Application of HSP90.2 protein and its encoding gene in regulating wheat disease resistance

Abstract

The present invention discloses the application of HSP90.2 protein and its encoding gene in regulating wheat disease resistance. The present invention first analyzes the powdery mildew resistance and stripe rust resistance of hsp90.2-aabb double mutant material and wild-type Kronos material and finds that HSP90.2 can regulate wheat powdery mildew resistance and stripe rust resistance. Further, by overexpressing HSP90.2 in wild-type Kronos material, it is found that overexpressing HSP90.2 can improve wheat resistance to powdery mildew. HSP90.2 protein and related biological materials will play an important role in breeding disease-resistant wheat varieties.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and specifically relates to application of HSP90.2 protein and its encoding gene in regulating wheat disease resistance. Background Art

[0002] Wheat powdery mildew is a common and highly prevalent fungal disease that occurs at all stages of wheat growth and has the characteristics of wide distribution range and strong transmission. The disease mainly occurs on wheat leaves, and in severe cases can infect the entire wheat plant, posing a great threat to wheat growth. Severe disease in the seedling stage of wheat can directly affect growth and development. At the same time, after the plant is infected, powdery mildew infection of the leaves will seriously affect the photosynthesis of the plant, thereby affecting the filling of the grains, and then leading to a decrease in yield. Stripe rust is the fungal disease that has the most serious impact on wheat production. The disease causes annual wheat production losses of up to 10% nationwide. Wheat grains affected by stripe rust are shriveled, and their appearance and edibility are seriously affected.

[0003] Heat shock protein 90 (Hsp90) is a highly conserved molecular chaperone that is ubiquitous in eukaryotic cells. Hsp90 has the function of promoting protein refolding and is widely involved in stress signal transduction such as temperature, drought, salt stress and pathogen infection. Summary of the invention

[0004] The technical problem to be solved by the present invention is how to regulate the disease resistance of wheat.

[0005] In order to solve the above technical problems, the present invention first provides a new use of HSP90.2 protein or related biological materials.

[0006] The present invention provides the use of HSP90.2 protein or related biological materials in any of the following 1)-3):

[0007] 1) Regulate wheat disease resistance;

[0008] 2) Cultivate transgenic wheat with improved disease resistance;

[0009] 3) Wheat breeding;

[0010] The HSP90.2 protein is HSP90.2-7B protein and / or HSP90.2-7A protein. The HSP90.2-7B protein and the HSP90.2-7A protein are two copies of the HSP90.2 protein on chromosome 7B and chromosome 7A of tetraploid wheat, respectively.

[0011] The HSP90.2-7B protein is any one of the following proteins (a1)-(a4):

[0012] (a1) the protein shown in Sequence 2 in the sequence listing;

[0013] (a2) a fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of the protein described in (a1);

[0014] (a3) a protein associated with wheat disease resistance obtained by replacing and / or deleting and / or adding one or more amino acid residues in (a1);

[0015] (a4) A protein that has 98% or more identity with (a1) and is associated with wheat disease resistance.

[0016] The HSP90.2-7A protein is any one of the following proteins (b1)-(b4):

[0017] (b1) the protein shown in Sequence No. 4 in the sequence listing;

[0018] (b2) a fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of the protein described in (b1);

[0019] (b3) a protein associated with wheat disease resistance obtained by replacing and / or deleting and / or adding one or more amino acid residues in (b1);

[0020] (b4) A protein that has more than 98% identity with (b1) and is associated with wheat disease resistance.

[0021] In the protein described in (a2) or (b2) above, the tag refers to a polypeptide or protein fused and expressed together with the target protein using DNA in vitro recombination technology to facilitate the expression, detection, tracing and / or purification of the target protein. The tag can be a Flag tag, a His tag, an MBP tag, an HA tag, a myc tag, a GST tag and / or a SUMO tag, etc.

