Biosensing platform based on multi-legged DNA walker and DNA nanowire track and its preparation method

Abstract

The present invention relates to a biosensor platform based on a multi-legged DNA walker and a DNA nanowire track and a preparation method thereof. The biosensor platform comprises a multi-legged DNA walker, a DNA nanowire track, a Mg 2+ The multi-legged DNA walker is constructed of gold nanoparticles, DNAzyme walking chains, and locking chains, and the DNA nanowire track is constructed by self-assembly of track chain SUB1 and track chain SUB2. The multi-legged DNA walker can change from a "locked" state to an "unlocked" state when a specific target exists. The walker in the "unlocked" state is in the presence of Mg 2+ With the assistance of DNA nanowires, the sensor can continuously walk along the DNA nanowire track and cut the track chain to achieve sensitive detection of the target. Due to the designability of DNA, the sensor can detect other targets by changing the corresponding DNA sequence, which is a promising sensing tool.

Description

Technical Field

[0001] The present invention belongs to the field of biosensor technology, and in particular relates to a biosensor platform based on a multi-legged DNA walker and a DNA nanowire track and a preparation method thereof. Background Art

[0002] MicroRNA (miRNA) is a type of short endogenous non-coding RNA that is widely present in most eukaryotic organisms and is usually 18 to 25 nucleotides. More and more studies have shown that abnormal expression of miRNA is closely related to human diseases. It has become a new group of biomarkers for disease treatment and can be used to provide important pathological status information.

[0003] Based on the importance of miRNA in disease diagnosis and treatment, various miRNA analysis technologies have been developed, including quantitative real-time polymerase chain reaction (qRT-PCR), Northern blotting, microarray analysis, and electrochemical detection. In recent years, exploring efficient biosensing strategies is an urgent need to pursue a highly sensitive miRNA biosensing platform. DNA nanotechnology shows great promise in constructing a highly sensitive and highly selective miRNA biosensing platform.

[0004] DNA nanotechnology has a history of more than 40 years. Today, researchers have used DNA to build a series of sophisticated, programmable and addressable DNA nanostructures. These DNA nanostructures range from simple to complex, from one-dimensional to three-dimensional, and from static to dynamic. In addition, different DNA nanostructures can be combined through reasonable design to create a variety of new DNA nanostructures, which greatly enriches the number and types of DNA nanostructures and provides a biosensor platform for detecting various targets. Summary of the invention

[0005] The object of the present invention is to provide a biosensing platform based on a multi-legged DNA walker and a DNA nanowire track and a preparation method thereof for sensitive detection of miRNA-21 in vitro and in cells.

[0006] To achieve the above object, the present invention adopts the following technical solution:

[0007] A biosensing platform based on a multi-legged DNA walker and a DNA nanowire track, the biosensing platform comprising a multi-legged DNA walker, a DNA nanowire track, a Mg 2+ solution and target miRNA solution;

[0008] The multi-legged DNA walker comprises gold nanoparticles AuNPs, DNAzyme walking chains and locking chains;

[0009] The DNA nanowire track includes a track chain SUB1 and a track chain SUB2;

[0010] The Mg 2+ The solution is a magnesium chloride solution;

[0011] The target miRNA is miRNA-21;

[0012] The particle size of the gold nanoparticles AuNPs is 10-15 nm;

[0013] The DNAzyme walking strand sequence is:

[0014] 5'-HS-TTTTTTTTTTTTTTTTTTTTTTTTTTACAGACTGATGTTGATCTCTTCTCCGAGCCGGTCGAAATAGTGAGT-3';

[0015] The locked strand sequence is: 5'-AAGAGATCAACATCAGTCTGATAAGCTA -3';

[0016] The track chain SUB1 sequence is:

[0017] 5'-TACTCCCCCAGGTGCCCCTCAGACCCTTTTAGTAGTCTAGGATTCGGCGTGGGT / i6FAMdT / AATGACTCACTAT / rA / GGAAGAGATTTT / iBHQ1dT / AACCCAC-3';

[0018] The track chain SUB2 sequence is:

[0019] 5'-GCACCTGGGGGAGTAACTAAAAGGGTCTGAGGGAGTCTAGGATTCGGCGTGGGT / i6FAMdT / AATGACTCACTAT / rA / GGAAGAGATTTT / iBHQ1dT / AACCCAC-3';

[0020] The miRNA-21 sequence is: 5'-UAGCUUAUCAGACUGAUGUUGA-3.

