive homozygous lines are screened. The expression level of the modified target gene AhALS-G1709T in Arabidopsis thaliana and peanut is detected by qRT-PCR method, and the effect of the modified AhALS-G1709T in peanut resistance is verified by identifying the resistance of transgenic strains to imidazolinone herbicides.

[0031] The present invention also provides a method for identifying plants resistant to imidazolinone herbicides, which comprises determining whether the plant has the peanut imidazolinone herbicide-resistant gene AhALS-G1709T or determining whether the plant contains the protein.

[0032] The working principle and beneficial effects of the present invention are:

[0033] 1. In the present invention, based on the comparative analysis of ALS enzyme mutation sites in other plant species, the AhALS-G1709T gene was obtained by using in vitro site-directed mutagenesis technology, and peanut germplasm resources with high resistance to imidazolinone herbicides were created. This method directly modified the AhALS gene, the target enzyme endogenous to imidazolinone herbicides in peanuts, thereby achieving the directed genetic improvement of peanut resistance to imidazolinone herbicides, enriching the peanut herbicide-resistant germplasm resources, and avoiding the unexpected effects brought about by non-directed genetic improvement caused by natural variation or artificial chemical mutagenesis.

[0034] 2) This invention is the first peanut imidazolinone herbicide resistance gene found in peanut, filling the gap in peanut resistance germplasm resources and key functional genes. The application of the AhALS-G1709T gene will obtain peanut materials with high resistance to imidazolinone herbicides without exogenous ALS gene sequences.

[0035] 3) The use of the nucleic acid sequence of the peanut imidazolinone herbicide-resistant gene AhALS-G1709T of the present invention can improve the tolerance of other plants that are not resistant to imidazolinone herbicides to imidazolinone herbicides.

[0036] 4) The peanut imidazolinone herbicide resistance gene AhALS-G1709T of the present invention was introduced into peanuts by a transgenic method to obtain AhALS-G1709T transgenic peanut plants. After herbicide resistance identification, AhALS-G1709T transgenic peanut plants were still able to grow and reproduce seeds normally after applying 10 times the recommended concentration for weed control at the 2-3 compound leaf stage, indicating that the site-directed mutation did not affect the normal metabolism of peanut branched-chain amino acids, thereby showing ALS resistance based on target site changes. However, after 3 weeks of applying 10 times the recommended concentration for weed control at the 2-3 compound leaf stage, the wild-type peanut showed death of the entire plant. Therefore, the transgenic peanut carrying the mutant resistance gene AhALS-G1709T has an effective concentration of resistance to imazethapyr herbicide at more than 10 times the recommended dose for weed control. The invention has potential application value in improving the tolerance of peanuts to imidazolinone herbicides, the resistance level of the resistance mutation site has breeding utilization value, and the resistance gene has practical application value in production. BRIEF DESCRIPTION OF THE DRAWINGS

[0037] The present invention will be further described in detail below in conjunction with the accompanying drawings and specific embodiments.

[0038] Figure 1 This is a schematic diagram of the peanut AhALS-G1709T gene mutation site;

[0039] Figure 2 To identify the resistance of peanut transgenic plants expressing AhALS and AhALS-G1709T to the herbicide imazethapyr;

[0040] In the figure, W is the control sprayed with clear water, 10×IMI represents the treatment of spraying 10 times the recommended field herbicide dose of imidacloprid, 35S:AhALS and 35S:AhALS-G1709T are T1 generation peanut positive lines transformed by callus-mediated transformation of AhALS and AhALS-G1709T gene plant expression vectors driven by CaMV 35S promoter through gene gun;

[0041] Figure 3 The inhibition rate of imazethapyr on plant height, aboveground fresh weight and dry weight of transgenic peanut expressing AhALS and AhALS-G1709T was compared.