[0022] In the protein described in (a3) ​​or (b3) above, the substitution and / or deletion and / or addition of one or several amino acid residues is substitution and / or deletion and / or addition of no more than 10 amino acid residues, or substitution and / or deletion and / or addition of no more than 9 amino acid residues, or substitution and / or deletion and / or addition of no more than 8 amino acid residues, or substitution and / or deletion and / or addition of no more than 7 amino acid residues, or substitution and / or deletion and / or addition of no more than 6 amino acid residues, or substitution and / or deletion and / or addition of no more than 5 amino acid residues, or substitution and / or deletion and / or addition of no more than 4 amino acid residues, or substitution and / or deletion and / or addition of no more than 3 amino acid residues, or substitution and / or deletion and / or addition of no more than 2 amino acid residues, or substitution and / or deletion and / or addition of no more than 1 amino acid residue.

[0023] In the protein described in (a4) or (b4) above, the identity refers to the identity of the amino acid sequence. The identity of the amino acid sequence can be determined using a homology search site on the Internet, such as the BLAST page on the NCBI homepage website. For example, in Advanced BLAST2.1, by using blastp as a program, setting the Expect value to 10, setting all filters to OFF, using BLOSUM62 as a matrix, setting the Gap existence cost, Per residue gap cost and Lambda ratio to 11, 1 and 0.85 (default values) respectively, and searching for the identity of a pair of amino acid sequences, the identity value (%) can be calculated.

[0024] The related biological material is a nucleic acid molecule encoding the HSP90.2-7B protein or the HSP90.2-7A protein, or an expression cassette, a recombinant vector or a recombinant microorganism containing the nucleic acid molecule.

[0025] Furthermore, the nucleic acid molecule encoding the HSP90.2-7B protein is a DNA molecule as described in any one of (A1) or (A2):

[0026] (A1) the DNA molecule shown in Sequence 1 in the sequence listing;

[0027] (A2) A DNA molecule that has 75% or more identity with (A1) and encodes the protein.

[0028] The nucleic acid molecule encoding the HSP90.2-7A protein is a DNA molecule as described in any one of the following (B1) or (B2):

[0029] (B1) the DNA molecule shown in Sequence 3 in the sequence listing;

[0030] (B2) A DNA molecule that has 75% or more identity with (B1) and encodes the protein.

[0031] Those skilled in the art can easily mutate the nucleotide sequence encoding the HSP90.2-7B protein or HSP90.2-7A protein of the present invention by using known methods, such as directed evolution and point mutation. Those artificially modified nucleotides having 75% or higher identity with the HSP90.2-7B or HSP90.2-7A nucleotide sequence isolated from the present invention are all derived from the nucleotide sequence of the present invention and are equivalent to the sequence of the present invention as long as they encode the HSP90.2-7B protein or HSP90.2-7A protein and have the same function.

[0032] The term "identity" as used herein refers to sequence similarity to a natural nucleic acid sequence. "Identity" includes nucleotide sequences that have 75% or more, or 80% or more, or 85% or more, or 90% or more, or 95% or more identity to the nucleotide sequence of the protein composed of the amino acid sequence shown in the coding sequence 2 or sequence 4 of the present invention. Identity can be evaluated by the naked eye or by computer software. Using computer software, the identity between two or more sequences can be expressed as a percentage (%), which can be used to evaluate the identity between related sequences.

[0033] Furthermore, the expression cassette refers to a DNA capable of expressing HSP90.2-7B protein and / or HSP90.2-7A protein in a host cell, and the DNA may include not only a promoter for initiating transcription of HSP90.2-7B and / or HSP90.2-7A, but also a terminator for terminating transcription of HSP90.2-7B and / or HSP90.2-7A. Furthermore, the expression cassette may also include an enhancer sequence.

[0034] The vector may be a plasmid, cosmid, phage or viral vector.

[0035] The microorganism may be yeast, bacteria, algae or fungi; the bacteria may be Agrobacterium (such as Agrobacterium EHA105).

[0036] In the above application, the regulation is improvement, which is specifically reflected in that when the HSP90.2-7B protein content in wheat is increased or the expression level of the HSP90.2-7B gene is increased, the disease resistance of wheat is improved.

[0037] In order to solve the above technical problems, the present invention also provides a new use of a substance that inhibits the above HSP90.2 protein.

