Application of energy sensor SnRK1α4 protein and its related biomaterials in regulating plant symbiotic nitrogen fixation

Abstract

The present invention discloses the application of energy receptor SnRK1α4 protein and related biological materials in regulating symbiotic nitrogen fixation in plants. The present invention provides a protein derived from Medicago truncatula, named SnRK1α4 protein, which is the protein shown in SEQ ID NO: 1. Nucleic acid molecules encoding SnRK1α4 protein also belong to the protection scope of the present invention. The nucleic acid molecule can specifically be the SnRK1α4 gene. The present invention also protects the application of SnRK1α4 protein or nucleic acid molecules encoding SnRK1α4 protein: (c1) positively regulating the symbiotic nitrogen fixation ability of plants; (c2) positively regulating the symbiotic nitrogen fixation ability of plants and nitrogen-fixing bacteria; (c3) positively regulating the growth performance of plants in low-nitrogen environments. The present invention provides valuable evidence for the study of nitrogen fixation mechanism of leguminous plants, provides important gene resources for the cultivation of new varieties of efficient nitrogen-fixing plants, and has important application prospects in agricultural production.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and particularly relates to application of energy receptor SnRK1α4 protein and related biological materials in regulating plant symbiotic nitrogen fixation. Background Art

[0002] Nitrogen is essential for plant growth. Although it accounts for 79% of the atmosphere, it cannot be directly absorbed and utilized by plants. The demand for nitrogen in agricultural systems is extremely high, and people often promote crop production and improve crop yield and quality by applying nitrogen fertilizers; however, the large-scale application of nitrogen fertilizers will cause serious environmental pressure and reduce production efficiency.

[0003] Biological nitrogen fixation converts free nitrogen in the atmosphere into absorbable ammonia, providing 50-70 Tg of fixed nitrogen source for agricultural systems every year. Among them, symbiotic nitrogen fixation is the largest branch of biological nitrogen fixation, especially the symbiotic nitrogen fixation system of leguminous plants and rhizobia, which relieves soil pressure and promotes nitrogen cycle in the atmosphere, which is of great significance to the sustainable development of agriculture.

[0004] Therefore, improving the symbiotic nitrogen fixation ability of plants and cultivating high-efficiency nitrogen-fixing crops have important production application value. Summary of the invention

[0005] The purpose of the present invention is to provide the application of energy sensor SnRK1α4 protein and related biological materials in regulating plant symbiotic nitrogen fixation.

[0006] The present invention provides a protein derived from Medicago truncatula, named SnRK1α4 protein, which is as follows (a1) or (a2) or (a3) ​​or (a4):

[0007] (a1) the protein shown in SEQ ID NO: 1;

[0008] (a2) a fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of the protein described in (a1);

[0009] (a3) a protein related to plant symbiotic nitrogen fixation ability obtained by replacing and / or deleting and / or adding one or more amino acid residues in (a1);

[0010] (a4) A protein derived from alfalfa that has more than 98% identity with (a1) and is associated with symbiotic nitrogen fixation in plants.

[0011] The labels may be specifically shown in Table 1.

[0012] Table 1 Tag sequences

[0013] Label Residue sequence Poly-Arg 5-6 (usually 5) RRRRR Poly-His 2-10 (usually 6) HHHHHH FLAG 8 DYKDDDDK Strep-tag II 8 WSHQ c-myc 10 EQKLISEEDL

[0014] Nucleic acid molecules encoding SnRK1α4 protein also fall within the protection scope of the present invention.

[0015] The nucleic acid molecule may specifically be the SnRK1α4 gene, which is as follows (b1) or (b2) or (b3) or (b4):

[0016] (b1) a DNA molecule whose coding region is shown in SEQ ID NO: 2;

[0017] (b2) the DNA molecule shown in SEQ ID NO: 3;

[0018] (b3) a DNA molecule derived from alfalfa and having more than 95% identity with (b1) or (b2) and encoding the protein;

[0019] (b4) A DNA molecule that hybridizes to the nucleotide sequence defined in (b1) or (b2) under stringent conditions and encodes the protein.

[0020] The stringent conditions mentioned above may be using a solution of 0.1×SSPE (or 0.1×SSC), 0.1% SDS, hybridizing at 65° C. and washing the membrane in a DNA or RNA hybridization experiment.

[0021] The expression cassette, recombinant vector, recombinant microorganism or transgenic plant cell containing the nucleic acid molecule all fall within the protection scope of the present invention.

[0022] The present invention also protects the use of SnRK1α4 protein or a nucleic acid molecule encoding SnRK1α4 protein, which is at least one of the following (c1) to (c3):

[0023] (c1) positively regulates the symbiotic nitrogen fixation ability of plants;

[0024] (c2) positively regulates the symbiotic nitrogen-fixing ability of plants and nitrogen-fixing bacteria;

[0025] (c3) Positively regulates plant growth performance in a low nitrogen environment.

