Maize kernel development regulatory gene ZmGWT1a, its encoded protein, SNP sites, functional markers and their applications
By cloning and utilizing the corn kernel development regulation gene ZmGWT1a, the problem of corn kernel development regulation is solved, and the grain size and yield are improved.
Patent Information
- Application Number
- CN202310145127.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-02-21
- Publication Date
- 2025-03-07
- Estimated Expiration
- 2043-02-21
AI Technical Summary
The existing technology is difficult to accurately regulate corn grain development, resulting in difficult to effectively increase grain size and yield.
ZmGWT1a, a key gene that affects GPI synthesis, was cloned. This gene regulates the development of corn embryos and endosperm, affects the accumulation of grain storage substances, but does not affect the normal growth and development of the plants.
Through the utilization of the ZmGWT1a gene, the weight of corn grains and the accumulation of stored substances can be significantly increased, thereby increasing corn yield.
Smart Images
Figure CN116376926B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of biological genetic engineering technology, and specifically to maize kernel development regulating genes ZmGWT1a , its encoded protein, SNP sites, functional markers and their applications. Background Art
[0002] Maize (Zea mays L.) is an important food and feed crop, playing an irreplaceable role in ensuring national food security and national economic development. As a model organism, maize is the subject of extensive biological research, including plant domestication, genome evolution, developmental physiology, epigenetics, pest resistance, hybrid vigor, quantitative genetics, and comparative genomics. In recent years, several aspects of maize biochemistry, genetics, physiology, and ecology have been fully explored, but there is still a long way to go to analyze the complete developmental regulatory network of maize.
[0003] Corn kernel size is an important component of corn yield, and kernels, as the decisive factor of corn yield, have become the focus of attention. As the main organ of corn yield, the molecular mechanism of its formation and development has received extensive attention. Although many genes that regulate corn kernel development and filling have been cloned, since the development of corn embryo and endosperm is an extremely complex biological process, the node genes and molecular mechanisms that precisely regulate kernel filling still need to be further analyzed.
[0004] On the other hand, glycosylphosphatidylinositol (GPI) modification is an important post-translational modification in eukaryotes. GPI-anchored proteins (GPI-APs) are involved in a variety of biological processes, including transmembrane signal transduction, cell surface protection, cell adhesion, and cell wall formation. Studies have shown that mutations in genes related to GPI biosynthesis, anchoring, and remodeling can lead to a variety of physiological and reproductive defects in mammals. However, the mechanism of action of genes related to GPI synthesis and regulation in plants is still unclear.
[0005] The information disclosed in this background technology section is only used to deepen the understanding of the background technology of the present disclosure, and should not be regarded as acknowledging or suggesting in any form that the information constitutes the prior art known to those skilled in the art. Summary of the invention
[0006] The present invention applies to the natural mutants of corn kernels found in the process of corn field breeding and selection. gwt1a Cloning of key genes affecting GPI synthesis ZmGWT1a , which encodes an acyltransferase in step 4 of the glycophosphatidylinositol (GPI) biosynthesis pathway. ZmGWT1aIt regulates the development of corn embryo and endosperm and affects the accumulation of grain storage substances, but does not affect the normal growth and development of the plant. It is of great value to increasing corn yield.
[0007] In the first aspect disclosed in the present application, phenotypic and cytological analysis was performed to find gwt1a The 100-grain weight of the mutant was 49.7% lower than that of the wild type, the embryo and endosperm developed abnormally, and the proliferation of cells in the basal transfer layer of the endosperm was reduced. ZmGWT1a The gene, whose CDS sequence is shown in SEQ ID NO.1.
[0008] The second aspect disclosed in the present application relates to a grain development regulating gene ZmGWT1a The encoded protein has an amino acid sequence as shown in SEQ ID NO.2.
[0009] The third aspect disclosed in the present application relates to a method for amplifying the ZmGWT1a The primer pair for the gene has sequences shown in SEQ ID NO.3 and SEQ ID NO.4.