[0042] In the figure, 35S:AhALS and 35S:AhALS-G1709T are T1 peanut positive lines transformed by gene gun-mediated callus tissue with AhALS and AhALS-G1709T gene plant expression vectors driven by CaMV 35S promoter, respectively. ** indicates that the difference in the inhibitory effect on growth (plant height, fresh weight and dry weight) between AhALS and AhALS-G1709T transgenic peanut lines reached an extremely significant level. DETAILED DESCRIPTION

[0043] The technical scheme in the embodiment of the present invention will be clearly and completely described below in conjunction with the embodiment of the present invention. Obviously, the described embodiment is only a part of the embodiment of the present invention, rather than all the embodiments. Based on the embodiments in the present invention, all other embodiments obtained by ordinary technicians in the field without making creative work are related to the scope of protection of the present invention. If there is no special explanation in the embodiment, the experimental methods used in the embodiment are conventional methods and techniques well known to those skilled in the art, and the reagents or materials used can be obtained through commercial channels.

[0044] Example 1: Obtaining the peanut imidazolinone herbicide resistance gene AhALS-G1709T

[0045] The peanut AhALS gene is numbered arahy.Tifrunner.gnm2.ann1.881M8L.1 in the Peanutbase (https: / / www.peanutbase.org) database. According to the comparison of its coding region nucleotide sequence and genome sequence, the gene does not contain introns. The full length of the gene is 2001bp, located at Chr10: 2637177-2639177, and encodes the cultivated peanut acetolactate synthase III (Arachis hypogaea acetolactate synthase 3, chloroplastic-like, LOC112714609).

[0046] 1. Reagents

[0047] High-fidelity PCR DNA polymerase PrimeSTAR HS DNA Polymerase was purchased from Bio-Rad Biotechnology (Beijing) Co., Ltd.

[0048] Blunt-end DNA A-addition kit was purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd.;

[0049] Agarose gel DNA recovery kit was purchased from Omega;

[0050] The cloning vector pMD19-T Simple Vector was purchased from Bio-Rad Biotechnology (Beijing) Co., Ltd.;

[0051] The site-directed mutagenesis kit MutanBEST Kit was purchased from TaKaRa;

[0052] 2. Plant materials

[0053] Peanut variety: JKD1547-001, this variety is a new high oleic acid peanut variety bred by Hebei University of Science and Technology. It has a compact plant shape, strong resistance to lodging and stress, an oleic acid content of 78%, and is not resistant to imidazolinone herbicides.

[0054] 3. Experimental methods

[0055] 3.1 DNA extraction

[0056] The genomic DNA from peanut leaves was extracted using the CTAB method.

[0057] 3.2 Primer design

[0058] The primer sequences are as follows:

[0059] AhALS-F: 5'—ATGGCTGCCACTGCTTCCA—3';

[0060] AhALS-R: 5'—GGATATCAATATTTTGTTCTGCCATCG—3'.

[0061] 3.3 PCR reaction

[0062] Prepare PCR reaction system: prepare 20 μL PCR reaction system according to the instructions of high-fidelity PCR DNA polymerase PrimeSTAR HS DNA Polymerase Kit: 10 μL Polymerase, 1 μL each of AhALS-F and AhALS-R, 2 μL DNA solution (20 ng / μL), and 6 μL ddH2O.

[0063] PCR reaction: amplification was performed on an A300 Fast Thermal Cycler PCR instrument with the following procedure: pre-denaturation at 94°C for 2 min; denaturation at 94°C for 30 s, annealing at 59°C for 30 s, extension at 72°C for 2 min, for a total of 30 cycles, and post-extension at 72°C for 2 min.

[0064] The product was A-added using a blunt-end DNA A-adding kit, separated by 1.2% (w / v) agarose gel electrophoresis, purified and recovered using an agarose gel DNA recovery kit, ligated to the cloning vector pMD19-T Simple Vector, and heat-shock transformed into competent DH5α.

[0065] Through blue-white screening and colony PCR identification, a positive monoclonal product was obtained, which was the acetolactate synthase III encoding gene AhALS. After sequencing by Beijing Liuhe BGI Genomics Co., Ltd., the gene sequence is shown in SEQ ID NO.1.