[0026] The present invention also protects a method for cultivating plants with improved symbiotic nitrogen fixation ability, comprising the following steps: introducing a nucleic acid molecule encoding SnRK1α4 protein into a recipient plant to obtain a transgenic plant with improved symbiotic nitrogen fixation ability. The nucleic acid molecule can be introduced into the recipient plant via a recombinant plasmid. The recombinant plasmid can be a recombinant plasmid obtained by replacing a small fragment between the SalI and SpeI restriction sites in the vector pCAMBIA1307 with the SnRK1α4 gene.

[0027] The present invention also protects a method for cultivating plants with reduced symbiotic nitrogen fixation ability, comprising the following steps: inhibiting the expression of a nucleic acid molecule encoding SnRK1α4 protein in a target plant to obtain a transgenic plant with reduced symbiotic nitrogen fixation ability. The inhibition of the expression of a nucleic acid molecule encoding SnRK1α4 protein in a target plant can be achieved by introducing an interference vector targeting a nucleic acid molecule encoding SnRK1α4 protein into the target plant. The inhibition of the expression of a nucleic acid molecule encoding SnRK1α4 protein in a target plant can be achieved by introducing a gene editing vector targeting a nucleic acid molecule encoding SnRK1α4 protein into the target plant. Specifically, the gene editing vector is a vector based on Cas9 gene editing technology. Specifically, the gene editing vector expresses sgRNA and Cas9 protein. The sgRNA targets a nucleic acid molecule encoding SnRK1α4 protein. Specifically, the target of the sgRNA is: GCTAACCTCACCTTGCCAG.

[0028] The present invention also provides a method for cultivating plants with improved symbiotic nitrogen fixation ability, comprising the following steps: increasing the content of SnRK1α4 protein in the plants to obtain plants with improved symbiotic nitrogen fixation ability.

[0029] The present invention also provides a method for cultivating plants with reduced symbiotic nitrogen fixation ability, comprising the following steps: reducing the content of SnRK1α4 protein in the plants to obtain plants with reduced symbiotic nitrogen fixation ability.

[0030] The present invention also protects the use of any of the above methods in plant breeding.

[0031] The positive regulation of the symbiotic nitrogen fixation ability of the plant is manifested in that the abundance of SnRK1α4 protein is increased, and the symbiotic nitrogen fixation ability of the plant in symbiosis with rhizobia is improved.

[0032] The positive regulation of the symbiotic nitrogen fixation ability of the plant is manifested in that the abundance of SnRK1α4 protein is reduced, and the symbiotic nitrogen fixation ability of the plant during symbiosis with rhizobia is reduced.

[0033] The positive regulation of the symbiotic nitrogen fixation ability of the plant is manifested in that the abundance of SnRK1α4 protein increases, and when the plant and rhizobium coexist, the nodules of the plant become larger and / or the number of nodules increases and / or the fresh weight of nodules increases and / or the nitrogenase activity of nodules increases.

[0034] The positive regulation of the symbiotic nitrogen fixation ability of the plant is manifested in that the abundance of SnRK1α4 protein is reduced, and when the plant and rhizobium coexist, the nodules of the plant become smaller and / or the number of nodules decreases and / or the fresh weight of nodules decreases and / or the nitrogenase activity of nodules decreases.

[0035] The positive regulation of the symbiotic nitrogen fixation ability of the plant is reflected in that the abundance of the SnRK1α4 gene is increased, and the symbiotic nitrogen fixation ability of the plant during symbiosis with rhizobia is improved.

[0036] The positive regulation of the symbiotic nitrogen fixation ability of the plant is manifested in that the abundance of the SnRK1α4 gene is reduced, and the symbiotic nitrogen fixation ability of the plant during symbiosis with rhizobia is reduced.

[0037] The positive regulation of the symbiotic nitrogen fixation ability of the plant is manifested in that the abundance of the SnRK1α4 gene increases, and when the plant and rhizobium coexist, the nodules of the plant become larger and / or the number of nodules increases and / or the fresh weight of nodules increases and / or the nitrogenase activity of nodules increases.

[0038] The positive regulation of the symbiotic nitrogen fixation ability of the plant is manifested in that the abundance of the SnRK1α4 gene is reduced, and when the plant and the rhizobium coexist, the nodules of the plant become smaller and / or the number of nodules decreases and / or the fresh weight of nodules decreases and / or the nitrogenase activity of the nodules decreases.

[0039] The growth performance is: plant height and / or root length and / or fresh weight.

[0040] The root length is the main root length.

[0041] The fresh weight is the fresh weight of the above-ground part.

[0042] The improvement in the symbiotic nitrogen fixation ability is manifested in that when the plant and the rhizobium coexist, the nodules of the plant become larger and / or the number of nodules increases and / or the fresh weight of the nodules increases and / or the activity of the nodule nitrogenase increases and / or the plant height increases and / or the root length increases and / or the fresh weight increases.