[0010] The fourth aspect disclosed in the present application relates to a corn kernel phenotypic mutation SNP site, based on the fourth version of the corn B73 reference genome, and there is a G / A mutation at the chr9.s_121097330 position.
[0011] The fifth aspect disclosed in the present application relates to a dCAPS molecular marker for identifying phenotypic mutants, including a primer pair as shown in SEQ ID NO.5 and SEQ ID NO.6; and / or a primer pair as shown in SEQ ID NO.7 and SEQ ID NO.8.
[0012] In another aspect disclosed in the present application, the corn kernel development regulating gene ZmGWT1a , the amplification primers, the corn kernel phenotypic mutation SNP sites or the dCAPS molecular markers are used in the regulation of kernel size and / or corn embryo and endosperm developmental traits.
[0013] Another aspect disclosed in the present application is a SNP site associated with corn kernel length and 100-kernel weight, based on the fourth version of the corn B73 reference genome, with a C / T mutation at the position of chr9.s_121100040 or / and chr9.s_121100593. ZmGWT1a Among the excellent haplotypes.
[0014] Another aspect disclosed in the present application relates to a method for identifying a gene ZmGWT1aThe dCAPS molecular marker of the excellent haplotype includes the primer pairs shown as SEQ ID NO.9 and SEQ ID NO.10, SEQ ID NO.11 and SEQ ID NO.12 and / or SEQ ID NO.13 and SEQ ID NO.14.
[0015] In another aspect disclosed in the present application, the corn kernel development regulating gene ZmGWT1a , the amplification primers, the SNP sites, and the dCAPS molecular markers are used in the breeding of corn kernel size varieties / lines.
[0016] One or more technical solutions provided in the embodiments of the present application have at least the following technical effects or advantages:
[0017] 1. Positional Cloning ZmGWT1a Genes regulate the development of corn embryo and endosperm, affecting the accumulation of grain storage substances but not the normal growth and development of the plant, and are of great value in increasing corn yields.
[0018] 2. ZmGWT1a The identification of excellent haplotypes and analysis of their utilization pathways provide technical support and excellent germplasm resources for the utilization of this gene. BRIEF DESCRIPTION OF THE DRAWINGS
[0019] Figure 1 In one embodiment of this application ZmGWT1a Mutants ( gwt1a ) Grain phenotype analysis; Figure, A: Grain phenotype on separated ears; B: Comparison of wild-type and mutant grains on the same ear; C: Comparison of wild-type (WT) and mutant gwt1a Comparison of 100-grain weight; D: Comparison of longitudinal sections of wild-type and mutant grains; E: Difference in germination between wild-type and mutant grains; F: Difference in germination rate between wild-type and mutant grains; G: Comparison of aboveground parts of wild-type and mutant 10 days after sowing; H: Comparison of roots of wild-type and mutant 10 days after sowing; I: Comparison of wild-type and mutant plants at adult stage; J: Comparison of self-fertile ears of homozygous wild-type (+ / +) and mutant (- / -) plants.
[0020] Figure 2 This is a cytological analysis of wild-type and mutant grains in an embodiment of the present application; in the figure, A: comparison of paraffin sections of mutant and wild-type grains 10-18 days after pollination; B: comparison of embryos of mutant and wild-type grains 18 days after pollination; C: transmission electron microscopy observation of mutant and wild-type endosperm; D: comparison of basal transfer layers of mutant and wild-type endosperm.
[0021] Figure 3 In one embodiment of this application ZmGWT1a ( gwt1a)Gene map cloning, gene structure and function verification; In the figure, A: ZmGWT1a Positional cloning of genes; B: ZmGWT1a Schematic diagram of gene structure; C: Schematic diagram of ZmGWT1a protein structure; DE: gwt1a and ZmGWT1a Allelic validation of premature gene termination mutants.
[0022] Figure 4 This is a molecular marker diagram of dCAPS1-F1 / R1 and dCAPS1-F1 / R1 and their enzyme digestion in an embodiment of the present application; in the figure, A: gwt1a Phenotypes of mature wild-type (WT) and mutant grains; B: agarose gel electrophoresis bands of dCAPS1-F1R1 PCR products; C: agarose gel electrophoresis bands of dCAPS1-F2R2 PCR products; D: Sma After enzyme digestion with I, the electrophoretic bands in 10% nucleic acid PAGE gel.
