Primer combination, kit and application for detecting Verticillium dahliae

Abstract

The present invention relates to a primer combination, a kit and an application for detecting Verticillium dahliae. The primer combination comprises an RPA primer pair and crRNA; the target gene of the RPA primer pair comprises the ITS gene of Verticillium dahliae; the target gene of the crRNA comprises the ITS gene of Verticillium dahliae. The primer combination and the kit provided by the present invention combine the RPA amplification technology and the CRISPR detection technology to achieve rapid detection of Verticillium dahliae, and have the advantages of high sensitivity, strong specificity and high detection efficiency. The application of the primer combination and the kit of the present invention to the detection of Verticillium dahliae is of great significance for the prevention and treatment of Cotinus coggygria wilt caused by infection with Verticillium dahliae.

Description

Technical Field

[0001] The present invention relates to the field of biological detection technology, and in particular to a primer combination, a kit and an application thereof for detecting Verticillium dahliae. Background Art

[0002] Cotinus coggygria is a deciduous shrub or small tree in the Anacardiaceae family. Its leaves turn red in autumn, which is of great ornamental and economic value. It is the main tree species for the autumn red leaf landscape in Beijing's Xiangshan Park. Since the discovery of Cotinus coggygria wilt in Xiangshan in the 1980s, its occurrence has been getting worse year by year. The disease causes the leaves of Cotinus coggygria to wilt and turn yellow from the edge to the inside, or curl due to water loss, but usually do not fall off; the vascular bundles of the roots and stems become necrotic, brown stripes appear at the junction of the xylem and the cortex, and some branches die quickly. In severe cases, the entire plant may become weak or die.

[0003] The pathogen of Cotinus coggygria wilt is Verticillium dahliae, whose asexual generation belongs to the genus Verticillium of the class Hyphomycetes of the subphylum Deuteromycotina. Black microsclerotia are often formed on the surface of the colony. It has a wide temperature adaptation range and is resistant to high temperatures. Verticillium dahliae is a typical soil-dwelling fungus. The hyphae produced by the germination of microsclerotia in the soil invade the vascular bundle through the wounds on the surface of the Cotinus coggygria root system, and then produce conidia that expand upward along the vascular bundle with the transpiration flow. Verticillium dahliae expands slowly in the host and has a long incubation period. When the leaves show obvious wilting symptoms, a large number of pathogens are already present in the roots and stems, making it easy to miss the best prevention and control period, resulting in a large-scale outbreak of the disease.

[0004] The detection methods for Fusarium wilt disease of Cotinus coggygria mainly include pathogen isolation and identification. However, the traditional pathogen isolation and identification methods are time-consuming and labor-intensive, and have great deficiencies in detection time and operation level, making it difficult to quickly detect a large number of seedlings. Therefore, the establishment of a rapid and highly sensitive detection technology for Fusarium wilt pathogen of Cotinus coggygria is of great significance for the prevention and control of Fusarium wilt disease of Cotinus coggygria. Summary of the invention

[0005] In view of the problems existing in the prior art, the present invention provides a primer combination, a kit and an application for detecting Verticillium dahliae. The primer combination provided by the present invention can quickly detect the target gene with high sensitivity and strong specificity, and is of great significance for the prevention and treatment of Cotinus coggygria wilt caused by Verticillium dahliae infection.

[0006] The present invention provides a primer combination for detecting Verticillium dahliae. The primer combination comprises an RPA primer pair and crRNA; the target gene of the RPA primer pair comprises the Verticillium dahliae ITS gene; and the target gene of the crRNA comprises the Verticillium dahliae ITS gene.

[0007] Preferably, the RPA primer pair includes an upstream primer and a downstream primer; the sequence of the upstream primer includes one of Seq_1, Seq_2, Seq_3 and Seq_4; the sequence of the downstream primer includes one of Seq_5, Seq_6, Seq_7 and Seq_8.

[0008] Preferably, the sequence of the upstream primer includes Seq_1; the sequence of the downstream primer includes Seq_6.