[0043] The improvement of the symbiotic nitrogen fixation ability is the improvement of the symbiotic nitrogen fixation ability in a low-nitrogen environment.

[0044] The reduction in symbiotic nitrogen fixation ability is manifested in that when the plant and the rhizobium coexist, the nodules of the plant become smaller and / or the number of nodules decreases and / or the fresh weight of the nodules decreases and / or the activity of nodule nitrogenase decreases and / or the plant height decreases and / or the root length decreases and / or the fresh weight decreases.

[0045] The reduction in symbiotic nitrogen fixation ability refers to a reduction in symbiotic nitrogen fixation ability in a low-nitrogen environment.

[0046] Any of the above-mentioned low nitrogen environments refers to a nitrogen content in the culture medium of less than 0.5 mM.

[0047] Any of the above-mentioned low nitrogen environments refers to the culture medium containing no nitrogen.

[0048] Any of the above plants is a leguminous plant.

[0049] Any of the above plants is a plant of the genus Alfalfa.

[0050] Any of the above plants is Medicago truncatula.

[0051] Any of the above plants is of Medicago truncatula R108 ecotype.

[0052] Any of the above mentioned rhizobia may be Sinorhizobium.

[0053] Any of the above mentioned rhizobia may be Sinorhizobium Sm1021.

[0054] The inventors found in experiments that: SnRK1α4 overexpression plants showed normal growth under full nutrition conditions, increased nodule number, increased nodule size and fresh weight, increased nitrogenase activity, and overall plant growth was better than that of wild-type controls after inoculation of rhizobia under nitrogen deficiency conditions; snrk1α4 mutant plants (snrk1α4 functional deficiency) showed normal growth under full nutrition conditions, reduced nodule number, reduced nodule size and fresh weight, weakened nitrogenase activity, and overall plant growth was worse than that of wild-type controls after inoculation of rhizobia under nitrogen deficiency conditions. Therefore, SnRK1α4 positively regulates plant symbiotic nitrogen fixation, and overexpression of SnRK1α4 significantly improves plant symbiotic nitrogen fixation ability, which has important application value. The present invention provides valuable evidence for the study of nitrogen fixation mechanism of leguminous plants, provides important gene resources for the cultivation of new varieties of efficient nitrogen-fixing plants, and has important application prospects in agricultural production. BRIEF DESCRIPTION OF THE DRAWINGS

[0055] Figure 1 Schematic diagram of element analysis of SnRK1α4 protein and SnRK1α4 gene.

[0056] Figure 2 Schematic diagram of the elements of the recombinant plasmid p1307-SnRK1α4.

[0057] Figure 3 This is an agarose gel electrophoresis detection diagram of an exemplary sample in the PCR identification of Example 2.

[0058] Figure 4 It is the relative transcription level of SnRK1α4 gene in the tested plants in the RNA level identification in Example 2.

[0059] Figure 5 Schematic diagram of the elements of the recombinant plasmid p401-SnRK1α4.

[0060] Figure 6 These are the relevant sequencing results in the molecular identification of Example 3.

[0061] Figure 7 These are the results of plant phenotype identification under full nutrition conditions in Example 4.

[0062] Figure 8 These are the results of plant phenotype identification under nitrogen deficiency conditions in Example 4.

[0063] Fig. 9 This is the result of root phenotype identification under nitrogen deficiency conditions in Example 4. DETAILED DESCRIPTION

[0064] The present invention is further described in detail below in conjunction with specific embodiments, and the examples provided are only for illustrating the present invention, rather than for limiting the scope of the present invention. The examples provided below can be used as a guide for further improvements by those of ordinary skill in the art, and do not constitute a limitation of the present invention in any way.

[0065] The experimental methods in the following embodiments, unless otherwise specified, are conventional methods, and are carried out according to the techniques or conditions described in the literature in this field or according to the product instructions. The materials, reagents, etc. used in the following embodiments, unless otherwise specified, can be obtained from commercial sources. Unless otherwise specified, the quantitative tests in the following embodiments are set up with three repeated experiments, and the results are averaged. The wild-type alfalfa seeds used in the embodiments are wild-type alfalfa R108 seeds. The wild-type plants in the embodiments refer to wild-type alfalfa R108 plants. The statistical analysis method used in the embodiments is Whitney test; the P value expression method is: ns, not significant, *P<0.05, 0.01<**P<0.05, ***P<0.01, ****P<0.001.

[0066] Sinorhizobium meliloti Sm1021 is recorded in the following literature: Zhu F, Deng J, Chen H, Liu P, Zheng L, Ye Q, Li R, Brault M, Wen J, Frugier F, Dong J, Wang TA CEPpeptide receptor-like kinase regulates auxin biosynthesis and ethylene signaling to coordinate root growth and symbiotic nodulation in Medicagotruncatula. Plant Cell. 2020Sep;32(9):2855-2877.doi:10.1105 / tpc.20.00248.