[0023] Figure 5 This is the result of the grain length correlation analysis in one embodiment of the present application; in the figure, the top is ZmGWT1a Manhattan plot of the association analysis between SNP and grain length trait; in the middle is ZmGWT1a Schematic diagram of the gene structure; below is the LD block diagram of the SNP.
[0024] Figure 6 The haplotypes in one embodiment of the present application are molecular markers; in the figure, A: agarose gel electrophoresis band of dCAPS2-F1R1 PCR product; B: agarose gel electrophoresis band of dCAPS2-F2R2 (chr9.s_121100040) PCR product; C: agarose gel electrophoresis band of dCAPS2-F2R2 PCR product Hind The electrophoresis bands in 4% nucleic acid agarose gel after digestion with enzyme III; D: agarose gel electrophoresis bands of dCAPS2-F3R3 (chr9.s_1211005593) PCR product; E: dCAPS2-F2R2 PCR product Nde Electrophoresis bands in 4% nucleic acid agarose gel after I digestion; Note: Lanes 1 (LY042) and 2 (CIMBL98) are Hap3; Lanes 3 (CF3) and 4 (R08) are Hap2; Lanes 5 (BS16) and 6 (MN) are Hap1. DETAILED DESCRIPTION
[0025] Unless otherwise specified, the instruments and equipment involved in the following embodiments are all conventional instruments and equipment; the reagents and materials involved are all commercially available conventional products unless otherwise specified; the tests and detection methods involved (such as genomic DNA extraction, RNA extraction and reverse transcription, RT-PCR, real-time fluorescence quantitative PCR, BN-PAGE gel electrophoresis, Western blot, corn kernel paraffin sections, etc.) are all conventional methods unless otherwise specified.
[0026] Embodiment 1: gwt1a Phenotypic analysis of mutants
[0027] gwt1a Mutants (collected by Tang Jihua, 2018, Yuanyang Science and Education Park, Henan Agricultural University) are grain mutants discovered during field breeding and selection. Observation of mature wild-type and mutant grains on the same ear revealed that, compared with the wild-type, gwt1a The mutant grains became smaller, the endosperm was not fully filled, and the top was slightly collapsed, resulting in a significant decrease in the 100-grain weight of the mutant (50.3% of the wild type) (see Figure 1 AD). The mature mutant grains can germinate normally, and the mutants can grow into plants and self-fertilize after germination (see Figure 1 GJ, but its bud rate (91.6%) was lower than that of the wild type (99.6%) (see Figure 1 EF).
[0028] 10-18 days after pollination (10-18 DAP) gwt1a Paraffin sections of mutant and wild-type kernels were observed and it was found that the mutant embryo developed normally, the proliferation of cells in the endosperm basal transfer layer was reduced, and the filling of endosperm starch granules and protein bodies was reduced compared with the wild-type (see Figure 2 ).
[0029] Embodiment 2: ZmGWT1a Map-based cloning and functional verification of genes
[0030] use gwt1a F bred with the backbone inbred line Zheng 58 2 The segregating population was used as material, and the target gene was located in the physical interval of about 789 kb on the 9th chromosome of maize through genetic analysis and map-based cloning (see Figure 3 A).
[0031] The linkage markers and their sequences used in the map-based cloning process are shown in Table 1. Gene annotation and sequencing analysis within the candidate segment showed that Zm00001d047181 The gene (CDS sequence is shown in SEQ ID NO.1, and the amino acid sequence is shown in SEQ ID NO.2) is a potential candidate gene, containing 16 exons. gwt1a )middleZm00001d016902 The gene has a single base mutation from G to A at +933bp in exon 12, causing the 311th amino acid encoded by it to mutate from tryptophan to a stop codon (see Figure 3 B).