[0038] The present invention provides the use of a substance that inhibits the above-mentioned HSP90.2 protein in any one of the following (d1)-(d3):

[0039] (d1) Reduce wheat disease resistance;

[0040] (d2) breeding transgenic wheat with reduced disease resistance;

[0041] (d3) Wheat breeding.

[0042] In the above application, the reduction of wheat disease resistance is specifically manifested as: when the content of HSP90.2-7B protein and HSP90.2-7A protein in wheat is reduced, or HSP90.2-7B protein and HSP90.2-7A protein are not expressed, the wheat disease resistance is reduced.

[0043] In order to solve the above technical problems, the present invention also provides a method for cultivating transgenic wheat with improved disease resistance.

[0044] The method for cultivating transgenic wheat with improved disease resistance provided by the present invention comprises the steps of increasing the activity and / or content of HSP90.2 protein in the recipient wheat to obtain the transgenic wheat; the disease resistance of the transgenic wheat is higher than that of the recipient wheat.

[0045] Furthermore, the method for increasing the activity and / or content of HSP90.2 protein in the recipient wheat is to overexpress HSP90.2-7B protein in the recipient wheat.

[0046] The overexpression method is to introduce the coding gene of the HSP90.2-7B protein into the recipient wheat.

[0047] Furthermore, the disease resistance of the transgenic wheat is higher than that of the recipient wheat, which is specifically manifested in that the number of powdery mildew spores and / or the powdery mildew spore biomass of the transgenic wheat after inoculation with powdery mildew fungi is lower than that of the recipient wheat.

[0048] In order to solve the above technical problems, the present invention finally provides a method for cultivating transgenic wheat with reduced disease resistance.

[0049] The method for cultivating transgenic wheat with reduced disease resistance provided by the present invention comprises the steps of reducing the activity and / or content of HSP90.2 protein in a recipient plant to obtain a transgenic plant; the disease resistance of the transgenic plant is lower than that of the recipient plant.

[0050] Furthermore, reducing the activity and / or content of the HSP90.2 protein in the recipient plant is reducing the activity and / or content of the HSP90.2-7A protein and the HSP90.2-7B protein in the recipient plant.

[0051] Furthermore, the disease resistance of the transgenic plant is lower than that of the recipient plant, which is specifically manifested in that the powdery mildew area and / or powdery mildew spore biomass and / or microcolony index of the transgenic plant are higher than those of the recipient plant.

[0052] In any of the above uses or methods, the disease resistance may be powdery mildew resistance and / or stripe rust resistance.

[0053] Furthermore, the powdery mildew may specifically be powdery mildew caused by powdery mildew fungus race E09.

[0054] The stripe rust disease may specifically be the stripe rust disease caused by the stripe rust fungus CRY32.

[0055] In any of the above-mentioned uses or methods, the wheat or recipient wheat may specifically be wild-type tetraploid Durum wheat (Kronos).

[0056] In any of the above-mentioned applications or methods, the transgenic plants include not only the first generation transgenic plants obtained by transforming the HSP90.2 gene into the target plant, but also its progeny. For transgenic plants, the gene can be propagated in the species, or the gene can be transferred into other varieties of the same species, especially commercial varieties, using conventional breeding techniques. The transgenic plants include seeds, callus, complete plants and cells.

[0057] The present invention first analyzes the powdery mildew resistance and stripe rust resistance of hsp90.2-aabb double mutant materials and wild-type Kronos materials and finds that HSP90.2 can regulate wheat powdery mildew resistance and stripe rust resistance. Further, by overexpressing HSP90.2 in wild-type Kronos materials, it is found that overexpressing HSP90.2 can improve wheat resistance to powdery mildew. HSP90.2 protein and related biological materials will play an important role in breeding disease-resistant wheat varieties. BRIEF DESCRIPTION OF THE DRAWINGS

[0058] Figure 1The hsp90.2-aabb double mutant material of wheat has a significantly weaker ability to resist powdery mildew than the wild-type Kronos. A is the detection of the accumulation of HSP90.2 protein in the hsp90.2-aabb double mutant material and the wild-type Kronos. B is the phenotype of the hsp90.2-aabb double mutant material and the wild-type Kronos after inoculation with powdery mildew. C is the statistics of the powdery mildew area of ​​the hsp90.2-aabb mutant material and the wild-type Kronos 7 days after inoculation with powdery mildew. D is the statistics of the powdery mildew spore biomass of the hsp90.2-aabb mutant material and the wild-type Kronos 7 days after inoculation with powdery mildew. E is the powdery mildew staining of the hsp90.2-aabb mutant material and the wild-type Kronos 7 days after inoculation with powdery mildew. F is the statistics of the powdery mildew microcolony index of the hsp90.2-aabb mutant material and the wild-type Kronos 7 days after inoculation with powdery mildew.