[0067] Vector pHSE401 is described in the following document (described in Figure 1 of the document): Xing HL, Dong L, Wang ZP, Zhang HY, Han CY, Liu B, Wang XC, Chen QJ. A CRISPR / Cas9 toolkit for multiplex genome editing in plants. BMC Plant Biol. 2014 Nov 29; 14: 327. doi: 10.1186 / s12870-014-0327-y.

[0068] The vector pCAMBIA1307 (pCAMBIA1307 empty vector) is described in the following literature: Zhu F, Deng J, Chen H, Liu P, Zheng L, Ye Q, Li R, Brault M, Wen J, Frugier F, Dong J, Wang TA CEPpeptide receptor-like kinase regulates auxin biosynthesis and ethylenesignaling to coordinate root growth and symbiotic nodulation in Medicagotruncatula.Plant Cell.2020Sep;32(9):2855-2877.doi:10.1105 / tpc.20.00248.

[0069] The formula of the culture medium involved in the embodiment is as follows:

[0070] The formula of SH3a liquid medium (1L) is: 100 mL of 10×N6 macromolecular solution, 1 mL of 1000×SH micromolecular solution, 1 mL of 1000×SH organic solution, 20 mL of 50×EDFS iron salt solution, 0.4 mL of 2,4-D stock solution, 0.5 mL of 6-BAP stock solution, 100 mg of inositol, 30 g of sucrose, pH adjusted to 5.85, and the balance is water. 3.2 g of plant gel was added to the solid medium.

[0071] The formula of SH9 liquid medium (1L) is: 100mL of 10×N6 macromolecular solution, 1mL of 1000×SH micromolecular solution, 1mL of 1000×SH organic solution, 20mL of 50×EDFS iron salt solution, 100mg of inositol, 20g of sucrose, pH adjusted to 5.85, and the balance is water. 8g of agar is added to the solid medium.

[0072] The formula of 1 / 2MS liquid culture medium (1L) is: MURASHIGE&SKOOG (MS) BASAL MEDIUM (M519) (Phyto Technology Laboratories TM ) 2.22g, sucrose 12g, pH adjusted to 5.85, the balance is water. Add 8g agar to the solid medium.

[0073] The formula of Fahraeus nitrogen-free medium (1 L) is: MgSO 4 7H 2 O 0.123g, KH 2 PO 4 0.095g, Na 2 HPO 4 ·2H 2 O 0.14 g, 200× Fahraeus iron salt mother solution 5 mL, MnSO 4 0.1mg, CuSO 4 0.1mg, H 3 BO 3 0.1mg, Na 2 MoO 4 0.1mg, CaCl 2 ·2H 2 O 0.147g, the balance is water.

[0074] 10×N6 bulk mother liquor (1L): MgSO 4 7H 2 O 1.85g, KNO 3 28.3 g, (NH 4 ) 2 SO 4 4.63 g, CaCl 2 ·2H 2 O 1.66 g, KH 2 PO 4 4g, the balance is water.

[0075] 1000×SH trace stock solution (100mL): MnSO 4 ·H 2 O 1g, H 3 BO 3 500mg, ZnSO 4 7H 2 O 100 mg, KI 100 mg, Na 2 MoO 4 ·2H 2 O 10 mg, CuSO 4 ·5H 2O 20 mg, CoCl 2 6H 2 O 10 mg, the balance is water.

[0076] 1000×SH organic mother liquor (100 mL): nicotinic acid 500 mg, pyridoxine hydrochloride 500 mg, thiamine hydrochloride 500 mg, and the balance is water.

[0077] 50×EDFS iron salt mother solution (500 mL): NaFe·EDTA 3.487 g, the balance is water.

[0078] 2,4-D stock solution: contains 10 mg / mL 2,4-D, the balance is water.

[0079] 6-BAP stock solution: contains 1 mg / mL 6-BAP, the balance is water.

[0080] 200×Fahraeus iron salt mother solution (1L): FeSO 4 5.6 g, Na 2 EDTA 7.4g, the balance is water, chelate at 50℃.

[0081] The acetylene reduction method was used to detect the nitrogenase activity of the nodules, as follows: ① Take the underground part of the plant, put it into a chromatographic bottle with a capacity of 10 ml (i.e., the upper column volume is 10 ml), add 500 μL of sterile water and seal it; then inject 200 μL of pure acetylene gas and react at room temperature for 3 hours (i.e., the reaction time is 3 hours); ② After completing step ①, draw 100 μL of gas from the chromatographic bottle (i.e., the amount of sample gas is 100 μL) and inject it into the Nexis GC-2030 gas chromatograph, and record the peak area of ​​ethylene (called the ethylene peak area of ​​the test sample); ③ After completing step ①, take out the sample in the chromatographic bottle, peel the nodules with a blade and weigh the fresh weight of the nodules (in g). Inject 1 nmol of ethylene into the Nexis GC-2030 gas chromatograph and record the peak area of ​​ethylene (called the ethylene peak area of ​​the standard sample). The nitrogenase activity is defined as the amount of ethylene produced per milligram of nodule per hour, in units of nmol / g / min. Nitrogenase activity = (ethylene peak area of ​​test sample × upper column volume) ÷ ethylene peak area of ​​standard sample × sample gas volume ÷ (reaction time × nodule fresh weight).