[0032] Zm00001d047181 The gene cloning method is as follows:
[0033] 1) Use the Plant Polysaccharide and Polyphenol RNA Extraction Kit to extract RNA from mutant and wild-type endosperm 10 days after pollination according to the kit instructions, fully dissolve the total RNA with RNase-free double distilled water, and use DNaseI to remove possible DNA residues.
[0034] 2) RNA quality was initially tested by agarose gel electrophoresis. The RNA concentration and the absorbance of RNA at 260 nm and 280 nm were tested by NanoDrop instrument. 260 / 280 Whether it is between 1.8 and 2.2 (28S: 18S>1.0) can determine the integrity and purity of the RNA.
[0035] 3) The obtained RNA was used as a template for reverse transcription, and the obtained cDNA was packaged and stored in a -20°C refrigerator for later use.
[0036] 4) Based on the maize B73 reference genome Zm00001d047181 Transcript sequence, design amplification primers:
[0037] F: 5' ATGGAGGGCCGCCTCTT 3' (SEQ ID No. 3);
[0038] R: 5'TCACCAGAATTTCATCCTAACACC 3' (SEQ ID No. 4).
[0039] To verify the candidate gene, we purchased the EMS mutant from the maize mutant library (http: / / elabcaas.cn / memd / ). Zm00001d047181 Premature termination mutant material ( gwt1a-2 ). Change + / gwt1a With + / gwt1a-2 The hybridization was performed and the F 1 The phenotypes and genotypes of the ears were observed and identified. The results showed that F 1 The wild-type and mutant kernels on the ear conformed to the Mendelian segregation ratio of 3:1, and only the kernels with the mutant phenotype contained both mutation sites. Zm00001d047181 is produced gwt1a The functional gene of the kernel mutant phenotype is named ZmGWT1a .
[0040] Table 1 ZmGWT1a Primers and sequences used for cloning
[0041] Primer name Sequence(5’-3’) umc2121R GTGGTGTTCTCCTTTTGATACGCT umc1519F CTCGAGACTCTGGTTCAATCCAAT umc1519R CATGCACGTACTTCCCTGATTTTT s15382F CGGCTGTCAGTAGCAGTAACTC s15382R ATCCATCCCGCAAGTCAAATCG s15405F TGGGTAATCTCTGCACGCAATC s15405R CGCCGCCAGTGACGAAATC S15449F CCCGAGTTCTCCTGCTCTACG S15449R CCTGAAGATGTCCAAGGCGTTG s15455F CACAATTCAACTTGGCACATGG s15455R AAATTCGGGCAGCAGTAGGG s15462F TCAAAACCAACTGTCCTTGTCG s15468F GGTTAGACGGCTTCACGGTTG s15468R GGGCGCGAGCAGCATATATC s15475F GCACCAACTACACGCACGAC s15475R GAAGATCATGCCAAGGGAGGTC s15487F GACAAAAGGAGTTGAGCACACC s15487R TCTAATTTCCCACCGCACATCC TRM008F CCCAAGGGAGATTTAGGTGTTG TRM008R GAGTGCCTCTAGAATAGCTGAA
[0042] .
[0043] Example 3: Corn ZmGWT1a Development of molecular markers for mutation sites
[0044] against ZmGWT1a The single base mutation of dCAPS1 was developed to be easily detected by PCR molecular markers, as follows:
[0045] gwt1a The actual position of the mutation site in the fourth version of the maize B73 reference genome is 121,097,330, and the following dCAPS primers were designed:
[0046] dCAPS1-F1: 5'GTTCTCCTGCACGTTCGATA 3' (SEQ ID No. 5);
[0047] dCAPS1-R1: 5' CGTACCATTCGACGAGAAACT 3' (SEQ ID No. 6);
[0048] dCAPS1-F2: 5' CTCCCATGGCAGGATCCCG 3' (SEQ ID No. 7);
[0049] dCAPS1-R2: 5' TGACTTGAGGTGTTCCGGTTCTTGC 3' (SEQ ID No. 8).
