New strain of trametes versicolor, polysaccharide extracted from the new strain of trametes versicolor and cosmetics

Abstract

The present application provides a new strain of Agaricus blazei Murill, which is Agaricus blazei Murill JSR-1 with a preservation number of CGMCC No.23250. The present application also provides Agaricus blazei Murill polysaccharide extracted from fermentation liquor of Agaricus blazei Murill JSR-1. The Agaricus blazei Murill strain with the preservation number of CGMCC No.23250 provided by the present application has a short preparation period, a high extraction rate, an easy-to-implement preparation method, and can be mass-produced. The Agaricus blazei Murill polysaccharide obtained by the method of the present application is safe and has no side effects, can obviously improve the water content of the skin, relieve skin inflammation, and has good soothing and anti-wrinkle effects.

Description

Technical Field

[0001] This invention belongs to the field of cosmetic technology, specifically relating to a new strain of Agaricus blazei, Agaricus blazei polysaccharide extracted from this strain, and cosmetics. Background Technology

[0002] Agaricus blazei Murill, also known as Brazilian mushroom, is a fungus belonging to the Basidiomycota, Agaricomycetes, Agaricales, Agaricaceae, and Agaricus genus. It is a thermophilic fungus with mycelial growth temperatures ranging from 10-33°C. Mycelial cells die at 37°C, with an optimal growth temperature of 22-27°C. Fruiting bodies develop in the range of approximately 20-33°C, with an optimal temperature of 22-25°C. It is widely distributed in the grasslands along the coast of Florida and the plains of Southern California in the United States, as well as in Brazil and Peru. Piedade, São Paulo, in southern Brazil, is a major production area.

[0003] Agaricus blazei is a valuable edible and medicinal fungus. Its crisp, delicious flesh has an almond-like flavor and is rich in nutrients. It possesses high anti-cancer activity, enhances cellular immune function, lowers blood sugar and blood pressure, reduces cholesterol, combats arteriosclerosis, improves bone hyperplasia, and has beauty and calming effects. Agaricus blazei polysaccharides extracted from it also exhibit significant anti-tumor, immunomodulatory, bone marrow hematopoietic enhancement, and antibacterial effects. Therefore, a wide variety of processed Agaricus blazei products are available. International research on Agaricus blazei polysaccharides is mainly concentrated in Japan. In my country, Agaricus blazei was initially introduced from Japan by the Fujian Academy of Agricultural Sciences in 1992. After years of development, research on it has gradually deepened. However, the market still anticipates more high-performance new strains of Agaricus blazei and its extracts and products.

[0004] The applicant of this disclosure collected and screened a strain of Agaricus blazei JSR-1 in the wild in Dali, Yunnan, and extracted Agaricus blazei polysaccharide from the mycelium of this Agaricus blazei. Compared with the general Agaricus blazei polysaccharide, this Agaricus blazei polysaccharide has a better skin barrier function, anti-inflammatory and moisturizing functions, and has a good skin care effect. Summary of the Invention

[0005] To address the above problems, this invention provides a novel strain of Agaricus blazei, Agaricus blazei polysaccharide extracted from the mycelium of the novel strain, and a cosmetic product using the Agaricus blazei polysaccharide as an active ingredient.

[0006] To solve the above-mentioned technical problems, the technical solution provided by the present invention is as follows:

[0007] In a first aspect, the present application provides a new strain of Agaricus blazei Murill, which is Agaricus blazei Murill JSR-1 and has a preservation number of CGMCC No.23250. The new strain of Agaricus blazei Murill is obtained by the following steps: collecting wild fruiting bodies of fungi from Dali City (100.2305, 25.59238) in Yunnan Province, picking tissues at the junction of the cap and stem of the fungi, and then placing the tissues on a slant medium with PDA enriched medium, and culturing the tissues in the dark at 25℃ for 5 days to obtain mycelium.