[0009] Preferably, the crRNA includes a framework nucleic acid fragment sequence and a guide sequence; the guide sequence includes one of Seq_14, Seq_15 and Seq_16.

[0010] Preferably, the framework nucleic acid fragment sequence includes Seq_13; and the guide sequence includes Seq_15.

[0011] Preferably, the RPA primer pair includes Seq_1 and Seq_6; the crRNA includes a framework nucleic acid fragment sequence Seq_13 and a guide sequence Seq_15.

[0012] The present invention provides a kit for detecting Verticillium dahliae, comprising the primer combination, DEPC water, LwaCas13a buffer, LwaCas13a protein, NTP buffer mix, T7 RNA polymerase mix, RNase inhibitor, RNA Reporter and Verticillium dahliae plasmid standard.

[0013] The present invention also provides application of the primer combination or the kit in detecting Verticillium dahliae.

[0014] Preferably, the application comprises the following steps:

[0015] S1, extracting genomic DNA of the sample to be tested, and using the genomic DNA of the sample to be tested as a template, performing RPA amplification to obtain an RPA product;

[0016] S2. Using the RPA product as a template, a CRISPR / Cas13 detection system for Verticillium dahliae was constructed.

[0017] Preferably, the CRISPR / Cas13 detection system in step S2 is: 8.4 μl of DEPC water, 2 μl of LwaCas13a buffer, 1 μl of LwaCas13a protein, 2 μl of crRNA, 1 μl of NTP buffer mix, 0.6 μl of T7 RNA polymerase mix, 0.5 μl of RNase inhibitor, 2.5 μl of RNA Reporter and 2 μl of Verticillium dahliae RPA product.

[0018] Beneficial effects:

[0019] The present invention provides a primer combination, a kit and an application for detecting Verticillium dahliae. The primer combination and the kit include an RPA primer pair and crRNA; wherein both the RPA primer pair and the crRNA can specifically detect the TIS gene in Verticillium dahliae. The primer combination and the kit provided by the present invention combine the RPA amplification technology and the CRISPR detection technology to achieve rapid detection of Verticillium dahliae, and have the advantages of high sensitivity, strong specificity and high detection efficiency. The application of the primer combination and the kit of the present invention to the detection of Verticillium dahliae is of great significance for the prevention and treatment of Cotinus coggygria wilt caused by Verticillium dahliae infection. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] In order to more clearly illustrate the technical solutions in the present invention or the prior art, the drawings required for use in the embodiments or the description of the prior art will be described below.

[0021] Figure 1 1 represents the crRNA 1 experimental group, 2 represents the crRNA 2 experimental group, 3 represents the crRNA 3 experimental group, and N represents the negative control; A represents the crRNA cleavage result under a high concentration (1 ng / μL) substrate, and B represents the crRNA cleavage result under a low concentration (1 pg / μL) substrate. crRNA-N represents the negative of crRNA, i.e., no RPA reaction product is added, and DEPC water is used instead; RPA-N represents the negative of RPA reaction, i.e., the negative product of RPA is added;

[0022] Figure 2 1 is a specific detection result diagram of Example 2 of the present invention; wherein 1 represents Verticillium dahliae, 2 represents Verticillium alfalfa No. 1, 3 represents Verticillium alfalfa No. 2, 4 represents Verticillium nigromaculata, and N represents negative control;

[0023] Figure 3 The sensitivity test result diagram of Example 2 of the present invention is shown in FIG. 1 , wherein the concentrations of electrophoresis bands 1 to 6 are 2.33×105 copies / μL, 2.33×10 4 copies / μL, 2.33×10 3 copies / μL, 2.33×10 2 copies / μL, 2.33×10 1 copies / μL, 2.33×100copies / μL; NC is the negative control group of crRNA, that is, no RPA reaction product is added and DEPC water is used instead; NR is RPA negative, that is, the negative product of RPA reaction is added. DETAILED DESCRIPTION

[0024] The invention provides a primer combination for detecting Verticillium dahliae.