[0021] The method for preparing the above-mentioned biosensing platform based on a multi-legged DNA walker and a DNA nanowire track comprises the following steps:

[0022] 1) Synthesis of gold nanoparticles AuNPs: Gold nanoparticles AuNPs with a particle size of 10-15 nm were synthesized by sodium citrate reduction method;

[0023] 2) Preparation of multi-legged DNA walker: 2 μL of 100 μM DNAzyme walking chain and 1 μL of 20 mM TCEP were mixed evenly and activated at room temperature for 2 hours to obtain solution A; 4 μL of 100 μM locking chain was added to solution A, and then 63 μL of 200 mM pH 7.3 HEPES buffer was mixed evenly, denatured in a 95°C metal bath for 5 minutes, and then cooled to room temperature to obtain solution B; 100 μL gold nanoparticles AuNPs and 90 μL ultrapure water were added to solution B and mixed evenly to obtain solution C; solution C was subjected to freeze-thaw cycle treatment, the freezing temperature of the freeze-thaw cycle treatment was -20°C, the number of times was 3, and the single freezing time was 2 hours; solution C after freeze-thaw cycle treatment was centrifuged at 14500rpm for 15 minutes, the supernatant was discarded, the precipitate was re-dissolved with ultrapure water, and the centrifugation was repeated 3 times. The precipitate obtained by the last centrifugation was re-dissolved with 200-400 μL 20mM Tris-HCl buffer with pH 7.4 to obtain solution D, which is the multi-legged DNA walker solution;

[0024] 3) Preparation of DNA nanowire track: 1 μL 100 μM track chain SUB1 was added to 9 μL 20 mM Tris-HCl buffer at pH 7.4, annealed at 95°C for 5 minutes, and then gradually cooled to room temperature; 1 μL 100 μM track chain SUB2 was added to 9 μL 20 mM Tris-HCl buffer at pH 7.4, annealed at 95°C for 5 minutes, and then gradually cooled to room temperature; the annealed track chains SUB1 and SUB2 were mixed evenly, reacted at room temperature for 2 hours, and solution E was obtained, which was the DNA nanowire track solution;

[0025] 4) Reaction of the target with the multi-legged DNA walker and DNA nanowire track: 5 μL of the multi-legged DNA walker solution was mixed with 87 μL of 20 mM Tris-HCl buffer at pH 7.4, and 1 μL of the target miRNA solution was added thereto. The mixture was reacted at 37°C for 1 hour, and then 5 μL of 200 mM Mg was added. 2+ The solution and 2 μL DNA nanowire track solution were reacted at 37° C. for 3 hours to obtain a test solution with a total volume of 100 μL; the fluorescence intensity of the test solution in the range of 500-650 nm was measured and recorded at an excitation light wavelength of 488 nm.

[0026] Furthermore, the synthesis method of the above-mentioned gold nanoparticles AuNPs is specifically as follows: 1.03mL of 20mg / mL chloroauric acid solution is added to 49μL of ultrapure water, refluxed and heated at 120°C until boiling, 5mL of 38.8mM sodium citrate solution is quickly added, and refluxed and heated continuously. After the solution turns deep red, refluxed and heated continuously for 15 to 20 minutes, and then cooled to room temperature to obtain a gold nanoparticle AuNPs solution.

[0027] The above-mentioned biosensing platform based on multi-legged DNA walker and DNA nanowire track is used in detecting miRNA-21 for non-disease diagnosis and treatment purposes.