[0008] In a second aspect, the present application provides a polysaccharide of Agaricus blazei Murill, which is extracted from Agaricus blazei Murill JSR-1 and has a preparation method including the following steps: step one, inoculating Agaricus blazei Murill JSR-1 with a preservation number of CGMCC No.23250 into a potato glucose medium to perform fermentation treatment to obtain a fermentation liquid; and step two, concentrating the fermentation liquid, performing first alcohol precipitation treatment, discarding supernatant after centrifugation, adding deionized water, removing proteins by Sevage method, performing second alcohol precipitation treatment, collecting precipitate, removing impurities by dialysis, and then freeze-drying to obtain crude polysaccharide of Agaricus blazei Murill.

[0009] According to the above scheme, in step one, the fermentation temperature of the fermentation treatment is 28℃, the shaking speed is 150 rpm, and the fermentation time is 5 days.

[0010] According to the above scheme, step two specifically includes the following steps: concentrating the fermentation liquid, adding 3 times the volume of anhydrous ethanol, storing at 4℃ for a period of time, discarding supernatant after centrifugation, adding deionized water, removing proteins by Sevage method for 5 times, performing alcohol precipitation treatment and collecting precipitate, dissolving the precipitate in ultrapure water, dialyzing for 48 hours with a MW cutoff of 10 kDa, and then freeze-drying to obtain the crude polysaccharide of Agaricus blazei Murill.

[0011] According to the above scheme, the crude polysaccharide of Agaricus blazei Murill obtained in step two has a purity of 80-85 wt% (such as 81 wt%, 82 wt%, 83 wt%, 84 wt%, etc.).

[0012] As a preferred embodiment, the preparation method of the above-mentioned polysaccharide of Agaricus blazei Murill further includes step three: sequentially performing DEAE-52 cellulose column chromatography purification, dialysis, and freeze-drying treatment on the crude polysaccharide of Agaricus blazei Murill obtained in step two.

[0013] As a preferred embodiment, the above-mentioned polysaccharide of Agaricus blazei Murill includes at least one of two components, polysaccharide A1 and polysaccharide A2, which are obtained after the treatment in step three, wherein the molecular weight of A1 is 1.524×10 4 Da, and the purity is 83%; and the molecular weight of A2 is 6.463×10 4 Da, and the purity is 78.2%.

[0014] In a third aspect, the present application further provides a cosmetic product containing the above-mentioned polysaccharide of Agaricus blazei. According to the above-mentioned scheme, the mass percentage of the polysaccharide of Agaricus blazei in the cosmetic product is 0.5-5% (such as 0.8%, 1%, 2%, 3%, 4%, 4.5%, etc.).

[0015] The present application has the following beneficial effects:

[0016] 1. The present application selects the Agaricus blazei strain with the preservation number of CGMCC No.23250, extracts the polysaccharide of Agaricus blazei from the fermentation liquor, has a short preparation period (without mushroom growth), a high extraction rate, and an easy-to-implement preparation method, and can be mass-produced.

[0017] 2. The polysaccharide of Agaricus blazei obtained by the method of the present application is safe and has no side effects when used in cosmetic products, can significantly improve the water content of the skin, relieve skin inflammation problems, and has good soothing and anti-wrinkle effects.

[0018] The new strain of Agaricus blazei of the present disclosure was preserved on September 13, 2021, with the preservation number of CGMCC No.23250, and the classification name is Agaricus blazei JSR-1, also known as Agaricus blazei JSR-1. The preservation unit name is China General Microbiological Culture Collection Center (CGMCC), and the address is No. 3, Beichen West Road, Chaoyang District, Beijing, with a postcode of 100101. BRIEF DESCRIPTION OF DRAWINGS

[0019] Figure 1 The results of the in-vitro free radical scavenging capacity determination of the polysaccharide of Agaricus blazei extracted from strains No. 21-25 in Example 2 are shown in Table 1.

[0020] Figure 2 The detection results of intracellular proteins (FLG, AQP3) in the UVB damage protection experiment in Example 2 are shown in Table 2.

[0021] Figure 3 The detection results of intracellular inflammatory factors (KLK7, IL-1β, TNF-α, IL-6, IL-8) in the UVB damage protection experiment in Example 2 are shown in Table 3.