[0025] In the present invention, the primer combination includes an RPA primer pair and crRNA; the target gene of the RPA primer pair includes the ITS gene of Verticillium dahliae; the target gene of the crRNA includes the ITS gene of Verticillium dahliae. The primer combination provided by the present invention utilizes RPA amplification technology and CRISPR detection technology together to achieve rapid detection of Verticillium dahliae, and has the advantages of high sensitivity, strong specificity, and high detection efficiency.

[0026] In the present invention, the RPA primer pair includes an upstream primer and a downstream primer; the present invention designs an upstream primer and a downstream primer for specific detection of Verticillium dahliae based on the conservative ITS gene sequence of Verticillium dahliae, blasts the designed upstream primer and downstream primer in NCBI, and shows that it is a specific Verticillium dahliae sequence, and screens out the optimal primer set. In the present invention, the sequence of the upstream primer preferably includes one of Seq_1, Seq_2, Seq_3 and Seq_4, and more preferably includes Seq_1; the sequence of the downstream primer preferably includes one of Seq_5, Seq_6, Seq_7 and Seq_8, and more preferably includes Seq_6. When the upstream primer of the RPA primer pair is Seq_1 and the downstream primer is Seq_6, the RPA amplification effect is best.

[0027] According to the characteristics of Cas13a protein, the present invention directly designs crRNA that specifically identifies Verticillium dahliae in the amplified gene fragment sequence, and blasts it in NCBI, showing that it is a specific Verticillium dahliae sequence. In the present invention, the crRNA includes a framework nucleic acid fragment sequence and a guide sequence; the framework nucleic acid fragment sequence preferably includes Seq_13; the guide sequence preferably includes one of Seq_14, Seq_15 and Seq_16, and more preferably includes Seq_15. When the framework nucleic acid fragment sequence of the crRNA is Seq_13 and the guide sequence is Seq_15, the sequence of the crRNA is Seq_10; Seq_10 is used for the CRISPR-Cas13a rapid detection system of Verticillium dahliae, and the detection effect is the best.

[0028] The primer combination provided by the present invention uses the ITS gene of Verticillium dahliae as the target gene, combines the RPA amplification technology with the CRISPR detection technology, realizes the rapid detection of Verticillium dahliae, and has the advantages of high sensitivity, strong specificity and high detection efficiency.

[0029] The present invention provides a kit for detecting Verticillium dahliae. The kit comprises the primer combination, DEPC water, LwaCas13a buffer, LwaCas13a protein, NTP buffer mix, T7 RNA polymerase mix, RNase inhibitor, RNA Reporter and Verticillium dahliae plasmid standard.

[0030] In the present invention, the Cas13a protein is preferably LwCas13a; the RNA Reporter is preferably designed according to the characteristics of the Cas13a protein, and its molecular structure is preferably FAM-RNA-biotin.

[0031] The present invention designs and constructs a positive plasmid of Verticillium dahliae. The specific method includes: connecting the nucleic acid target fragment of the ITS gene of Verticillium dahliae to the pMD-19T cloning vector and transforming it into Escherichia coli DH5α competent cells, screening positive clone strains and shaking the bacteria overnight, extracting plasmids and sending them for sequencing. The present invention names the positive plasmid with correct sequence identification as pMD-19TVd-ITS and stores it at -20°C for future use.

[0032] The present invention inoculates the above-obtained DH5α bacterial solution containing the recombinant plasmid into an LB medium containing 100 μg / m ampicillin, and cultures it in a shaker at 37°C and 120 rpm overnight; aspirates the bacterial solution, and uses a Tiangen plasmid extraction kit to extract the plasmid according to the operating steps in the instruction manual; uses Nanodrop 2000 to measure the concentration, calculates the copy number, and performs a series of gradient dilutions to obtain the Verticillium dahliae plasmid standard for subsequent use; and a corresponding reaction system can be prepared according to the required detection quantity, and each component is added in sequence to react.

[0033] The present invention also provides the application of the primer combination and the kit in detecting Verticillium dahliae.