[0066] 3.4 Site-directed mutagenesis

[0067] The site-directed mutagenesis kit MutanBEST Kit was used to introduce specific primers for PCR reaction, and the PCR product was subjected to end smoothing and 5′-phosphorylation (P) treatment. Then, the highly efficient ligation reagent Ligation Solution I was used for self-ligation (circularization reaction), and then the mutant DNA was transformed and extracted. The schematic diagram of site-directed mutagenesis is shown in Figure 1 As shown, the peanut acetolactate synthase (AhALS) coding gene is 2001 bases in length, and the 1709th base of the AhALS reading frame after the start codon is changed from G to T, resulting in the codon TGG encoding the 570th amino acid being changed to TTG, and the protein sequence being changed from W (Trp) to L (Leu). The preparation of the mutant gene was carried out according to the method provided by the MutanBEST Kit, and the specific steps are as follows:

[0068] (1) Specific primer design

[0069] The specific primer sequences are as follows:

[0070] AhALS_G1709T-F: 5'—GATCGTTTCTATAAAATCCAATAGG—3';

[0071] AhALS_G1709T-R: 5'—CTCCaATTGAACAACCATA—3'.

[0072] The primer set AhALS_G1709T-F and AhALS_G1709T-R are a pair of primers with adjacent 5′-ends and opposite 3′-ends. The mutation site (indicated by lowercase letter a) is introduced into AhALS_G1709T-R. This pair of primers introduces a mutation site at position 1709 of the AhALS gene, causing G to mutate to T, achieving the purpose of amino acid Trp570Leu mutation.

[0073] (2) PCR reaction

[0074] Prepare PCR reaction system: prepare 50 μL PCR reaction system according to the instructions of high-fidelity PCR DNA polymerase PrimeSTAR HS DNA Polymerase kit: Pyrobest DNA Polymerase 0.25 μL, 10×PyrobestBuffer II (5U / μL) 5 μL, dNTP Mixture (2.5 mM) 4 μL, AhALS_G1709T-F and AhALS_G1709T-R 1 μL each, genomic DNA 1 ng, and ddH2O to make up to 50 μL.

[0075] PCR reaction: Amplification was performed on an A300 Fast Thermal Cycler PCR instrument with a reaction program of 95°C for 30 s, 55°C for 30 s, and 72°C for 5 min for 30 cycles.

[0076] The PCR reaction solution was subjected to 1% agarose gel electrophoresis, and then the gel was cut to recover the target DNA fragment.

[0077] (3) End smoothing and 5′-end phosphorylation reaction

[0078] Blunting Kination reaction was performed to blunt the ends of the PCR fragments and perform 5′-end phosphorylation reaction.

[0079] Prepare the reaction solution in a microcentrifuge tube: about 1 pmol of DNA fragment, 2 μL of 10×Blunting Kination Buffer, 1 μL of Blunting Kination Enzyme Mix, and add ddH2O to 20 μL.

[0080] The reaction was carried out at 37°C for 10 min, and then at 70°C for 10 min.

[0081] (4) Self-ligation reaction

[0082] Self-ligation reaction: Take about 0.25 pmol (5 μL) of Blunting Kination reaction solution into a new microcentrifuge tube, add 5 μL of Ligation Solution I, mix well, and react at 16°C for 1 hour.

[0083] (5) Transformation and extraction of mutant DNA

[0084] The entire amount of the reaction solution was transformed into 100 μL competent cells TOP10, mutants were selected, and the target gene AhALS-G1709T was obtained.

[0085] Sequencing verified that the target fragment had undergone a site-directed mutation at the corresponding site: G1709T, and the mutant gene was named AhALS-G1709T. Its sequence was shown in SEQ ID NO.3. The mutation caused the Trp at position 570 of the protein sequence to change to Leu, and the sequence of the mutant protein encoded by it was shown in SEQ ID NO.4. Except for the site-directed mutation G1709T, the remaining nucleotide sequence of sequence SEQ ID NO.3 had no difference with the nucleotide sequence of the endogenous AhALS gene of peanut (shown in sequence SEQ ID NO.1). Except for the Trp570Leu site, sequence SEQ ID NO.4 had no difference with sequence SEQ ID NO.2, and no mutation occurred at other sites.