[0022] Figure 4 The detection results of intracellular inflammatory factors (KLK7, IL-1β, TNF-α, IL-6, IL-8) in the UVB damage repair experiment in Example 2 are shown in Table 4.

[0023] Figure 5 The detection results of intracellular proteins (FLG, AQP3) in the UVB damage repair experiment in Example 2 are shown in Table 5.

[0024] Figure 6The detection results of Col-1, ELN, MMP-1, and GSH-Px in the UVA repair experiment of Example 2 are shown.

[0025] Figure 7 The column chromatography results of the polysaccharide of No. 21 Tricholoma matsutake obtained in Example 3 are shown.

[0026] Figure 8 The infrared spectrum and ultraviolet spectrum of components A1 and A2 obtained in Example 3 are shown.

[0027] Figure 9 The scanning electron microscope (SEM) and atomic force microscope (AFM) images of components A1 and A2 obtained in Example 3 are shown.

[0028] Figure 10 The efficacy data of components A1 and A2 obtained in Example 3 and the No. 21 sample are shown.

[0029] Figure 11 The test results of transdermal water loss and water content in the human efficacy evaluation in Example 4 are shown.

[0030] Figures 12-13 The effective examples in the human efficacy evaluation in Example 4 are shown. DETAILED DESCRIPTION

[0031] The following examples facilitate a better understanding of the present application, but do not limit the present application. In the following examples, the experimental methods are conventional methods unless otherwise specified. In the following examples, the test materials used are commercially available from conventional biochemical reagent stores unless otherwise specified. In the following examples, the quantitative tests are set up with three repeated experiments, and the average value is taken. In the following examples, the method for detecting the content of Tricholoma matsutake polysaccharide is referred to the following literature: Wang Qian, Zhang Jiacan, Wang Changtao, et al. Effect of carbon-nitrogen ratio on active ingredients and antioxidant capacity of fungi fermented mulberry- oat bran [J]. Food Industry Science and Technology, 2018.

[0032] Example 1, Isolation, Identification and Preservation of Tricholoma matsutake JSR-1 CGMCC No. 23250

[0033] 1. Isolation of the strain: The applicant collected wild fungal fruiting bodies from Dali City (100.2305, 25.59238) in Yunnan Province, picked the tissue at the junction of the cap and stem, and then placed it on a slant medium with PDA enriched medium, and cultured at 25°C in the dark for 5 days to obtain mycelium. The mycelium was purified twice to obtain the purified strain JSR-1. The steps for each purification were as follows: the mycelium was placed on a slant medium with PDA enriched medium, and cultured at 25°C in the dark for 5 days.

[0034] 2. Morphological identification: Take the liquid mycelium to inoculate on PDA medium, cultivate at 25℃ for 3 days, the mycelial morphological characteristics are obvious, the initial mycelium is dense and radial growth, the late mycelium is concentrated into white spots with the growth of mycelium, the mycelium is white on the back. Branching, bending.

[0035] 3. Molecular phylogenetic analysis: Genomic DNA was extracted using fungal DNA extraction kit type I (centrifugal column type) product number: D301-02. ITS universal primer sequence ITS1: TCCGTAGGTGAACCTGCGG and ITS4: TCCTCCGCTTATTGATATGC were used as primers for PCR reaction. The reaction program is: 95℃ pre-denaturation for 1min, 94℃ denaturation for 30s, 55℃ annealing for 30s, 72℃ extension for 30s, a total of 30 cycles, 72℃ final extension for 5min. The obtained PCR product was sequenced, and the sequencing results showed that the rDNA-ITS sequence of JSR-1 was compared with the rDNA-ITS sequence in the NCBI database. The results showed that the ITS sequence of the measured strain (JSR-1) had 86.2% homology with the ITS sequence of Agaricus sp. (Agaricus subrufescens strain). It is named Agaricus blazei JSR-1, also known as Agaricus blazei JSR-1.

[0036] 4. Preservation of Agaricus blazei JSR-1 strain: JSR-1 has been preserved in the China General Microbiological Culture Collection Center (CGMCC) on September 13, 2021, with the preservation number CGMCC No.23250. The full name of JSR-1 is Agaricus blazei JSR-1 CGMCC No.23250.