[0034] In the present invention, the application preferably comprises the following steps:

[0035] S1, extracting genomic DNA of the sample to be tested, and using the genomic DNA of the sample to be tested as a template, performing RPA amplification to obtain an RPA product;

[0036] S2. Using the RPA product as a template, a CRISPR / Cas13 detection system for Verticillium dahliae was constructed.

[0037] In the present invention, the reaction system of RPA amplification in step S1 is preferably: Buffer V25.0μL, purified water 16.5μL, upstream primer (10μM) 2.0μL, downstream primer (10μM) 2.0μL, DNA template 2μL and MgAc 2.5μL. The present invention preferably places the above reaction system in a reaction tube containing freeze-dried enzyme powder, vortexes to mix, and places in an incubator at 37°C for 15min.

[0038] The RPA amplification described in the present invention preferably has a negative control: 2.0 μL of DNA template is replaced with 2.0 μL of purified water.

[0039] The RPA amplification described in the present invention preferably sets a positive reaction control: 2.0 μL of DNA template is replaced with a positive control template (the positive control provided in the RPA reaction kit is used to confirm whether the RPA reaction process is normal. The positive reaction control system is mainly used to evaluate whether the reagents in the kit are effective).

[0040] In the present invention, the CRISPR / Cas13 detection system described in step S2 is preferably: DEPC water 8.4 μl, LwaCas13a buffer 2 μl, LwaCas13a protein 1 μl, crRNA 2 μl, NTP buffer mix 1 μl, T7 RNA polymerase mix 0.6 μl, RNase inhibitor 0.5 μl, RNA Reporter 2.5 μl and Verticillium dahliae RPA product 2 μl, totaling 20 μl.

[0041] The application method provided by the present invention is based on the CRISPR-Cas13a nucleic acid detection platform SHERLOCK, which utilizes the non-specific shearing activity of LwaCas13a and combines RPA (recombinant polymerase amplification technology) that can efficiently amplify the target fragment to achieve rapid detection of trace nucleic acids of Verticillium dahliae with high sensitivity and strong specificity, and is of great significance for the prevention and control of Cotinus coggygria wilt caused by Verticillium dahliae infection.

[0042] The primer combination, kit and application for detecting Verticillium dahliae provided by the present invention are described in detail below in conjunction with the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0043] Unless otherwise specified, the experimental methods used in the examples are conventional methods; the materials and reagents used are all available from commercial sources.

[0044] Materials involved in the present invention: Verticillium dahliae samples were provided by the Forest Pathology Laboratory of Beijing Forestry University; Verticillium nigromaculata samples and Verticillium lucerne samples were provided by the Chinese Microbial Strain Library; RPA primers, crRNA and ssDNA signal reporter probes were synthesized by Shanghai Sangon Biotechnology Co., Ltd., and other biochemical reagents were imported or domestically produced for analytical grade.

[0045] Example 1 Establishment of CRISPR-Cas13a combined with RPA visual detection reaction system

[0046] 1. Experimental methods

[0047] 1.1. Design RPA primers that specifically target the ITS gene of Verticillium dahliae.

[0048] Principles for designing RPA primers: The RPA primers are 30-35 bases in length, with a GC content between 30% and 70%; the 3-5 nucleotides at the 5' end should avoid polyguanine (cytosine is beneficial here and can promote the recombination of fragments; at the 3' end, guanine and cytosine contribute to the stable binding of the polymerase and can improve the amplification performance of the primers).