[0028] In summary, the present invention designs a novel biosensing platform based on a multi-legged DNA walker and a DNA nanowire track. The target activates the multi-legged DNA walker, so that the DNAzyme walking chain in the multi-legged DNA walker is in an "unlocked" state. The unlocked DNAzyme walking chain can recognize the hairpin substrate part in the DNA nanowire track and 2+ When present, the rA site of the hairpin substrate part in the track chain is specifically cut, so that the fluorescence signal of the system is restored. The DNAzyme walking chain that completes one cutting becomes free again, and hybridizes with the next hairpin substrate, and performs the next cutting process to achieve cyclic amplification of the fluorescence signal. The multiple "feet" on the multi-legged DNA walker can simultaneously connect to multiple hairpin substrates on a DNA nanowire track, and the multiple "feet" of the multi-legged DNA walker can be connected to multiple DNA nanowire tracks at the same time. Therefore, every time the multi-legged DNA walker moves forward, multiple fluorescent group signals are restored in each DNA nanowire track.

[0029] The advantages of the present invention are:

[0030] (1) In the present invention, multiple "feet" on the multi-legged DNA walker can simultaneously connect to multiple hairpin substrates on a DNA nanowire track. At the same time, each multi-legged DNA walker can connect to multiple DNA nanowire tracks and continuously run along the self-assembled long DNA nanowire track to achieve cyclic amplification of the fluorescence signal;

[0031] (2) The presence of AuNPs and DNA nanowire tracks in the present invention enriches oligonucleotides, the reaction can be initiated by a trace amount of the target, and the reaction rate is increased;

[0032] (3) The present invention proposes a general strategy to construct a biosensor platform that can be used for specific detection of other targets by changing the sequences of the DNAzyme walking chain and the locking chain loaded on the multi-legged DNA walker;

[0033] (4) Compared with traditional detection methods, the present invention does not require expensive instruments and equipment, complex and time-consuming sample pretreatment, and skilled operators, and is more convenient and economical. BRIEF DESCRIPTION OF THE DRAWINGS

[0034] Figure 1 The figure is a schematic diagram of the construction process of the biosensing platform based on the multi-legged DNA walker and the DNA nanowire track of the present invention.

[0035] Figure 2 This is the fluorescence response diagram for feasibility analysis of the target object in Example 1. a: Target object and Mg 2+ Both exist; b: only the target exists; c: only Mg exists 2+ ; d: target and Mg 2+ None exist.

[0036] Figure 3 This is a sensitivity fluorescence response diagram after adding different concentrations of the target in Example 2.

[0037] Figure 4 This is a specific fluorescence response diagram of adding different interferents and targets in Example 3. DETAILED DESCRIPTION

[0038] In order to make the contents of the present invention easier to understand, the technical solution of the present invention is further explained below in combination with specific implementation methods. However, the following examples do not represent the scope of protection of the rights limited by the present invention. The scope of protection of the rights of the present invention shall be subject to the claims.

[0039] The biosensor platform based on a multi-legged DNA walker and a DNA nanowire track in the following embodiments of the present invention comprises a multi-legged DNA walker, a DNA nanowire track, a Mg 2+ solution and target miRNA solution;

[0040] The multi-legged DNA walker comprises gold nanoparticles AuNPs, DNAzyme walking chains and locking chains;

[0041] The DNA nanowire track includes a track chain SUB1 and a track chain SUB2;

[0042] The Mg 2+ The solution is a magnesium chloride solution;

[0043] The target miRNA is miRNA-21;

[0044] The sequences of the DNAzyme walking strand, locking strand, track strand SUB1, track strand SUB2 and target miRNA-21 are as follows:

[0045] DNAzyme walking chain: 5'-HS-TTTTTTTTTTTTTTTTTTTTTTTTCAGACTGATGTTGATCTCTTCTCCGAGCCGGTCGAAATAGTGAGT-3';

[0046] Locking strand: 5′-AAGAGATCAACATCAGTCTGATAAGCTA -3′;

[0047] Orbital chain SUB1: 5'-TACTCCCCCAGGTGCCCCTCAGACCCTTTTAGTAGTCTAGGATTCGGCGTGGGT / i6FAMdT / AATGACTCACTAT / rA / GGAAGAGATTTT / iBHQ1dT / AACCCAC-3';

[0048] Orbital chain SUB2: 5'-GCACCTGGGGGAGTAACTAAAAGGGTCTGAGGGAGTCTAGGATTCGGCGTGGGT / i6FAMdT / AATGACTCACTAT / rA / GGAAGAGATTTT / iBHQ1dT / AACCCAC-3';

[0049] miRNA-21: 5′-UAGCUUAUCAGACUGAUGUUGA-3′ (U represents uracil).