[0082] Example 1. Discovery of SnRK1α4 protein and SnRK1α4 gene

[0083] A new protein was found in Medicago truncatula, named SnRK1α4 protein, as shown in SEQ ID NO: 1 (321aa). In the cDNA of Medicago truncatula, the open reading frame encoding SnRK1α4 protein is shown in SEQ ID NO: 2 (966bp). In the genomic DNA of Medicago truncatula, the gene encoding SnRK1α4 protein is shown in SEQ ID NO: 3 (3636bp, located on chromosome VI, containing 6 exons and 5 introns).

[0084] SnRK1α4 protein belongs to the energy sensor family AMPK / SnRK1 / SNF1 and has a kinase domain.

[0085] Schematic diagram of element analysis of SnRK1α4 protein and SnRK1α4 gene is shown in Figure 1 .

[0086] Example 2: Preparation of transgenic plants overexpressing SnRK1α4 gene

[0087] 1. Construction of plant expression vector

[0088] 1. Using the double-stranded DNA molecule shown in SEQ ID NO: 2 as a template, PCR amplification was performed using a primer pair consisting of SnRK1α4-F and SnRK1α4-R, and the PCR amplification product was recovered.

[0089] Primer SnRK1α4-F: ATGGACGGATCAAATAGCAT;

[0090] Primer SnRK1α4-R: TCAAATTTTCTCTTCTGAGGTCT.

[0091] 2. Using the PCR amplification product obtained in step 1 as a template, perform PCR amplification using a primer pair consisting of SnRK1α4-p1307-FLAG-F and SnRK1α4-p1307-FLAG-R, and recover the PCR amplification product.

[0092] Primer SnRK1α4-p1307-FLAG-F:AT GTCGAC ATGGACGGATCAAATAGC;

[0093] Primer SnRK1α4-p1307-FLAG-R:AT ACTAGT AATTTTCTCTTCTGAGGTCT.

[0094] 3. Take the PCR amplification product obtained in step 2, perform double digestion with restriction endonucleases SalI and SpeI, and recover the digestion product.

[0095] 4. Take the vector pCAMBIA1307, perform double digestion with restriction endonucleases SalI and SpeI, and recover the vector backbone of about 10 kb.

[0096] 5. Connect the digestion product obtained in step 3 and the vector backbone obtained in step 4 to obtain the recombinant plasmid p1307-SnRK1α4. The recombinant plasmid p1307-SnRK1α4 has been sequenced and verified to contain the DNA segment shown in SEQ ID NO: 4 (the inserted foreign DNA molecule forms a fusion gene with the 3×FLAG coding sequence in the vector). The schematic diagram of the elements of the recombinant plasmid p1307-SnRK1α4 is shown in Figure 2 .

[0097] 2. Preparation of transgenic plants overexpressing SnRK1α4 gene

[0098] 1. Introduce the recombinant plasmid p1307-SnRK1α4 into Agrobacterium EHA105 to obtain recombinant Agrobacterium.

[0099] 2. The recombinant Agrobacterium obtained in step 1 was inoculated into YEP liquid medium containing 75 mg / L rifampicin and 50 mg / L kanamycin, and cultured at 28°C and 230 rpm until the OD 600nm The value was 0.6-0.8, and then the mixture was centrifuged at room temperature and 5000 rpm for 10 min. The bacterial precipitate was collected and resuspended with an equal volume of SH3a liquid culture medium containing 0.1 mM acetosyringone to obtain the infection solution.

[0100] 3. Take wild-type alfalfa seeds and use 98% H 2 SO 4 The seeds were treated with the solution for 8 min, then rinsed 5 times with precooled deionized water, and then disinfected with a 0.5% NaClO aqueous solution containing 0.1% TritonX100 for 12 min, and then rinsed with sterile water in a clean bench; the seeds were then spread on a 0.8% water agar plate and incubated inverted at 4°C in the dark for 3 days, and then inverted at room temperature in the dark for 12 h; the germinated seeds were then placed on a 1 / 2MS solid culture medium in a clean bench and cultured for 3-4 weeks at 22°C with alternating light and dark (16 h light / 8 h dark); the fully expanded leaves were then taken, immersed in a sterilized 0.1% Triton X100 aqueous solution for 5 min, and then washed 3-5 times with sterile water, and each single leaf was cut into 2-4 pieces with a knife to form explants.

[0101] 4. Immerse the explants prepared in step 3 in the infection solution prepared in step 2, evacuate to -0.09 MPa and maintain for 30 min, then slowly release the air; then place in a horizontal shaker at 60 rpm in the dark for 1.5 h; then take out the explants, spread them on a single layer of filter paper-covered SH3a solid culture medium containing 0.1 mM acetosyringone, and culture them at 22°C in the dark for 3 days.