[0049] Design four upstream primers and four downstream primers as follows:

[0050] The nucleotide sequence of the upstream primer is:

[0051] RPA-F1:5'-CCATATTGTTGCTTCGGCGGCTCGTTCTGC-3'(Seq_1);

[0052] RPA-F2:5'-CCCGCCGGTCCATCAGTCTCTCTGTTTATACC-3'(Seq_2);

[0053] RPA-F3:5'-CCATCAGTCTCTCTGTTTATACCAACGATAC-3'(Seq_3);

[0054] RPA-F4:5'-GTTCTGCGAGCCCGCCGGTCCATCAGTCTCTCTG-3'(Seq_4);

[0055] The nucleotide sequence of the downstream primer is:

[0056] RPA-R1:5'-CCACTGCTTTTAAGGGCCTACAGACGTAGA-3'(Seq_5);

[0057] RPA-R2:5'-CGCAAGGAAGGGCCACGCGGGTCCGCCAC-3'(Seq_6);

[0058] RPA-R3:5'-CCACGCGGGTCCGCCACTGCTTTTTAAGGGCC-3'(Seq_7);

[0059] RPA-R4: 5'-AAGCGCCTGCGGGACTCCGATGCGAGCTGTAAC-3' (Seq_8).

[0060] There are 16 pairs in total.

[0061] When performing the RPA reaction, a T7 promoter needs to be added to the 5' end of the upstream primer of the RPA primer set, and its sequence is: GAAATTAATACGACTCACTATAGGG (Seq_12).

[0062] The best primer pair screened out was the combination of RPA-F1 and RPA-R2.

[0063] The combination of RPA-F1 and RPA-R2 was used as the primer pair of the RPA reaction system for subsequent experimental operations.

[0064] 1.2. Design of crRNA specifically targeting the ITS gene of Verticillium dahliae

[0065] The design of LwaCas13a crRNA targeting ITS gene follows the following five principles:

[0066] (1) The format of the crRNA sequence is: 5'-framework nucleic acid fragment interacting with LwaCas13a nuclease-guide sequence-3'. The sequence of the framework nucleic acid fragment interacting with LwaCas13a nuclease is GAUUUAGACUACCCCAAAAACGAAGGGGACUAAAAC (Seq_13);

[0067] (2) connecting the framework nucleic acid fragment that interacts with the LwaCas13a nuclease to the guide sequence to produce a complete crRNA;

[0068] (3) The guide sequence of crRNA should be reverse complementary to the target site in the target RNA;

[0069] (4) The crRNA guide sequence is 28 bases long and can be set at any position in the RPA amplification product, but cannot overlap with the RPA primer;

[0070] (5) When there is only a single base difference in the guide sequence of crRNA, there is and is only allowed to be a single base mismatch.

[0071] Based on the fragments amplified by the RPA primers of the ITS gene that have been screened, three guide sequences and crRNAs that are reverse complementary to the target RNA sequence were designed according to the design principles, as follows:

[0072] The wizard sequence is:

[0073] UCGUUGGUAUAAACAGAGAGACUGAUGG(Seq_14);

[0074] GUAUCGUUGGUAUAAACAGAGAGACUGA(Seq_15);

[0075] CAGAAGUAUCGUUGGUAUAAACAGAGAG(Seq_16).

[0076] The corresponding crRNA sequence is:

[0077] crRNA1:GAUUUAGACUACCCCAAAAACGAAGGGGACUAAAACUCGUUGGUAUAAACAGAGAGACUGAUGG(Seq_9);

[0078] crRNA2:GAUUUAGACUACCCCAAAAACGAAGGGGACUAAAACGUAUCGUUGGUAUAAACAGAGAGACUGA(Seq_10);

[0079] crRNA3:GAUUUAGACUACCCCAAAAACGAAGGGGACUAAAACCAGAAGUAUCGUUGGUAUAAACAGAGAG(Seq_11).

[0080] Through subsequent optimization of experimental conditions and visual effect judgment, the best crRNA was screened out as crRNA2.