[0050] Example 1: Feasibility analysis of the biosensor platform based on multi-legged DNA walker and DNA nanowire track for in vitro detection of miRNA, with miRNA-21 as the target for feasibility analysis. The construction process is as follows: Figure 1 As shown, the specific steps are as follows:

[0051] 1. Synthesis of gold nanoparticles AuNPs with a particle size of 10~15nm;

[0052] 2. Preparation of multi-legged DNA walker;

[0053] 3. Preparation of DNA nanowire tracks;

[0054] 4. Target miRNA-21 and Mg 2+ Simultaneous presence, presence of target miRNA-21 only, presence of Mg only 2+ , target miRNA-21 and Mg 2+ When both are absent, they react with the multi-legged DNA walker and the DNA nanowire track;

[0055] 5. Fluorescence detection.

[0056] The specific method of step 1 is as follows: before the synthesis, the required glassware needs to be fully soaked in freshly prepared aqua regia (concentrated HNO3 / concentrated HCl=1:3, V / V), then washed with a large amount of ultrapure water, and placed in a drying oven for drying; chloroauric acid powder is dissolved in ultrapure water to prepare a chloroauric acid solution with a concentration of 20 mg / mL for use; sodium citrate powder is dissolved in ultrapure water to prepare a sodium citrate solution with a concentration of 38.8 mM for use; during the synthesis, 1.03 mL of chlorine is added to a three-necked flask (with a capacity of 100 mL) containing 49 μL of ultrapure water. 20 mg / mL pre-prepared chloroauric acid solution was refluxed and heated at 120°C until boiling, and then 5 mL of 38.8 mM sodium citrate solution was quickly added and refluxed and heated continuously. After the color of the solution in the flask turned dark red, refluxed and heated for 15-20 minutes, and then the heating was stopped. Stirring was continued for 2-4 hours until it cooled to room temperature to obtain a gold nanoparticle AuNPs solution with a concentration of 10 nM, which was stored at 4°C in the dark for later use.

[0057] The specific method of step 2 is:

[0058] (1) Mix 2 μL of 100 uM DNAzyme walking chain and 1 μL of 20 mM TCEP and activate at room temperature for 2 hours to obtain solution A;

[0059] (2) Add 4 μL of 100 uM lock chain to solution A, and add 63 μL of 200 mM pH 7.3 HEPES buffer as the reaction buffer. After fully mixing, denature in a 95°C metal bath for 5 minutes, and slowly cool to room temperature to obtain solution B.

[0060] (3) Add 100 μL of 10 nM gold nanoparticle AuNPs solution and 90 μL of ultrapure water to solution B and mix thoroughly to obtain solution C;

[0061] (4) Freeze solution C at -20°C for 2 h, then thaw at room temperature, and repeat the freeze-thaw cycle three times.

[0062] (5) After freeze-thaw cycle treatment, centrifuge solution C at 14500 rpm for 15 min, discard the supernatant, reconstitute the precipitate with ultrapure water, repeat the centrifugation three times, and reconstitute the precipitate obtained by the last centrifugation with 200-400 μL of 20 mM Tris-HCl buffer, pH 7.4, to obtain solution D, which is the multi-legged DNA walker solution. Store at 4°C in the dark.

[0063] The specific method of step 3 is as follows: add 1 μL of 100 μM track chain SUB1 to 9 μL of 20 mM Tris-HCl buffer at pH 7.4, anneal at 95°C for 5 minutes, and then gradually cool to room temperature; add 1 μL of 100 μM track chain SUB2 to 9 μL of 20 mM Tris-HCl buffer at pH 7.4, anneal at 95°C for 5 minutes, and then gradually cool to room temperature; mix the annealed track chain SUB1 and track chain SUB2 evenly, react at room temperature for 2 hours to allow SUB1 and SUB2 to fully hybridize, and obtain solution E, which is the DNA nanowire track solution.