[0059] Figure 2 The wheat hsp90.2-aabb double mutant material has a significantly weaker ability to resist stripe rust than the wild-type Kronos. A is the phenotype of the hsp90.2-aabb double mutant material and wild-type Kronos after inoculation with stripe rust. B is the statistics of the microcolony index of the hsp90.2-aabb double mutant material and wild-type Kronos after inoculation with stripe rust.

[0060] Figure 3 Analysis of the ability of HSP90.2-7B transgenic wheat to resist powdery mildew. A is the detection of HSP90.2 protein expression in HSP90.2-7B transgenic wheat. B is the reduction of colony area of ​​HSP90.2-7B transgenic wheat leaves 7 days after powdery mildew inoculation. C is the reduction of powdery mildew spore biomass in HSP90.2-7B transgenic wheat compared with the control Kronos 7 days after powdery mildew inoculation. D is the increase of HSP90.2 gene expression in HSP90.2-7B transgenic wheat compared with the control Kronos 7 days after powdery mildew inoculation. The p value in the figure indicates the significant level. DETAILED DESCRIPTION

[0061] The present invention is further described in detail below in conjunction with specific embodiments, and the examples provided are only for illustrating the present invention, rather than for limiting the scope of the present invention. The examples provided below can be used as a guide for further improvements by those of ordinary skill in the art, and do not constitute a limitation of the present invention in any way.

[0062] The experimental methods in the following examples, unless otherwise specified, are all conventional methods, and are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial channels.

[0063] The tetraploid Duran wheat (Kronos) in the following example is described in the document “Krasileva, KV, et al. (2017). “Uncovering hidden variation in polyploid wheat.” Proceedings of the National Academy of Sciences 114(6): E913-E921.”.

[0064] The double mutant material hsp90.2aabb in the following example is recorded in the document “Yan., et al. (2023). “HSP90.2 promotes CO2 assimilation rate, grain weight, and yield in wheat.” Plant Biotechnology Journal.”

[0065] The powdery mildew race E09 in Example 1 below is described in the document “Li, Genqiao, et al. 2009, Molecular identification of a new powdery mildew resistance gene Pm41 on chromosome 3BL derived from wild emmer (Triticum turgidum var. dicoccoides). Theoretical and applied genetics 119: 531-539.”

[0066] The stripe rust fungus CRY32 in the following Example 1 is recorded in the document “Chen, Yun, et al. 2020, Cloning of wheat keto-acyl thiolase 2B reveals a role of jasmonic acid in grain weight determination. Nature Communications 11(1): 6266.”.

[0067] The amino acid sequence of the HSP90.2-7B protein in the following Example 1 is shown as Sequence 2 in the sequence listing, and the coding gene sequence is shown as Sequence 1 in the sequence listing.

[0068] The amino acid sequence of the HSP90.2-7A protein in the following Example 1 is shown as Sequence 4 in the sequence listing, and the coding gene sequence is shown as Sequence 3 in the sequence listing.

[0069] Example 1. Sequence analysis of double mutant material (hsp90.2aabb) and detection of its disease resistance

[0070] 1. Sequence analysis of double mutant material (hsp90.2aabb) and detection of HSP90.2 protein expression 1. Sequence analysis of double mutant material (hsp90.2aabb)

[0071] Compared with the wild-type wheat Kronos genome sequence, the only difference between the double mutant material (hsp90.2aabb) is that the gene sequence encoding HSP90.2 on wheat chromosome 7A (HSP90.2-7A, sequence 3) mutated from TGG to TGA at positions 622-624, and the gene sequence encoding HSP90.2 on wheat chromosome 7B (HSP90.2-7B, sequence 1) mutated from TGG to TGA at positions 877-879, resulting in premature termination of protein translation.