[0086] Example 2 Functional verification of the peanut imidazolinone herbicide resistance gene AhALS-G1709T

[0087] 1. Construction of a recombinant plasmid expression vector containing the peanut imidazolinone herbicide resistance gene AhALS-G1709T

[0088] The AhALS-G1709T gene obtained in Example 1 was cloned into the pBarF3 plant expression vector, and the AhALS-G1709T gene was driven by the constitutively expressed CaMV 35S promoter to construct a recombinant plasmid expression vector containing the AhALS-G1709T gene; the specific steps are as follows:

[0089] The following gene-specific primers (with restriction sites and protective bases) were designed according to the restriction sites of the multiple cloning site on the pBarF3 vector:

[0090] AhALS-G1709TsacF: 5'—GGCGAGCTCATGGCTGCCACTGCTTCAAAC—3';

[0091] AhALS-G1709TsmaR: 5'—TCCCCCGGGTCAATATTTTGTTCTGCCATCGCC—3'.

[0092] The CDS sequences of the endogenous gene AhALS and the mutant gene AhALS-G1709T (from the start codon to the stop codon) were amplified by PCR from the template, and then ligated to the prokaryotic expression vector pMD19-T SimpleVector, and transformed into the competent cell Trans5α. The recombinant T vectors with correct sequences verified by sequencing were named pMD19-AhALS and pMD19-AhALS_G1709T.

[0093] The plasmids were extracted separately, and the target fragments were double-digested (SacI and SmaI). At the same time, pBarF3 was digested with the same endonuclease, the exogenous fragments and vectors were recovered, and the two fragments were connected. The constructed recombinant vector with the target gene was transformed into E. coli, and the resistance positive clones were picked to extract the plasmids, double-digested and verified, and sequencing confirmed that the constructed overexpression recombinant vector was completely correct. The verified recombinant vectors containing AhALS and AhALS-G1709T genes were named pBF-AhALS and pBF-AhALS_G1709T.

[0094] pBF-AhALS and pBF-AhALS_G1709T were transformed into Agrobacterium GV1301 strain by electric shock to obtain recombinant strains. The plasmids were extracted for PCR and enzyme digestion identification. The recombinant strains containing the endogenous gene AhALS and the plant expression vector with the resistance gene AhALS-G1709T were named GV-pBF-AhALS and GV-pBF-AhALS_G1709T, respectively.

[0095] 2. Genetic transformation of Arabidopsis thaliana containing the peanut imidazolinone herbicide resistance gene AhALS-G1709T expression vector and identification of herbicide resistance

[0096] The recombinant Agrobacterium strains GV-pBF-AhALS and GV-pBF-AhALS_G1709T were introduced into Arabidopsis thaliana by floral dipping (Clough SJ, Bent A F. Plant J, 1998, 16: 735–743). After antibiotic selection on the culture medium, T0 generation plants were obtained, transplanted into culture pots, and grown in an artificial climate chamber.

[0097] DNA from young leaves of Arabidopsis thaliana was extracted by CTAB method. The target gene of transgenic plants was identified by PCR. Transgenic positive plants with the target gene were screened and propagated to obtain genetically stable T3 generation homozygous transgenic lines of each gene.

[0098] Real-time fluorescence quantitative PCR analysis determined that the expression of AhALS and AhALS-G1709T genes in Arabidopsis plants was significantly higher than that in the untransformed wild parent control.

[0099] The primers used for PCR detection of positive transgenic Arabidopsis plants are as follows:

[0100] 35S_S2-F:5'—GGTAATATCCGGAAACCTCC—3'

[0101] 35S_S2-R:5'—TAAGCTCAACAAACCTCCTC—3'

[0102] The length of the amplified product was 1299 bp.

[0103] The PCR reaction system was as follows: 2 μl of DNA template (20 ng / μL), 10 μL of Premix Ex Taq endonuclease, 0.6 μL each of 35S_S2-F and 35S_S2-R primers, and ddH2O supplemented to 20 μL.

[0104] The PCR reaction program was as follows: pre-denaturation at 94°C for 5 min; 40 cycles (denaturation at 94°C for 30 s; annealing at 55°C for 1 min, and extension at 72°C for 2 min); post-extension at 72°C for 10 min.