[0064] The specific method of step 4 is:

[0065] Target miRNA-21 and Mg 2+ When they are present at the same time, react with the multi-legged DNA walker and the DNA nanowire track: 5 μL of the multi-legged DNA walker solution was mixed with 87 μL of 20 mM Tris-HCl buffer at pH 7.4, 1 μL of 100 nM miRNA-21 solution was added thereto, and the mixture was reacted at 37°C for 1 hour, followed by the addition of 5 μL of 200 mM magnesium chloride solution and 2 μL of DNA nanowire track solution, and the mixture was incubated at 37°C for 3 hours to obtain a total volume of 100 μL of the test solution;

[0066] When only the target miRNA-21 is present, it reacts with the multi-legged DNA walker and the DNA nanowire track: 5 μL of the multi-legged DNA walker solution is mixed with 87 μL of 20 mM Tris-HCl buffer at pH 7.4, and 1 μL of 100 nM miRNA-21 solution is added thereto, and the mixture is reacted at 37°C for 1 hour, followed by the addition of 5 μL of ultrapure water and 2 μL of the DNA nanowire track solution, and the mixture is incubated at 37°C for 3 hours to obtain a total volume of 100 μL of the test solution;

[0067] Only Mg exists 2+ Reaction with the multi-legged DNA walker and the DNA nanowire track: 5 μL of the multi-legged DNA walker solution was mixed with 87 μL of 20 mM Tris-HCl buffer at pH 7.4, 1 μL of ultrapure water was added thereto, and the mixture was reacted at 37°C for 1 hour, followed by addition of 5 μL of 200 mM magnesium chloride solution and 2 μL of the DNA nanowire track solution, and the mixture was incubated at 37°C for 3 hours to obtain a total volume of 100 μL of the test solution;

[0068] Target miRNA-21 and Mg 2+In the absence of both, react with the multi-legged DNA walker and DNA nanowire track: mix 5 μL of multi-legged DNA walker solution with 87 μL of 20 mM Tris-HCl buffer at pH 7.4, add 1 μL of ultrapure water, react at 37°C for 1 hour, then add 5 μL of ultrapure water and 2 μL of DNA nanowire track solution, incubate at 37°C for 3 hours to obtain a total volume of 100 μL of the test solution.

[0069] The specific method of step 5 is: using a Cary Eclipse fluorescence spectrophotometer to record the fluorescence intensity of the solution to be tested within the range of 500-650nm after being excited at an excitation wavelength of 488nm.

[0070] The results are as follows Figure 2 As shown, when the target miRNA or Mg is absent 2+ When any component was added, no obvious enhanced fluorescence signal could be detected ( Figure 2 , curves b, c, d), only when the target miRNA and Mg 2+ When they are present at the same time, the fluorescence signal will be significantly enhanced ( Figure 2 , curve a), this is because the DNAzyme walking chain on the multi-legged DNA walker is "unlocked" in the presence of the target. The unlocked DNAzyme walking chain can recognize the hairpin substrate part in the DNA nanowire track and 2+ The hairpin substrate in the DNA nanowire track was cut with the assistance of , and the recovery of the fluorescence signal proved that the multilegged DNA walker can run on the DNA nanowire track.

[0071] Example 2 A biosensor platform based on a multi-legged DNA walker and a DNA nanowire track is used for sensitivity analysis of in vitro detection of miRNAs at different concentrations. Sensitivity analysis is performed using miRNA-21 as the target. The construction steps are as follows:

[0072] 1. Synthesis of gold nanoparticles AuNPs with a particle size of 10~15nm;

[0073] 2. Preparation of multi-legged DNA walker;

[0074] 3. Preparation of DNA nanowire tracks;

[0075] 4. Different concentrations of target miRNA-21 react with multi-legged DNA walkers and DNA nanowire tracks;

[0076] 5. Fluorescence detection.

[0077] Steps 1, 2, 3 and 5 are the same as those in Example 1.

[0078] The specific method of step 4 is as follows: 5 μL of the multi-legged DNA walker solution is mixed with 87 μL of 20 mM Tris-HCl buffer at pH 7.4, 1 μL of target miRNA-21 solution of different concentrations is added thereto, and the mixture is reacted at 37° C. for 1 hour, followed by addition of 5 μL of 200 mM magnesium chloride solution and 2 μL of DNA nanowire track solution, and incubated at 37° C. for 3 hours to obtain a test solution with a total volume of 100 μL.