[0081] 1.3. Preparation of crRNA

[0082] For the convenience of storage and amplification in subsequent experiments, the present invention synthesizes crRNA into DNA, which is transcribed into crRNA in vitro when used, and the T7 promoter sequence GAAATTAATACGACTCACTATAGGG (Seq_12) needs to be added to the 5' end. The DNA sequence was synthesized by Shanghai Shenggong Biotechnology Co., Ltd. The DNA sequence used for transcription into crRNA is as follows:

[0083] DNA sequence for transcription into crRNA:

[0084] CCATCAGTCTCTCTGTTTATACCAACGAGTTTTAGTCCCTCTCGTTTTTGGGGTAGTCTAAATCcccTATAGTGAGTCGTATTAatttc(Seq_17);

[0085] TCAGTCCTCTGTTTATACCAACGATACGTTTTAGTCCCTCGTTTTTGGGGTAGTCTAAATCcccTATAGTGAGTCGTATTAatttc(Seq_18);

[0086] CTCTCTGTTTATACCAACGATACTTCTGGTTTTAGTCCCCTTCGTTTTTGGGGTAGTCTAAATCcccTATAGTGAGTCGTATTAatttc(Seq_19).

[0087] The crRNA DNA template was annealed into double-stranded DNA using rTaq10×PCR buffer (TaKaRa). The annealing system was: crRNAs IVT tempaltes (10μM) 1μL, T7-3GIVT (10μM) 1ul, 10×PCR buffer 1μL, and DEPCH2O was added to the total system to 10ul.

[0088] Annealing reaction was performed, and the annealing program was: 95°C for 5 min; 94°C to 25°C (0.1°C / s).

[0089] According to the instructions of Hi Scribe T7 Quick High Yield RNA Synthesis Kit (New England Biolabs), 10ul rNTP buffer mix, 2ul T7 RNA polymerase mix and 8μl DEPC H2O were added to the annealed product obtained in the previous step. Double-stranded DNA was transcribed into crRNA by incubation at 37°C overnight; then 20μl DEPC H2O, 2μl DNase I were added, 37°C, 15min. Then, according to the manufacturer's instructions, crRNA was purified using RNA Clean&Concentrator Kit (APEx BIO), and the concentration was adjusted to 10ng / ul using DEPC H2O (divided into 50ul per tube and stored at -80°C).

[0090] 1.4. Construction of standard (positive control)

[0091] The genomic DNA of Verticillium dahliae was extracted by CTAB method and stored at -20℃ for later use. The obtained genomic DNA was used as template to perform conventional PCR reaction on the ITS gene fragment.

[0092] Reaction system: 2×San Taq PCR Mix 25 μL, upstream primer (10 μM) 2 μL, downstream primer (10 μM) 2 μL, DNA template 1 μL, ddH2O supplemented to 50 μL;

[0093] Reaction conditions: 94℃5min; 94℃30s, 55℃30s, 72℃20s, 30cycles; 72℃10min; 4℃∞.

[0094] The obtained product was subjected to gel electrophoresis, and the gel was cut to recover and purify the target fragment.

[0095] The target fragment was connected to the pMD-19T cloning vector and transformed into E. coli DH5α competent cells. The positive clone strain was screened and shaken overnight. The plasmid was extracted and sent for sequencing. The positive plasmid with correct sequence identification was named pMD-19T Vd-ITS and stored at -20℃ for future use. The concentration of the plasmid was determined and a 10-fold gradient dilution was performed to use it as a standard for the CRISPR-Cas13a visualization detection method.

[0096] 1.5. Recombinant polymerase amplification (RPA)

[0097] According to the instructions of the (RPA) kit, add 47.5 μL of the system shown in Table 1 to each tube of reaction dry powder water to fully and evenly dissolve the lyophilized powder. Add 2.5 μL of 280 mM magnesium acetate solution to the cap of each reaction tube, cover the tube after adding, flick the tube with your finger to fully mix the reagents in the tube, centrifuge at low speed for 3-5 seconds, and react at 37°C for 15 minutes.

[0098] Table 1 RPA reaction system

[0099] Reagent name volume Buffer V 25.0μL Purified water 16.5μL Upstream primer RPA-F1 (10 μM) 2.0μL Downstream primer RPA-R2 (10 μM) 2.0μL Template DNA 2.0μL MgAc 2.5μL total 50μL

[0100] 1.7. CRISPR-Cas13a detection

[0101] The CRISPR-Cas13a system was used to detect the DNA reaction of Verticillium dahliae. The CRISPR-Cas13a detection system is shown in Table 2.