[0050] Among them, dCAPS1-F1R1 is the outer primer pair, which can specifically amplify ZmGWT1a Gene sequence (see Figure 4 B); dCAPS1-F2R2 was used as the inner primer pair, and the PCR product of dCAPS1-F1R1 diluted 10 times was used as the template for the second round of amplification.
[0051] against gwt1a The molecular marker detection of mutants includes the following steps:
[0052] (1) The reaction system is:
[0053] DNA template (30-50 ng / μL) 1 μL
[0054] Left primer (10μM) 0.5μL
[0055] Right primer (10μM) 0.5μL
[0056] dH 2 O 2 μL
[0057] 2×PCR Mix 5μL.
[0058] (2) The PCR amplification procedure for dCAPS1-F1R1 is as follows:
[0059] 1 cycle 95℃ pre-denaturation 3min;
[0060] 35 cycles: 95°C denaturation for 15 s, 58°C annealing for 20 s, 72°C extension for 30 s;
[0061] Delay 72℃ 5min;
[0062] Soak 25℃.
[0063] (3) The PCR amplification procedure for dCAPS1-F2R2 is as follows:
[0064] 1 cycle: 95℃ pre-denaturation for 3 min;
[0065] 35 cycles of 95°C denaturation for 15 s, 58°C annealing for 20 s, and 72°C extension for 15 s;
[0066] Delay 72℃ 5 min;
[0067] Soak 25℃.
[0068] The PCR product of dCAPS1-F2R2 was diluted 10 times and cleaved with restriction endonucleases. Sma I digestion, and then detected by 10% nucleic acid PAGE gel, the wild-type material was digested with a lower band (see Picture 4 D).
[0069] Embodiment 4: ZmGWT1a Candidate gene association analysis
[0070] To clarify ZmGWT1a The utilization pathway of the gene was to use 227 SNPs (single nucleotide polymorphism sites) (B73V4: 121087724-121104200) of the gene in 507 inbred lines as genotypes, and candidate gene association analysis was performed based on the grain phenotype, population structure (Q) and kinship (K) of the population. ZmGWT1aThe chr9.s_121092753 in the second exon of the gene, the chr9.s_121093053, chr9.s_121093298, chr9.s_121093370, chr9.s_121094277, chr9.s_121095184, chr9.s_121097032 in the intron, and the chr9.s_121100040 and chr9.s_121100593 in the 3'UTR were significantly associated with the grain length and 100-grain weight traits (p < 4.41E-03, see Picture 5 ).
[0071] Embodiment five: ZmGWT1a Excellent haplotype identification
[0072] Among the significant association loci between grain length and 100-grain weight, chr9.s_121092753, chr9.s_121093053, chr9.s_121094277, chr9.s_121095184, chr9.s_121097032 and chr9.s_121100593 were completely LD. Therefore, only chr9.s_121100593 and chr9.s_121100040 located in 3'UTR were used for haplotype analysis. Among the 444 inbred lines, there were 3 combinations with extremely significant differences in grain length ( p = 9.18E-07) (see Table 3): Hap1 (CC 2 copies), Hap2 (CT 410 copies), Hap3 (TC 32 copies). Among them, the average grain length of the superior haplotype Hap3 is 9.75 mm, and its distribution frequency in inbred lines is low (32 / 444), which is a rare haplotype and has potential for use in breeding improvement; the average grain length of the unfavorable haplotype Hap1 is 8.63 mm, and its distribution frequency in inbred lines is extremely low (2 / 444), which is a rare haplotype; the haplotype of most inbred lines is Hap2, which has a high distribution frequency (410 / 444) and a moderate grain length (see Table 2).
[0073] Table 2 Haplotype analysis
[0074] .
[0075] Embodiment six: ZmGWT1a Development of molecular markers for superior haplotypes
[0076] On the basis of clarifying the superior haplotype of grain length, a simple and easy-to-operate PCR marker dCAPS2 was developed for these two SNPs, and their actual positions in the fourth version of the maize B73 reference genome are 121, 100,040 bp and 121, 100,593 bp, respectively.