[0079] Figure 3 The relationship between the target concentration in the system and the change in fluorescence intensity is shown. Figure 3 It shows that the fluorescence intensity increases with the increase of target concentration.

[0080] Example 3 A biosensor platform based on a multi-legged DNA walker and a DNA nanowire track is used for in vitro detection of specific capabilities of different miRNAs. The specific capabilities of miRNA-21 are analyzed as a target. The construction steps are as follows:

[0081] 1. Synthesis of gold nanoparticles AuNPs with a particle size of 10~15nm;

[0082] 2. Preparation of multi-legged DNA walker;

[0083] 3. Preparation of DNA nanowire tracks;

[0084] 4. Different miRNA targets react with multi-legged DNA walkers and DNA nanowire tracks;

[0085] 5. Fluorescence detection;

[0086] Steps 1, 2, 3 and 5 are the same as those in Example 1.

[0087] The specific method of step 4 is: select the target miRNA-21 and four interference targets, let-7d, miRNA-200b, miRNA-429, and miRNA-141, a total of five miRNAs for specificity experiments. Mixed target mixture 1 contains the target miRNA-21 and four interference targets at the same concentration (100nM), that is, a mixed solution of five miRNAs; mixed target mixture 2 contains the four interference targets at the same concentration (100nM), that is, a mixed solution of the remaining four miRNAs except the target miRNA-21. Five groups of single targets (1 μL each, 100 nM) of miRNA-21, let-7d, miRNA-200b, miRNA-429, and miRNA-141 and two groups of mixed target solutions (1 μL each) of mixture 1 and mixture 2 were added to a mixed solution of 5 μL of multi-legged DNA walker solution and 87 μL of 20 mM Tris-HCl buffer at pH 7.4, and reacted at 37°C for 1 hour. Subsequently, 5 μL of 200 mM magnesium chloride solution and 2 μL of DNA nanowire track solution were added, and then incubated at 37°C for 3 hours to obtain a test solution with a total volume of 100 μL.

[0088] The results are as follows Figure 4 As shown, when each interfering target exists alone or simultaneously, the significantly enhanced fluorescence signal cannot be detected. When the target miRNA-21 exists alone or simultaneously with other interfering target miRNAs, a significantly increased fluorescence signal can be detected. The above results indicate that the developed sensing platform can specifically identify the target and demonstrates its good selectivity.

[0089] The above description is only a preferred embodiment of the present invention. All equivalent changes and modifications made according to the scope of the patent application of the present invention should fall within the scope of the present invention.