[0072] 2. Detection of HSP90.2 protein expression

[0073] The expression level of HSP90.2 protein in the double mutant material (hsp90.2aabb) and the wild-type wheat Kronos was detected. The specific steps are as follows: Put steel balls in a 2mL centrifuge tube in advance, cut an appropriate amount of wheat leaves into a centrifuge tube and quickly put them into liquid nitrogen, and use a high-throughput tissue grinder to break the sample, 45Hz, 20s, repeat once, until the wheat leaves are ground into powder. Add 2 times the volume of the sample plant protein extraction buffer, and add protease inhibitors to incubate on ice for 0.5-1h. Then centrifuge at 4℃, 12,000rpm for 15-20min, take the supernatant, and repeat once. The supernatant is the total active protein of the plant, and then the protein translation level is identified. The results showed that compared with the wild-type wheat Kronos, the accumulation of HSP90.2 protein in the double mutant material (hsp90.2aabb) was significantly reduced ( Figure 1 A).

[0074] 2. Disease resistance detection of double mutant material (hsp90.2aabb)

[0075] Detect the resistance of double mutant material (hsp90.2aabb) and wild-type wheat Kronos to powdery mildew and stripe rust. The specific steps are as follows:

[0076] 1. Analysis of powdery mildew resistance

[0077] Wheat seeds were placed in a culture dish for hydroponics to make them germinate uniformly, and then the germinated wheat seeds were cultured in a light incubator with a light cycle of 16h light / 8h dark and a temperature of 20℃. When the wheat seedlings grew to the one-leaf and one-heart stage, they were inoculated with the E09 subspecies of powdery mildew. When inoculation, wheat plants with good growth were first selected, and the wheat leaves inoculated with powdery mildew were sprayed with water mist, and then the wheat seedlings to be inoculated were evenly rubbed with wheat seedlings with E09 spores for powdery mildew inoculation. 72h after wheat powdery mildew inoculation, the leaves at the inoculation site were cut into 3-5cm fragments with scissors. The cut wheat leaves 72h after inoculation were fixed in a fixing solution (ethanol: acetic acid = 1:1) at room temperature for 24h. The fixing solution was poured out, and the leaves were transferred to clean water for rinsing, and then transferred to a decolorizing solution (lactic acid: glycerol: water = 1:1:1) for decolorization at room temperature for 48h. The decolorized leaves were transferred to clean water and rinsed 1-2 times, and then the leaves were placed in 0.6% Coomassie Brilliant Blue (R250) prepared in advance. The leaves were dyed for 10 seconds, and the leaves were quickly taken out and rinsed in clean water for 2-3 times. The stained leaves were fixed on a glass slide, and the spore and hyphae development was observed under a microscope, and the microcolony index (microcolony index = the percentage of spores that developed microcolonies to the total number of spores detected) was counted. Seven days after the wheat powdery mildew was inoculated, wheat plants with good disease were selected, the leaves at the inoculation site were cut off, and then scanned with a scanner. The scanned wheat leaves were used to identify the development of powdery mildew colonies, and the scanned powdery mildew area was counted using Image J software, and the powdery mildew spore biomass was counted by extracting DNA from the leaves.

[0078] The results are as follows Figure 1 The results showed that compared with the wild-type Kronos control, the powdery mildew of the double mutant material (hsp90.2aabb) was more serious, and the powdery mildew area, powdery mildew spore biomass and microcolony index were significantly increased.