[0102] 5. After completing step 4, transfer the explants to SH3a solid medium containing 10 mg / L hygromycin B and 200 mg / L timentin and culture at 22°C in the dark. Subculture every 2 weeks for a total of 6 weeks.

[0103] 6. After completing step 5, callus was transferred to SH9 solid medium containing 5 mg / L hygromycin B and 200 mg / L timentin, and cultured at 22°C with alternating light and dark (16 h light / 8 h dark). Subculture was performed every 3 weeks until regenerated shoots were obtained.

[0104] 7. Transfer the regenerated seedlings obtained in step 6 to 1 / 2MS solid medium and culture them at 22°C with alternating light and dark (16h light / 8h dark). Subculture every 3-4 weeks until the plants take root.

[0105] 8. Transfer the rooted regenerated plants obtained in step 7 to nutrient soil and culture them in a greenhouse.

[0106] Greenhouse conditions: 22°C, 16h light / 8h dark, humidity 70%-80%.

[0107] The rooted regenerated plants were initially named SnRK1α4-OX-n, where n is a natural number representing the plant number.

[0108] 3. Molecular Identification

[0109] 1. PCR identification

[0110] Test plants: rooted regenerated plants obtained in step 2.

[0111] The wild-type plants (WT) were used as negative controls.

[0112] Take leaves of the test plants and extract genomic DNA. Use the genomic DNA as a template and use the primer pair consisting of SnRK1α4-F and FLAG-testR for PCR amplification, and then perform agarose gel electrophoresis. If an amplification product of about 1017 bp is displayed, it is judged as positive and the test plant is a transgenic plant.

[0113] Primer SnRK1α4-F: ATGGACGGATCAAATAGCAT;

[0114] Primer FLAG-testR: GTAATCGATGTCGTGATCCTTA.

[0115] Agarose gel electrophoresis of exemplary samples is shown in Figure 3 SnRK1α4-OX-1 plants, SnRK1α4-OX-2 plants, SnRK1α4-OX-3 plants, SnRK1α4-OX-5 plants, SnRK1α4-OX-6 plants, SnRK1α4-OX-7 plants, SnRK1α4-OX-8 plants, SnRK1α4-OX-9 plants and SnRK1α4-OX-10 plants are all transgenic plants.

[0116] 2. RNA level identification

[0117] Test plants: SnRK1α4-OX-1 plant, SnRK1α4-OX-2 plant, SnRK1α4-OX-3 plant, SnRK1α4-OX-5 plant, SnRK1α4-OX-6 plant, SnRK1α4-OX-7 plant, SnRK1α4-OX-8 plant, SnRK1α4-OX-9 plant and SnRK1α4-OX-10 plant. Wild-type plants (WT) were used as negative controls for the test plants.

[0118] Take the leaves of the test plants, extract total RNA, and reverse transcribe to obtain cDNA. Using cDNA as a template and MtActin4A gene as an internal reference gene, the transcription level of SnRK1α4 gene was detected by RT-qPCR. The transcription level of SnRK1α4 gene in wild-type plants was used as a reference to calculate the relative transcription level of SnRK1α4 gene in the test plants.

[0119] The primers used to detect the MtActin4A gene are as follows:

[0120] Primer MtActin4A-F: CCAAAGGCCAACAGAGAAAA;

[0121] Primer MtActin4A-R: ACGACCAGCAAGATCCAAAC.

[0122] The primers used to detect SnRK1α4 gene are as follows:

[0123] Primer SnRK1α4-RTqPCR-F: TTGAAAATGGACGGATCAAA;

[0124] Primer SnRK1α4-RTqPCR-R: CTCTTTCCAACGGCAATCAA.

[0125] The relative transcription levels of SnRK1α4 gene in the tested plants are shown in Figure 4 .

[0126] Example 3: Preparation of snrk1α4 mutant plants with loss of snrk1α4 function

[0127] 1. Construction of genome editing binary vector

[0128] 1. Preparation of SnRK1α4-CBC fragment

[0129] The SnRK1α4-CBC fragment is a double-stranded DNA molecule shown in SEQ ID NO:5.

[0130] 2. Take the SnRK1α4-CBC fragment, digest it with restriction endonuclease BsaI, and recover the digestion product.

[0131] 3. Take the vector pHSE401, digest it with the restriction endonuclease BsaI, and recover the vector backbone of about 15.5 kb.

[0132] 4. Connect the digested product obtained in step 2 and the vector backbone obtained in step 3 to obtain the recombinant plasmid p401-SnRK1α4. The recombinant plasmid p401-SnRK1α4 has been sequenced and verified. The schematic diagram of its elements is shown in Figure 5 The recombinant plasmid p401-SnRK1α4 expressed sgRNA targeting the SnRK1α4 gene (the target of sgRNA was: GCTAACCTCACCTTGCCAG) and Cas9 protein.