Claims

1. A biosensing platform based on a multi-legged DNA walker and a DNA nanowire track, characterized in that: The biosensor platform includes a multi-legged DNA walker, a DNA nanowire track, a Mg 2+ solution and target miRNA solution; The multi-legged DNA walker comprises gold nanoparticles AuNPs, DNAzyme walking chains and locking chains; The DNA nanowire track includes a track chain SUB1 and a track chain SUB2; The Mg 2+ The solution is a magnesium chloride solution; The target miRNA is miRNA-21; The particle size of the gold nanoparticles AuNPs is 10-15 nm; The DNAzyme walking strand sequence is: 5'-HS-TTTTTTTTTTTTTTTTTTTTTTTTTTACAGACTGATGTTGATCTCTTCTCCGAGCCGGTCGAAATAGTGAGT-3'; The locked strand sequence is: 5'-AAGAGATCAACATCAGTCTGATAAGCTA-3'; The track chain SUB1 sequence is: 5'-TACTCCCCCAGGTGCCCCTCAGACCCTTTTAGTAGTCTAGGATTCGGCGTGGGT / i6FAMdT / AATGACTCACTAT / rA / GGAAGAGATTTT / iBHQ1dT / AACCCAC-3'; The track chain SUB2 sequence is: 5'-GCACCTGGGGGAGTAACTAAAAGGGTCTGAGGGAGTCTAGGATTCGGCGTGGGT / i6FAMdT / AATGACTCACTAT / rA / GGAAGAGATTTT / iBHQ1dT / AACCCAC-3'; The miRNA-21 sequence is: 5'-UAGCUUAUCAGACUGAUGUUGA-3; The method for preparing a biosensing platform based on a multi-legged DNA walker and a DNA nanowire track comprises the following steps: 1) Synthesis of gold nanoparticles AuNPs: Gold nanoparticles AuNPs with a particle size of 10-15 nm were synthesized by sodium citrate reduction method; 2) Preparation of multi-legged DNA walker: 2 μL of DNAzyme walking chain was mixed with 1 μL of 20 mM TCEP, and activated at room temperature for 2 hours to obtain solution A; 4 μL of locking chain was added to solution A, and then 63 μL of 200 mM pH 7.3 HEPES buffer was added, mixed evenly, denatured in a 95°C metal bath for 5 minutes, and then cooled to room temperature to obtain solution B; 100 μL of gold nanoparticles AuNPs and 90 μL of ultrapure water were added to solution B, mixed evenly to obtain solution C; solution C was subjected to freeze-thaw cycle treatment, the freezing temperature of the freeze-thaw cycle treatment was -20°C, the number of times was 3, and the single freezing time was 2 h; solution C after freeze-thaw cycle treatment was centrifuged at 14500 rpm for 15 minutes, the supernatant was discarded, the precipitate was re-dissolved with ultrapure water, and the centrifugation was repeated 3 times. The precipitate obtained from the last centrifugation was re-dissolved with 200~400 μL of 20 mM The solution was then re-dissolved in Tris-HCl buffer at pH 7.4 to obtain solution D, which is the multi-legged DNA walker solution; 3) Preparation of DNA nanowire track: 1 μL of track chain SUB1 was added to 9 μL of 20 mM Tris-HCl buffer at pH 7.4, annealed at 95°C for 5 minutes, and then gradually cooled to room temperature; 1 μL of track chain SUB2 was added to 9 μL of 20 mM Tris-HCl buffer at pH 7.4, annealed at 95°C for 5 minutes, and then gradually cooled to room temperature; the annealed track chains SUB1 and SUB2 were mixed evenly, reacted at room temperature for 2 hours, and solution E was obtained, which was the DNA nanowire track solution; 4) Reaction of the target with the multi-legged DNA walker and DNA nanowire track: 5 μL of the multi-legged DNA walker solution was mixed with 87 μL of 20 mM Tris-HCl buffer at pH 7.4, and 1 μL of the target miRNA solution was added thereto. The mixture was reacted at 37°C for 1 hour, and then 5 μL of 200 mM Mg was added. 2+ The solution and 2 μL DNA nanowire track solution were reacted at 37° C. for 3 hours to obtain a test solution with a total volume of 100 μL; the fluorescence intensity of the test solution in the range of 500-650 nm was measured and recorded at an excitation light wavelength of 488 nm.

2. A biosensing platform based on a multi-legged DNA walker and a DNA nanowire track according to claim 1, characterized in that: The synthesis method of the gold nanoparticles AuNPs is specifically as follows: 1.03 mL of 20 mg / mL chloroauric acid solution is added to 49 μL of ultrapure water, refluxed and heated at 120°C until boiling, 5 mL of 38.8 mM sodium citrate solution is quickly added, and refluxed and heated continuously. After the solution turns deep red, refluxed and heated continuously for 15 to 20 minutes, and then cooled to room temperature to obtain a gold nanoparticle AuNPs solution.

3. A biosensing platform based on a multi-legged DNA walker and a DNA nanowire track according to claim 1, characterized in that: The molar ratio of the DNAzyme walking chain to the locking chain in the multi-legged DNA walker solution is 1:

2.

4. The biosensing platform based on multi-legged DNA walker and DNA nanowire track according to claim 1, characterized in that: The molar ratio of the track chain SUB1 to the track chain SUB2 in the DNA nanowire track solution is 1:

1.

5. Use of the biosensor platform based on a multi-legged DNA walker and a DNA nanowire track as described in claim 1 in detecting miRNA-21 for non-disease diagnosis and treatment purposes.

Images