[0105] The amplified products were electrophoresed on 1.2% agarose gel and the band sizes were observed using a gel imaging system after staining with nucleic acid stain.

[0106] When the positive transgenic Arabidopsis grows to 6-8 true leaves, select plants with strong growth and good consistency for herbicide resistance identification and evaluation. The identification method is as follows:

[0107] Set up the following groups:

[0108] Control group 1 (CK1): non-transgenic Colombia type Arabidopsis, i.e. wild-type Arabidopsis;

[0109] Control group 2 (CK2): AhALS transgenic Arabidopsis;

[0110] Experimental group: AhALS-G1709T transgenic Arabidopsis;

[0111] Experimental reagents and instruments:

[0112] Herbicide: imazethapyr (2-[4,5-dihydro-4-methyl-4-(1-methylethyl)-5-oxo-1H-imidazol-2-yl]-5-ethyl-3-pyridinecarboxylic acid), purchased from Hengshui Jingmei Chemical Industry Co., Ltd.;

[0113] Spraying equipment: ASS-1 pesticide spraying system (XR8003 nozzle, spray pressure 0.275MPa, spray volume 400kg / hm 2 ).

[0114] In the experiment, the control group 1, 2 and the experimental group of Arabidopsis plants with normal growth and sprayed with water were used as the control (CK), and the recommended concentration of imazethapyr for weed control was 75g ai / hm 2As a benchmark, 5 concentration gradients of imidacloprid were set to spray the Arabidopsis plants in the control group 1, 2 and the experimental group. Three weeks after spraying, the resistance effects of the plants under different drug concentrations were determined based on their growth performance.

[0115] When Arabidopsis plants were sprayed with imidazolin at a concentration of 0.1×, the growth of wild-type Arabidopsis and transgenic Arabidopsis with endogenous AhALS in peanut was significantly inhibited. When the plants were sprayed with imidazolin at a concentration of ≥1×, both wild-type and AhALS transgenic Arabidopsis stopped growing and tended to die, indicating that 1× imidazolin is the lethal concentration for wild-type and AhALS transgenic Arabidopsis. On the contrary, when the plants were sprayed with 5 concentrations of imidazolin at 0.1×~15×, AhALS-G1709T transgenic Arabidopsis could grow normally. The above results indicate that after the peanut imidazolinone herbicide resistance gene AhALS-G1709T was transferred into Arabidopsis, the AhALS-G1709T transgenic Arabidopsis obtained had imidazolin herbicide resistance.

[0116] In addition, the fresh weight response of Arabidopsis plants to imazethapyr herbicide was analyzed using the Log-Logistic nonlinear regression model with EC 50 As a quantitative indicator for evaluation, the regression model formula used is as follows:

[0117] ;

[0118] Where: y is the plant's response to the herbicide at dose x (percentage relative to the control);

[0119] C represents the degree of plant growth response when the herbicide dose is the highest;

[0120] D represents the degree of plant response when the herbicide dose is 0;

[0121] b shows the dose-response curve at EC 50 The slope value at ;

[0122] x represents the herbicide dosage;

[0123] EC 50 It is the effective dose of herbicide that inhibits plant growth by 50%.

[0124] The survey data fitting results are shown in Table 1:

[0125] Table 1 Fresh weight response of transgenic Arabidopsis thaliana to imazethapyr

[0126]

[0127] From the data in Table 1, it can be seen that AhALS-G1709T transgenic Arabidopsis thaliana has the strongest resistance to imazethapyr. 50 447.25 g ai / hm 2 The resistance multiple was 274 times, indicating that AhALS-G1709T transgenic Arabidopsis plants acquired high drug resistance.