[0079] 2. Stripe rust resistance analysis

[0080] Wheat seeds were placed in a culture dish for hydroponics to make them germinate uniformly, and then the germinated wheat seeds were cultured in a light incubator with a light cycle of 16h light / 8h dark and a temperature of 20℃. When the wheat seedlings grew to the one-leaf-one-heart stage, they were inoculated with stripe rust CRY32 spores. First, fresh stripe rust CRY32 spores were suspended on the surface of tap water droplets and inoculated on wheat leaves at the one-leaf-one-heart stage using a toothpick smearing method. The leaves were treated at 16℃ in the dark for 24 hours, and then continued to be cultured under the conditions of an ambient temperature of 22℃ and a light cycle of 16 hours light / 8 hours dark. Seven days after inoculation, wheat plants with good disease were selected, the leaves at the inoculation site were cut off, and then scanned with a scanner. The scanned wheat leaves were used to identify the development of stripe rust colonies, and the microcolony index was calculated based on the percentage of spores that developed microcolonies to the total number of spores detected. The specific steps of the above detection method can refer to the method in the document “Wang, S., et al. (2019). YR36 / WKS1-mediated phosphorylation of PsbO, an extrinsic member of photosystem II, inhibits photosynthesis and confers stripe rust resistance in wheat. Molecular plant 12(12): 1639-1650.”

[0081] The results are as follows Figure 2 The results showed that compared with the wild-type Kronos control, the stripe rust of the double mutant material (hsp90.2aabb) was more severe, and the microcolony index increased significantly.

[0082] In summary, the research shows that the HSP90.2 gene can improve the resistance of wheat to powdery mildew and stripe rust.

[0083] Example 2: Obtaining HSP90.2-7B Transgenic Wheat and Detecting Its Traits

[0084] 1. Obtaining HSP90.2-7B Transgenic Wheat

[0085] 1. Construction of recombinant vector pGWB18-Ubi::HSP90.2-7B

[0086] The HSP90.2-7B gene shown in sequence 1 was connected into the pDONR207 vector (invitrogen, CAT#: 12535035) using the Gateway method to obtain the recombinant vector pDONR207-HSP90.2-7B, which was sequenced and verified. Sequencing showed that the HSP90.2-7B gene did not have any point mutations.

[0087] The recombinant vector pDONR207-HSP90.2-7B, pGWB18 vector (NCBI: txid419562) and recombinase (ThermoFisher Scientific, Cat. No. 11789100) were mixed and reacted at 22°C overnight to recombinate the HSP90.2-7B gene shown in sequence 1 between attR1 (AAACAAGTTTGTACAAAAAA) and attR2 (TTTCTTGTACAAAGTGG) of the pGWB18 vector to obtain the recombinant vector pGWB18-Ubi::HSP90.2-7B. The recombinant vector pGWB18-Ubi::HSP90.2-7B expresses the heat shock protein HSP90.2-7B.

[0088] 2. Obtaining recombinant bacteria

[0089] The recombinant vector pGWB18-Ubi::HSP90.2-7B was transformed into Agrobacterium EHA105 (Weidi Biotechnology, CAT#: AC1010) to obtain the recombinant bacteria pGWB18-Ubi::HSP90.2-7B / EHA105.

[0090] 3. Obtaining HSP90.2-7B Transgenic Wheat

[0091] Wild tetraploid spring wheat Kronos with good growth status was selected as the recipient, and genetic transformation was carried out by embryo stripping method. Agrobacterium pGWB18-Ubi::HSP90.2-7B was used for infection and differentiation, and then screening was performed to obtain HSP90.2-7B-transformed wheat strains.

[0092] 4. Protein level identification

[0093] The wild-type tetraploid spring wheat Kronos and the HSP90.2-7B-transgenic wheat lines 19# and 23# were identified at the protein level.

[0094] The results are as follows Figure 3 As shown in A, the results show that: through identification, it was found that the accumulation of HSP90.2 protein in the transgenic HSP90.2-7B wheat lines (19#, 23#) was significantly higher than that in the control wild-type Kronos.

[0095] 2. Analysis of disease resistance of transgenic HSP90.2-7B wheat

[0096] T3 generation HSP90.2-7B transgenic wheat lines 19# and 23# and wild-type tetraploid spring wheat Kronos were planted in an incubator for identification of powdery mildew resistance phenotypes. The specific steps are as follows: The transgenic HSP90.2-7B wheat lines at the one-leaf-one-heart stage were inoculated with powdery mildew E09 species, and the phenotype of the wheat leaves was observed 7 days after inoculation with powdery mildew, the number of spores was counted, and DNA was extracted from the wheat leaves 7 days after inoculation, and the powdery mildew spore biomass of the leaves after inoculation with powdery mildew was counted. At the same time, RNA was extracted from the wild-type control and transgenic HSP90.2-7B wheat materials 7 days after inoculation with powdery mildew, and the transcription level was verified to verify the expression of the HSP90.2-7B gene 7 days after inoculation. The primer sequences are as follows:

[0097] Primer HSP90.2-OE-F1: 5′-GCTCTCGCTCATCATCAACAC-3′;

[0098] Primer HSP90.2-OE-R1: 5′-GTTGTGCTTGCTGGTCACAA-3′.