[0133] 2. Preparation of snrk1α4 mutant plants with loss of snrk1α4 function

[0134] The recombinant plasmid p401-SnRK1α4 was used to replace the recombinant plasmid p1307-SnRK1α4, and the rest was the same as step 2 of Example 2 to obtain rooted regenerated plants.

[0135] 3. Molecular Identification

[0136] 1. Identification of transgenic

[0137] Test plants: rooted regenerated plants obtained in step 2.

[0138] The wild-type plants (WT) were used as negative controls.

[0139] Take leaves of the test plants and extract genomic DNA. Use the genomic DNA as a template and use the primer pair consisting of SnRK1α4-BsF and BsR for PCR amplification, and then perform agarose gel electrophoresis. If a 321bp amplification product is displayed, it is judged as positive and the test plant is a transgenic plant.

[0140] Primer SnRK1α4-BsF: ATATATGGTCTCGATTG GCTAACCTCACCTTGCCAG GTT;

[0141] Primer BsR: ATTATTGGTCTCGAAACTATTGGTTTATCTCATCGG.

[0142] 2. Identification of mutation patterns

[0143] Test plants: transgenic plants selected in step 1.

[0144] Leaves of the tested plants were taken to extract genomic DNA. The genomic DNA was used as a template and a primer pair consisting of SnRK1α4-TF and SnRK1α4-TR was used for PCR amplification. The PCR amplification products were recovered and sequenced.

[0145] Leaves of wild-type plants were taken to extract genomic DNA. The genomic DNA was used as a template and a primer pair consisting of SnRK1α4-TF and SnRK1α4-TR was used for PCR amplification. The PCR amplification products were recovered and sequenced.

[0146] Primer SnRK1α4-TF: CAAACCCCCACTAAATGAT;

[0147] Primer SnRK1α4-TR: TGCATCAAAACTAATCAC.

[0148] The sequencing results of the test plants were compared with those of the wild-type plants.

[0149] Based on the results of sequence alignment, homozygous mutant plants (i.e., a pair of homologous chromosomes have the same mutation) are screened.

[0150] Two homozygous mutant plants were obtained and named snrk1α4-1 and snrk1α4-2.

[0151] The relevant sequencing results can be found in Figure 6 Compared with the wild-type plants, the pair of homologous chromosomes in the snrk1α4-1 plant lost 13bp, that is, the "TTGGTCCTCTGGCAAGGTGAGGTTAGCAG" in the genomic DNA mutated to "TTGGTCCTCTTAGCAG". Compared with the wild-type plants, the pair of homologous chromosomes in the snrk1α4-2 plant gained 1bp, that is, the genomic DNA "TTGGTCCTCTGGCAAGGTGAGGTTAGCAG" mutated to "TTGGTCCTCTGAGCAAGGTGAGGTTAGCAG".

[0152] Example 4: Plant phenotype identification

[0153] Seeds for testing: seeds of SnRK1α4-OX plants, seeds of snrk1α4 mutant plants, and seeds of wild-type plants. The seeds of SnRK1α4-OX plants were obtained by mixing the seeds obtained by selfing SnRK1α4-OX-8 plants and the seeds obtained by selfing SnRK1α4-OX-10 plants in equal quantities. The seeds of snrk1α4 mutant plants were obtained by mixing the seeds obtained by selfing snrk1α4-1 plants and the seeds obtained by selfing snrk1α4-2 plants in equal quantities.

[0154] Culture medium: Mix 5 parts by volume of vermiculite and 2 parts by volume of perlite.

[0155] Plant cultivation was carried out in a greenhouse under the following conditions: 22°C, 16h light / 8h dark, and 70%-80% humidity.

[0156] 1. Plant phenotype identification under full nutrition conditions

[0157] The test seeds were sterilized and then planted in a culture medium soaked with 1 / 2MS liquid medium for 21 days. After the culture was completed, the phenotype was observed and photographed, and the plants were collected and the above-ground and underground parts were weighed respectively.

[0158] Exemplary photos of plants are shown in Figure 7 The statistical results of the aboveground biomass and underground biomass of the plants are shown in Figure 7 B and C (biomass refers to fresh weight, n = 15). From the phenotype, there was no significant difference in growth and development among the three groups of plants. From the biomass, there was no significant difference in the fresh weight of the aboveground part and the fresh weight of the underground part of the three groups of plants.

[0159] 2. Identification of plant nodulation phenotype under nitrogen deficiency conditions

[0160] The test seeds were disinfected and then planted in a culture medium soaked with Fahraeus nitrogen-free medium. After 7 days, they were inoculated with nitrogen-fixing bacteria solution (15 mL of solution was inoculated per plant and watered to the rhizosphere), and then cultured for another 21 days before plant phenotypic identification and root phenotypic identification were performed.

[0161] Azotobacterium solution: Resuspend the S. meliloti Sm1021 cells in sterile water to an OD of 600nm =0.05.