[0128] 3. Genetic transformation of peanut containing the AhALS-G1709T expression vector for peanut resistance to imidazolinone herbicides and identification of herbicide resistance

[0129] After the obtained recombinant Agrobacterium strains GV-pBF-AhALS and GV-pBF-AhALS_G1709T were propagated, GV1301-mediated peanut genetic transformation was performed. The expression vector of the peanut imidazolinone herbicide resistance gene AhALS-G1709T was transferred into the callus tissue of the wild-type peanut germplasm JK8543 (wherein, the wild-type peanut germplasm JK8543 comes from the germplasm preserved by the peanut molecular breeding team of Hebei University of Science and Technology, which is not resistant to imidazolinone herbicides). The specific steps are as follows:

[0130] Take JK8543 plump peanut seeds with good maturity and strong consistency, disinfect them in 75% alcohol for 1 minute, pour off the alcohol and add 1‰ HgCl solution, soak for 10 minutes, pour off HgCl and rinse with sterile water 5 times, and then soak in sterile water for 4 hours. Peel off the seed coat in a clean bench, cut off the plumule, radicle and cotyledon. Place the prepared embryo on MP5 (containing MS medium 0.44% (w / v), sucrose 3% (w / v), glutamine 1mg / mL, agar powder 0.8% (w / v)) callus induction medium containing 5μg / mL Picloram, and culture in the dark at 28℃. Then, the embryonic callus was transferred to MP3 (MS medium 0.44% (w / v), sucrose 3% (w / v), glutamine 1 mg / mL, agar powder 0.8% (w / v)) callus subculture medium containing 3 μg / mL Picloram and subcultured at 28°C in the dark for 3-4 weeks.

[0131] Peanut embryonic callus was first placed on an infiltration medium (MP3 medium supplemented with 0.2 M sorbitol and 0.2 M mannitol) for 3 h. After transformation of the callus using a gene gun, it was transferred to an infiltration medium again for 3 h, and then transferred back to MP3 medium and cultured in the dark at 28°C.

[0132] Transgenic calli were screened for resistance on MP3 medium supplemented with 50 μg / mL kanamycin. Resistant calli were cultured on differentiation medium MC (containing MS medium 0.44% (w / v), sucrose 2% (w / v), activated carbon 1 mg / mL and 50 μg / mL kanamycin) at 28°C, light intensity 80 μmol / (m2·s), and photoperiod 16h / 8h (D / N) for 4 weeks, and then embryoids were transferred to M10 medium (containing MS medium 0.44% (w / v), sucrose 2% (w / v) and BAP 10 μg / mL) at 28°C, photoperiod 16h / 8h (D / N), subcultured every 4 weeks, and seedlings formed in about 3 months.

[0133] When the shoots were 1-3 cm long, they were transferred to MSR rooting medium (containing 0.44% (w / v) MS medium, 2% (w / v) sucrose, 1 μg / mL NAA naphthaleneacetic acid and 50 μg / mL kanamycin) to induce rooting and cultured for 2 weeks under the same conditions of 28°C, 80 μmol / (m2·s) light intensity and 16h / 8h (D / N) photoperiod.

[0134] When the roots grow to about 3 cm, the rooted seedlings are transferred to the nutrient soil of the flowerpot and hardened in the greenhouse. After 2 weeks, the surviving seedlings are transplanted manually and grown under the natural light cycle until they bloom and bear fruit, thus obtaining transgenic seeds.

[0135] Leaves were taken from the T1 generation plants at the seedling stage, and leaf DNA was extracted using the CTAB method. The primer pairs 35S_S2-F and 35S_S2-R were used for PCR molecular detection of transgenic positive plants. The PCR reaction system and reaction procedure were as described above.

[0136] The PCR amplification products were separated by electrophoresis on 1.2% agarose gel, and the fragment size of the amplification products was observed by gel imaging system after nucleic acid staining. The results showed that 6 PCR-positive transgenic peanuts were obtained.

[0137] When the positive transgenic flowers grew to the 2-3 compound leaf stage, the ASS-1 pesticide spraying system was used to spray 5% imidacloprid aqueous solution at 750 g ai / hm 2 The leaves were sprayed with a spray dose of (10 times the recommended dose of imidacloprid for weed control) (10×IMI), and a water blank control (W) was set up. Each treatment was repeated 3 times.

[0138] The results are as follows Figure 2 As shown, AhALS-G1709T transgenic peanut plants were able to grow normally after spraying, while the growth of AhALS transgenic peanut plants was severely inhibited and eventually died.