[0102] Table 2 CRISPR-Cas13a detection system

[0103] Reagent name volume DEPC water 8.4μL LwaCas13a Buffer 2μL crRNA (10ng / μL) 2μL Lwa Cas13a protein (10μM) 1μL rNTP Mix 1μL T7 RNA polymerase mix 0.6μL RNase inhibitors 0.5μL Signal reporter RNA molecules 2.5μL RPA Products 2μL total 20μL

[0104] Experimental group A, experimental group B, negative control group crRNA-N and negative control group RPA-N were set up; among them, the concentration of RPA amplification product in experimental group A was 1ng / μL; the concentration of RPA amplification product in experimental group B was 1pg / μL; RPA amplification product was not added to crRNA-N in the negative control group, but was replaced by DEPC H2O; RPA amplification substrate template DNA in the negative control group RPA-N was replaced by DEPC H2O, and after RPA reaction, the negative product of RPA reaction was added to the CRISPR-Cas13a detection system. Other reagent components of each experimental group and negative control group remained unchanged.

[0105] Place the PCR tube containing 20 μL of the system in Table 2 in a 37°C incubator for 40 minutes. Add 30 μL of DEPC H2O to the PCR tube after the reaction, insert the test strip (Tiosbio Cas13 / 12 special nucleic acid detection test strip purchased from Beijing Baoying Tonghui Biotechnology Co., Ltd., item number: JY0301) into the tube, wait for 2-3 minutes, and read the result. Among them, the signal reporting RNA molecule is FAM-RNA-biotin. The detection area of ​​the test strip is fixedly coated with colloidal gold, and the colloidal gold is labeled with anti-FAM antibodies; the quality inspection area is fixedly coated with biotin ligands.

[0106] Result determination: For negative samples, the colloidal gold particle anti-FAM antibody is fully coupled to the FAM-RNA-biotin reporter molecule, and the conjugate is intercepted by the biotin ligand in the quality inspection area, so only the quality inspection area band is colored, and the detection area band is not colored; for positive samples, the FAM-RNA-biotin reporter molecule is cut by Cas13a, and the colloidal gold particle-anti-FAM antibody-FAM conjugate accumulates in the detection area band, and the detection area band is colored, while the color is reduced or even not colored in the quality control area band.

[0107] 2. Test results

[0108] Screening of crRNA: The above experiments 1.2-1.3 provide 3 different crRNAs. The 3 different crRNAs were applied to the detection of Verticillium dahliae. The extracted genomic DNA of Verticillium dahliae was first added to the RPA reaction unit for pre-amplification, and then the amplified product was placed in the CRISPR-Cas13a detection system, and the reaction was observed through the lateral flow test strip. The reaction temperature was 37°C and the reaction time was 40 minutes. The test results were as follows: Figure 1 shown.

[0109] Depend on Figure 1 It can be seen that the test line of the lateral flow detection strip showed color bands at high concentrations of substrate; at low concentrations of substrate, crRNA2 had the best color development effect; and the negative control was established, with no false positives. This result also proves that the CRISPR-Cas13a lateral flow detection method can directly detect Verticillium dahliae by visual means.

[0110] Depend on Figure 1 It can be concluded that the best crRNA is crRNA2. Subsequent experiments use crRNA2 as the commonly used crRNA sequence.

[0111] Example 2 Specificity and sensitivity test

[0112] 1. Test methods

[0113] 1.1 Specificity test

[0114] The genomic DNA of Verticillium dahliae, Verticillium nigromaculata and Verticillium medicaceum was extracted by CTAB method. The above genomic DNA was used as a template for RPA pre-amplification (RPA-F1 and RPA-R2 were selected) and the CRISPR-Cas13a lateral flow test strip detection (crRNA2 was selected) was performed using the system established in Example 1, and a negative control was set to verify the specificity of the method.