[0037] Example 2, strain screening comparison experiment

[0038] Agaricus blazei Murrill (Agaricus blazei Murrill) 21-25 (of which 21 and 22 were collected from Dali City, Yunnan Province; 23 and 24 were ordinary Agaricus blazei Murrill strains purchased from the General Microbial Culture Collection Center, with numbers GCMCC5.485 and GCMCC5.787 respectively; 25 was from Fujian Academy of Agricultural Sciences; and 21 was strain JSR-1), which were activated on PDA plates, and single colonies were transferred to potato dextrose liquid medium for expansion culture. The culture conditions were 28°C, 150rpm for 5d, and the fermentation broth was obtained. Subsequently, after concentration and freeze-drying steps, five kinds of fermentation freeze-dried powder were obtained and numbered 21-25. The five kinds of fermentation freeze-dried powder were tested and evaluated.

[0039] I. In vitro free radical scavenging ability determination

[0040] 1. Determination of total antioxidant capacity (ABTS method). Preparation of ABTS working solution: mix 5mL of 7mmol / L ABTS aqueous solution and 88μL of 140mmol / L potassium persulfate solution, and stand overnight at room temperature in the dark to form ABTS·+stock solution. Before use, dilute with anhydrous ethanol to form a working solution with an absorbance at 734nm of 0.70±0.02. Sample determination: take 4mL of ABTS working solution, add 40μL of sample to be tested, shake accurately for 30s, and measure the absorbance at 734nm after 6min of reaction A 样品 . Calculate the clearance rate as follows: ABTS clearance rate / %=(1-A 样品 / 0.700)×100.

[0041] 2. Determine its ability to scavenge 1-diphenyl-2-trinitrobenzene hydrazine radical (DPPH·). The experimental method is referred to the literature (Wu D, Liu P P, Li M, Wang C T, Zhao D, Zhang J C. Evaluation of in vitro antioxidant and anti-aging effects of Pueraria lobata water extract and Pueraria lobata fermentation broth [J]. Food Industry Science and Technology, 2019, 40(12):285-290+294.), which is as follows: prepare a DPPH· solution with a concentration of 4mg / mL using anhydrous ethanol, add 2mL of sample to 2mL of DPPH· solution, mix well, stand for 30min, centrifuge at 3000r / min for 10min, and measure the absorbance of the supernatant at 517nm. The ability of the test substance to scavenge DPPH· can be represented by the clearance rate, and the greater the clearance rate, the stronger the scavenging ability. The formula is: clearance rate I=[I-(A i -A j ) / A0]×100%; wherein: A i -2mL DPPH· solution+2mL sample; A j- 2 mL of solvent for 2 mL of DPPH· solution + 2 mL of sample; A0-2 mL of solvent for 2 mL of DPPH· solution + 2 mL of sample.

[0042] 3. The ability to scavenge hydroxyl radicals (·OH) was determined. The experimental method was referred to the literature and slightly modified (Zhao D, Xu D, Wang D, Zhang JC, Li M, Wang C. Composition detection and whitening and anti-aging efficacy evaluation of Ganoderma lucidum fermentation broth [J]. Daily Chemical Industry, 2016, 46(04): 226-230+242.). Specifically: 1 mL of sample was added with 6 mmol / L of FeSO4 solution 1 mL, mixed, then 6 mmol / L of H2O2 solution 1 mL was added, mixed, and then placed for 10 min, 6 mmol / L of salicylic acid solution 1 mL was added, mixed, and then placed in a 37℃ water bath for 30 min, 3000 r / min centrifugation for 10 min, and the supernatant was taken to measure the absorbance at 510 nm.

[0043] The results of the free radical scavenging experiment are shown in Table 1 below and Figure 1 It can be seen that the free radical scavenging ability of the polysaccharide extracted from the 25th strain of Agaricus blazei is better.