[0077] dCAPS Primers:
[0078] dCAPS2-F1: 5' GGTCGCTGCTGCATTAAAAGT 3' (SEQ ID No. 9);
[0079] dCAPS2-R1: 5'TTGCCACAGAAAAGTCAAACAGA 3' (SEQ ID No. 10);
[0080] dCAPS2-F2: 5' CTCAACTCTGAGCTGGAGCCCAAGCT 3' (SEQ ID No. 11);
[0081] dCAPS2-R2: 5'GTGACGAGCTGGTGCCGTTT 3' (SEQ ID No. 12);
[0082] dCAPS2-F3: 5' TGATAAATTTAATAATTTATTCATAT 3' (SEQ ID No. 13);
[0083] dCAPS2-R3: 5'ATTCGGGGTGCACGATCCG 3' (SEQ ID No. 14).
[0084] Among them, dCAPS2-F1R1 is an outer primer pair that can specifically amplify the genomic sequence containing two SNPs; dCAPS2-F2R2 and dCAPS2-F3R3 are inner primer pairs of chr9.s_121100040 and chr9.s_1211005593, respectively. The second round of amplification was performed using the PCR product of dCAPS2-F1R1 diluted 10 times as a template.
[0085] Molecular marker detection for excellent haplotypes includes the following steps:
[0086] (1) The reaction system is:
[0087] DNA template (30-50 ng / μL) 1 μL
[0088] Left primer (10μM) 0.5μL
[0089] Right primer (10μM) 0.5μL
[0090] dH 2 O 2 μL
[0091] 2×PCR Mix 5μL.
[0092] (2) The PCR amplification procedure for dCAPS1-F1R1 is as follows:
[0093] 1 cycle 95℃ pre-denaturation 3min;
[0094] 35 cycles: 95°C denaturation for 15 s, 58°C annealing for 20 s, 72°C extension for 30 s;
[0095] Delay 72℃ 5min;
[0096] Soak 25℃.
[0097] (3) The PCR amplification procedure for dCAPS2-F2R2 is as follows:
[0098] 1 cycle: 95℃ pre-denaturation for 3 min;
[0099] 35 cycles of 95°C denaturation for 15 s, 56°C annealing for 20 s, and 72°C extension for 15 s;
[0100] Delay 72℃ 5 min;
[0101] Soak 25℃ 。
[0102] (4) The PCR amplification procedure for dCAPS2-F3R3 is as follows:
[0103] 1 cycle: 95℃ pre-denaturation for 3 min;
[0104] 35 cycles: 95°C denaturation for 15 s, 52°C annealing for 20 s, 72°C extension for 15 s;
[0105] Delay 72℃ 5 min;
[0106] Soak 25℃.
[0107] The PCR products of dCAPS2-F2R2 and dCAPS2-F3R3 were cleaved with restriction endonucleases Hind III and Nde I digestion, and then detected by 4% nucleic acid agarose gel. Hap1 has higher and lower bands; Hap2 has both higher bands; Hap3 has both lower bands (see Picture 6 ).
[0108] Although some preferred embodiments of the present invention have been described, those skilled in the art may make other changes and modifications to these embodiments once they have learned the basic creative concept. Therefore, the appended claims are intended to be interpreted as including the preferred embodiments and all changes and modifications that fall within the scope of the present invention.
[0109] Obviously, those skilled in the art may make various changes and modifications to the present invention without departing from the spirit and scope of the present invention. Thus, if these modifications and variations to the present invention fall within the scope of the claims of the present application and their equivalents, the present invention is also intended to include these modifications and variations.
Claims
1. The maize kernel development regulating gene whose CDS sequence is shown in SEQ ID NO.1 ZmGWT1a Application in regulating corn kernel size and / or corn endosperm development traits.
2. The CDS sequence of the corn kernel development regulatory gene is shown in SEQ ID NO.1 ZmGWT1a , or the use of amplification primers shown in SEQ ID NO.3 and SEQ ID NO.4 in the breeding of corn kernel size varieties or lines.