[0139] The plant height and fresh weight of the aboveground part were measured 3 weeks after spraying, and the aboveground dry weight was weighed after drying. The inhibition rate of herbicides on the plant height, fresh weight, and dry weight of AhALS-G1709T and Ah-ALS transgenic peanut plants was calculated according to the formula: Growth inhibition rate (%) = (control index value - treatment index value) / control index value × 100%.

[0140] The calculation results are as follows Figure 3 As shown, the plant height, fresh weight and dry weight inhibition rates of AhALS-G1709T transgenic peanut plants after spraying with 10× imidacloprid were 13.29%, 27.28% and 12.03%, respectively, while those of AhALS transgenic peanut plants were 52.31%, 73.12% and 65.38%, respectively. The former were 74.59%, 62.69% and 81.61% lower than the latter, respectively, and the difference was extremely significant, indicating that the resistance effect concentration of transgenic peanut carrying the mutant resistance gene AhALS-G1709T to imidacloprid herbicide is more than 10 times the recommended dosage of herbicide for weed control.

[0141] In summary, the present invention obtains transgenic Arabidopsis and transgenic peanut materials with resistance to imazethapyr herbicide, and verifies that the peanut mutant gene AhALS-G1709T has the function of resisting imidazolinone herbicides.

[0142] The above are only preferred embodiments of the present invention and are not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of the present invention should be included in the protection scope of the present invention.

Claims

1. A peanut imidazolinone herbicide resistance gene AhALS-G1709T, characterized in that: The nucleotide sequence of the peanut imidazolinone herbicide resistance gene AhALS-G1709T is the nucleotide sequence shown in SEQ ID NO.3, which consists of 2001 bases.

2. The peanut imidazolinone herbicide resistance gene AhALS-G1709T according to claim 1, characterized in that: The peanut imidazolinone herbicide resistance gene AhALS-G1709T is obtained by in vitro site-directed mutagenesis of the acetolactate synthase III encoding gene AhALS, and the nucleotide sequence of the acetolactate synthase III encoding gene AhALS is shown in SEQ ID NO.

1.

3. The peanut imidazolinone herbicide resistance gene AhALS-G1709T according to claim 2, characterized in that: The acetolactate synthase III encoding gene AhALS is derived from peanut. Compared with the nucleotide sequence of peanut acetolactate synthase III from other sources, the 1709th base G of the peanut imidazolinone herbicide resistance gene AhALS-G1709T is changed to T.

4. The peanut imidazolinone herbicide resistance gene AhALS-G1709T according to claim 3, characterized in that: The amino acid sequence encoded by the acetolactate synthase III encoding gene AhALS is shown in SEQ ID NO.

2.

5. The protein encoded by the peanut imidazolinone herbicide resistance gene AhALS-G1709T according to any one of claims 1 to 4, characterized in that: The amino acid sequence of the protein is the amino acid sequence shown in SEQ ID NO.4, which consists of 666 amino acid residues, and the amino acid residue at the 570th position of the encoded protein sequence is leucine L.

6. A recombinant plasmid, characterized in that: The method for constructing the recombinant plasmid comprising the peanut imidazolinone herbicide resistance gene AhALS-G1709T according to any one of claims 1 to 4 comprises the following steps: The peanut imidazolinone herbicide resistance gene AhALS-G1709T according to any one of claims 1 to 4 is cloned into a plant expression vector, and the peanut imidazolinone herbicide resistance gene AhALS-G1709T is driven by the CaMV 35S promoter to construct a recombinant plasmid.

7. Use of the peanut imidazolinone herbicide resistance gene AhALS-G1709T according to any one of claims 1 to 4 in constructing plants with imidazolinone herbicide resistance, characterized in that: The plant is Arabidopsis thaliana or peanut.

8. The use according to claim 7, characterized in that The peanut imidazolinone herbicide resistance gene AhALS-G1709T is introduced into plant cells or tissues to obtain transgenic plants with imidazolinone herbicide resistance.

9. A method for identifying plants resistant to imidazolinone herbicides, characterized in that: The identification method comprises determining whether the plant contains the peanut imidazolinone herbicide resistance gene AhALS-G1709T as described in any one of claims 1 to 4 or determining whether the plant contains the protein as described in claim 5.

Images