[0162] Plant phenotyping includes taking photos, measuring taproot length, measuring plant height, and measuring the fresh weight of the aboveground part of the plant. Figure 8 The statistical results of the taproot length of the plants are shown in Figure 8The statistical results of plant height are shown in Figure 8 The statistical results of the aboveground biomass of the plants are shown in Figure 8 D (biomass refers to fresh weight, n = 15). SnRK1α4-OX taproot length is significantly greater than WT, plant height is significantly higher than WT, and aboveground fresh weight is significantly greater than WT. snrk1α4 taproot length is significantly less than WT, plant height is significantly lower than WT, and aboveground fresh weight is significantly less than WT.

[0163] Root phenotypic identification includes nodule observation, nodule number counting, nodule fresh weight counting and nodule nitrogenase activity detection. Fig. 9 The statistical results of the number of nodules of A. Fig. 9 B (n = 15). The statistical results of nodule fresh weight are shown in Fig. 9 C (n = 15). The statistical results of nitrogenase activity are shown in Fig. 9 D (n=15). The nitrogenase activity of SnRK1α4-OX was significantly higher than that of WT, while that of snrk1α4 was significantly lower than that of WT. The number of SnRK1α4-OX nodules was significantly more than that of WT, and the fresh weight of nodules was significantly greater than that of WT, while the number of snrk1α4 nodules was significantly less than that of WT, and the fresh weight of nodules was significantly less than that of WT.

[0164] The above results show that SnRK1α4 protein is a positive regulator of plant symbiotic nitrogen fixation. Increasing the abundance of SnRK1α4 protein by overexpressing the SnRK1α4 gene does not affect the normal growth and development of plants under full nutrition conditions. Under nitrogen-deficient conditions, plants overexpressing the SnRK1α4 gene showed larger nodule morphology, increased number, increased fresh weight, and increased nitrogenase activity, and significantly improved symbiotic nitrogen fixation ability. At the same time, the overall biomass of the plant increased, and the growth state was good, which has important application value in agricultural production.

[0165] The present invention has been described in detail above. It will be apparent to those skilled in the art that the present invention may be implemented in a wide range under equivalent parameters, concentrations and conditions without departing from the spirit and scope of the present invention and without the need for unnecessary experimentation. Although the present invention provides specific embodiments, it should be understood that further improvements may be made to the present invention. In short, according to the principles of the present invention, this application intends to include any changes, uses or improvements to the present invention, including changes made by conventional techniques known in the art that depart from the scope disclosed in this application. Applications of some of the basic features may be made within the scope of the following appended claims.

Claims

1. Protein, which is (a1) or (a2) as follows: (a1) the protein shown in SEQ ID NO: 1; (a2) A fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of the protein described in (a1).

2. A nucleic acid molecule encoding the protein of claim 1.

3. The nucleic acid molecule according to claim 2, characterized in that: The nucleic acid molecule is as follows (b1) or (b2): (b1) a DNA molecule having a coding region as shown in SEQ ID NO: 2; (b2) The DNA molecule represented by SEQ ID NO:

3.

4. An expression cassette, recombinant vector or recombinant microorganism containing the nucleic acid molecule according to claim 2 or 3.

5. Use of the protein according to claim 1 or the nucleic acid molecule according to claim 2 or 3, which is at least one of the following (c1) to (c3): (c1) positively regulates the symbiotic nitrogen fixation ability of alfalfa; (c2) positively regulates the symbiotic nitrogen-fixing ability of alfalfa and nitrogen-fixing bacteria; (c3) Positively regulates the growth performance of alfalfa in a low nitrogen environment.

6. A method for cultivating alfalfa with improved symbiotic nitrogen fixation ability, comprising the following steps: introducing the nucleic acid molecule of claim 2 or 3 into a recipient alfalfa to obtain transgenic alfalfa with improved symbiotic nitrogen fixation ability.

7. A method for cultivating Medicago truncatula with reduced symbiotic nitrogen fixation ability, comprising the following steps: inhibiting the expression of the nucleic acid molecule according to claim 2 or 3 in the target Medicago truncatula to obtain Medicago truncatula with reduced symbiotic nitrogen fixation ability.

8. A method for cultivating alfalfa with improved symbiotic nitrogen fixation ability, comprising the following steps: increasing the content of the protein according to claim 1 in alfalfa to obtain alfalfa with improved symbiotic nitrogen fixation ability.

9. A method for cultivating Medicago truncatula with reduced symbiotic nitrogen fixation ability, comprising the following steps: reducing the content of the protein according to claim 1 in Medicago truncatula to obtain Medicago truncatula with reduced symbiotic nitrogen fixation ability.

10. Use of the method according to claim 6 or 8 in cultivating alfalfa with improved symbiotic nitrogen fixation ability.

11. Use of the method according to claim 7 or 9 in cultivating Medicago truncatula with reduced symbiotic nitrogen fixation ability.

Images