[0044] Table 1 Free radical scavenging ability of five polysaccharides from Agaricus blazei

[0045]

[0046] II. Anti-inflammatory efficacy: UVB and UVA damage protection, and damage repair performance test

[0047] In the damage protection performance test experiment, the blank control group (Control, no sample and no UVB), the model group (Model, no sample and UVB), the sample group (Samples, sample protection before UVB damage), and the positive control group (Positive control, dipotassium glycyrrhizinate, dose 1%) were set. Well-grown HaCaT cells were selected, and the cell number was controlled at 1.5x10 6 mL -1 , 2 mL per well was laid in a 6-well plate, and then incubated in a 37℃, 5% CO2 incubator overnight. The 21-25th Agaricus blazei polysaccharide sample was added for protection for 8 h, and the HaCaT cells were irradiated with UVB (damaging dose) of 20 mJ / cm 2 . After irradiation, serum-free medium was added for culture for 24 h. The cell supernatant was collected, and the adherent cells were lysed with lysis buffer. After centrifugation, the supernatant was stored in a -20℃ refrigerator for detection of intracellular inflammatory factor expression and protein content.

[0048] In the damage repair performance test, the blank control group (Control: no UVB / UVA without sample), model group (Model: UVB / UVA without sample), sample group (Samples: UVB / UVA damage after adding sample repair), and positive control group (Positive control: dipotassium glycyrrhizinate, dosage 1%) were set. The well-grown HaCaT cells were selected, the cell number was controlled to be 1.5x10 6 mL -1 , 2mL per well was laid in a 6-well plate, and then cultured at 37℃ in a 5% CO2 incubator overnight. The UVB irradiation of HaCaT cells (first induced damage) was selected at 20mJ / cm 2 , and then the 21-25 No. Tricholoma polysaccharide sample was added for repair for 24h. The cell supernatant was collected, and the adherent cells were lysed with lysis solution. After centrifugation, the supernatant was stored in a-20℃ refrigerator for detection of intracellular inflammatory factor expression and protein content.

[0049] 1. UVB damage protection function test

[0050] KLK7, IL-1β, IL-8, TNF-α, IL-6 are inflammatory factors, and the increase in the value indicates pro-inflammatory effect, and the decrease in the value indicates anti-inflammatory effect. The intracellular inflammatory factor (KLK7, IL-1β, IL-8, TNF-α, IL-6) detection results of the UVB damage protection model are shown in Table 2 and Figure 3 , and it can be seen that the polysaccharide extracted from No. 21 and No. 25 fungi has better anti-inflammatory protection performance.

[0051] Table 2 Comparison of UVB damage protection effects of five Tricholoma polysaccharides

[0052]

[0053] Filaggrin (FLG) is an important molecule connecting keratin fibers in the stratum corneum of human skin. Under the assistance of FLG monomer connection, keratin fibers regularly aggregate to form a solid physical barrier in the outermost layer of the epidermis, which can prevent the loss of epidermal water and the invasion of external allergens. AQP3 is water channel protein 3, which is related to the transport of water molecules, and the increase in the value indicates that water molecules enter the cells, which is related to the moisturizing effect. The intracellular protein detection results of the UVB damage protection model are shown in Table 3 and Figure 2 , and it can be seen that the Tricholoma polysaccharide extracted from No. 21 fungus performs better.

[0054] Table 3 Comparison of UVB damage protection effects of five Tricholoma polysaccharides

[0055]

[0056]

[0057] 2. UVB damage repair function test

[0058] The results of intracellular inflammatory factor detection in the UVB damage repair model are shown in Table 4 and Table 5. Figure 4 It can be seen that the polysaccharide extracted from No. 21 Tricholoma matsutake has better UVB damage repair performance, and the polysaccharides extracted from No. 24 and No. 25 Tricholoma matsutake also have better UVB damage repair performance.

[0059] Table 4: Comparison of UVB damage repair effects of five Tricholoma matsutake polysaccharides

[0060]

[0061] The results of intracellular protein detection in the UVB damage repair model are shown in Table 5 and Table 6. Figure 5 It can be seen that the polysaccharides extracted from No. 21-25 Tricholoma matsutake have better performance.