[0099] The results showed that compared with the wild-type Kronos control, the number of spores in the HSP90.2-7B transgenic wheat line was reduced ( Figure 3 B). By extracting DNA from wheat leaves 7 days after inoculation and counting the powdery mildew spore biomass on the leaves after inoculation, it was found that the powdery mildew spore biomass of the HSP90.2-7B transgenic wheat line (19#) was significantly lower than that of the wild-type Kronos control ( Figure 3 C). At the same time, RNA was extracted from wheat leaves 7 days after inoculation, and the expression of HSP90.2 gene in the leaves after inoculation was verified at the transcription level. It was found that the expression of HSP90.2 gene in the transgenic HSP90.2-7B wheat line (19#) was significantly higher than that in the wild-type Kronos control ( Figure 3 D) The experimental results further verified that the HSP90.2 gene can improve wheat disease resistance.

[0100] The present invention has been described in detail above. It will be apparent to those skilled in the art that the present invention may be implemented in a wide range under equivalent parameters, concentrations and conditions without departing from the spirit and scope of the present invention and without the need for unnecessary experimentation. Although the present invention provides specific embodiments, it should be understood that further improvements may be made to the present invention. In short, according to the principles of the present invention, this application intends to include any changes, uses or improvements to the present invention, including changes made by conventional techniques known in the art that depart from the scope disclosed in this application. Applications of some of the basic features may be made within the scope of the following appended claims.

Claims

1. Application of HSP90.2 protein or its related biological materials in breeding transgenic wheat with improved disease resistance: The HSP90.2 protein is HSP90.2-7B protein and / or HSP90.2-7A protein; The HSP90.2-7B protein is the protein shown in sequence 2 in the sequence list; The HSP90.2-7A protein is the protein shown in sequence 4 in the sequence list; The relevant biological material is a nucleic acid molecule encoding the HSP90.2-7B protein or the HSP90.2-7A protein, or an expression cassette, a recombinant vector or a recombinant microorganism containing the nucleic acid molecule; The disease resistance is powdery mildew resistance and / or stripe rust resistance.

2. The nucleic acid molecule according to claim 1, characterized in that: The nucleic acid molecule encoding the HSP90.2-7B protein is the DNA molecule shown in sequence 1 in the sequence list; The nucleic acid molecule encoding the HSP90.2-7A protein is the DNA molecule shown in sequence 3 in the sequence table.

3. Use of the substance that inhibits the HSP90.2 protein in claim 1 in cultivating transgenic wheat with reduced disease resistance: The disease resistance is powdery mildew resistance and / or stripe rust resistance.

4. A method for cultivating transgenic wheat with improved disease resistance, comprising the step of increasing the content of the HSP90.2 protein described in claim 1 in a recipient wheat to obtain transgenic wheat; the disease resistance of the transgenic wheat is higher than that of the recipient wheat; the disease resistance is powdery mildew resistance and / or stripe rust resistance.

5. The method according to claim 4, characterized in that: The disease resistance of the transgenic wheat is higher than that of the recipient wheat, which is specifically manifested in that the number of powdery mildew spores and / or the powdery mildew spore biomass of the transgenic wheat after inoculation with powdery mildew fungi is lower than that of the recipient wheat.

6. A method for cultivating transgenic wheat with reduced disease resistance, comprising the step of reducing the content of the HSP90.2 protein of claim 1 in a recipient plant to obtain a transgenic plant; the disease resistance of the transgenic plant is lower than that of the recipient plant; The disease resistance is powdery mildew resistance and / or stripe rust resistance.

Images