[0115] 1.2 Sensitivity test

[0116] Construction of plasmid standards: Conventional PCR reaction was performed on the genomic DNA of Verticillium dahliae, and a single band of 392 bp was obtained. The product was purified by gel recovery and cloned and sequenced, and the results were completely consistent with expectations. The successfully constructed positive plasmid was named p MD-19T Vd-ITS and stored at -20°C for future use. The OD value of the plasmid standard was measured using a spectrophotometer and diluted to 100 ng / ul. The copy number of 100 ng / μl p MD-19T Vd-ITS standard was calculated to be 2.33×10 11 copies / ul.

[0117] The pMD-19T Vd-ITS standard plasmid (2.33×10 5 copies / μl~2.33×10 0 The sensitivity test was carried out using 4000 copies / μL) as a template, DEPC water as a negative control, and the lowest concentration without obvious bands on the test line was taken as the sensitivity of the detection method.

[0118] 2. Test results.

[0119] 2.1. Specificity test results

[0120] The specificity of the CRISPR-Cas13a lateral flow assay was evaluated by testing Verticillium dahliae, Verticillium nigromaculata, and Verticillium luciliae, as well as negative controls.

[0121] Test results such as Figure 2 As shown. Figure 2 It can be seen that the color development of the detection zone strip only appears on the test strip for detecting Verticillium dahliae in the present invention, and the test strips for detecting Verticillium nigromaculata and Verticillium lucerne and the negative control are all judged to be negative, indicating that the detection method established by the present invention has good specificity.

[0122] 2.2 Sensitivity test results

[0123] The standard plasmid was diluted 10 times in series to test the sensitivity of the method. The concentrations of electrophoretic bands 1 to 6 were 2.33×10 5 copies / μL, 2.33×104 copies / μL, 2.33×10 3 copies / μL, 2.33×10 2 copies / μL, 2.33×10 1 copies / μL, 2.33×10 0 copies / μL.

[0124] Test results such as Figure 3 As shown. Figure 3 It can be seen that the minimum detection limit of the present invention can reach 2.33×10 1 copies / μL, indicating that the detection method established by the present invention has good sensitivity.

[0125] The above-mentioned embodiments only express several implementation methods of the present invention, which is convenient for understanding the technical solution of the present invention in detail, but it cannot be understood as limiting the scope of the invention patent protection. It should be pointed out that for ordinary technicians in this field, several modifications and improvements can be made without departing from the concept of the present invention, which all belong to the protection scope of the present invention.

Claims

1. A primer combination for detecting Verticillium dahliae, characterized in that: It consists of an RPA primer pair and crRNA; the target gene of the RPA primer pair is the ITS gene of Verticillium dahliae; the target gene of the crRNA is the ITS gene of Verticillium dahliae; the upstream primer sequence of the RPA primer pair is Seq_1; the downstream primer sequence is Seq_6; the framework nucleic acid fragment sequence of the crRNA is Seq_13; the guide sequence is Seq_15; and the sequence of the crRNA is Seq_10.

2. A kit for detecting Verticillium dahliae, characterized in that: The method comprises the primer combination of claim 1, and further comprises DEPC water, LwaCas13a buffer, LwaCas13a protein, NTP buffer mix, T7 RNA polymerase mix, RNase inhibitor, RNA Reporter and Verticillium dahliae plasmid standard.

3. Use of the primer combination according to claim 1 or the kit according to claim 2 in detecting Verticillium dahliae.

4. The use according to claim 3, characterized in that: The steps include: S1, extracting genomic DNA of the sample to be tested, and using the genomic DNA of the sample to be tested as a template, performing RPA amplification to obtain an RPA product; S2. Using the RPA product as a template, a CRISPR / Cas13 detection system for Verticillium dahliae was constructed.

5. The use according to claim 4, characterized in that: The CRISPR / Cas13 detection system described in step S2 is: DEPC water 8.4 μl, LwaCas13a buffer 2 μl, LwaCas13a protein 1 μl, crRNA 2 μl, NTP buffer mix 1 μl, T7 RNA polymerase mix 0.6 μl, RNase inhibitor 0.5 μl, RNA Reporter 2.5 μl and Verticillium dahliae RPA product 2 μl.

Images