[0062] Table 5: Comparison of UVB damage repair effects of five Tricholoma matsutake polysaccharides

[0063]

[0064] III. Anti-aging efficacy: UVA damage protection performance test

[0065] In the UVA damage protection performance test experiment, a blank control group (Control, no sample and no UVA), a model group (Model, no sample and UVA), a sample group (Samples, sample protection before UVA damage), and a positive control group (Positive control, vitamin C, 0.100 mg / mL) were set. Well-grown human skin fibroblasts (HSFs) were selected, and the cell number was controlled at 1.5x10 6 mL -1 , and then placed in a 6-well plate at 2 mL per well. Then, after overnight incubation in a 37℃, 5% CO2 incubator, the polysaccharide samples from No. 21-25 Tricholoma matsutake were added for protection for 8 h, and the HSFs cells were irradiated with UVA (damage dose) at 7 J / cm 2 . After irradiation, serum-free medium was added for 24 h of culture. The cell supernatant was collected, and the adherent cells were lysed with lysis solution. After centrifugation, the supernatant was stored in a -20℃ refrigerator for detection of intracellular antioxidant enzymes and protein content. The detection indexes were COL-I (collagen I, the higher the value, the better), ELN (elastin, the higher the value, the better), MMP-1 (matrix metalloproteinase 1, which acts to decompose collagen, the lower the value, the better), and GSH-Px (glutathione peroxidase, which belongs to antioxidant enzymes, the higher the value, the better).

[0066] The results of intracellular protein detection of UVA damage protection model are shown in Table 6 and Figure 6 It can be seen that the polysaccharide extracted from No. 21 Tricholoma matsutake has UVA damage protection performance.

[0067] Table 6 shows the detection results of UVA damage protection of five kinds of Tricholoma matsutake polysaccharides

[0068]

[0069] Example 3, purification of JSR-1 polysaccharide and efficacy analysis of components

[0070] According to the literature method [Liu L. Extraction, purification, structure characterization and quality control of ganoderma lucidum tea [D]. Guizhou: Guizhou Normal University, 2017: 33-47. DOI: CNKI: CDMD: 2.1017.827375], the extraction and purification of polysaccharide are as follows: mycelium freeze-dried powder → hot water extraction → centrifugal supernatant → rotary evaporation concentration → ethanol precipitation → Sevage method to remove protein → DEAE-52 chromatography → dialysis → freeze-drying (-80℃, 0.03mBar, 48h) → polysaccharide freeze-dried powder.

[0071] I. Preparation and structure identification of Tricholoma matsutake polysaccharide

[0072] (1) Fermentation: inoculate the No. 21 strain into glucose potato liquid medium, and ferment at 28℃, 150rpm for 5 days (d) to obtain fermentation broth;

[0073] (2) Extraction of Tricholoma matsutake polysaccharide: The fermentation broth prepared in step (1) was concentrated, 3 times the volume of anhydrous ethanol was added, and it was stored at 4℃ overnight. After centrifugation, the supernatant was discarded, 100ml deionized water was added, and the Sevage method was used to remove protein, and the protein removal was recorded. The precipitate was collected again by alcohol precipitation method. The obtained precipitate was dissolved in ultrapure water, dialyzed for 48h with 10kDa MW cutoff, and then freeze-dried to obtain No. 21 Tricholoma matsutake crude polysaccharide (Tricholoma matsutake polysaccharide freeze-dried powder), which was tested to have a purity of 81.15%.

[0074] (3) Purification of Tricholoma matsutake polysaccharide: DEAE-52 cellulose column chromatography was used to separate and purify No. 21 Tricholoma matsutake crude polysaccharide, which was eluted with 0, 0.1, 0.3, 0.5mol / L NaCl at a flow rate of 1.0mL / min, and the eluate was collected. The elution curve was prepared with the absorbance of each tube, the NaCl concentration and the collected eluent number as the main ordinate, the secondary ordinate and the abscissa. Figure 7Figure 2 is a DEAE-52 column chromatogram. Two distinct elution peaks can be seen on the elution curve. Finally, the eluate collected from the same elution peak was concentrated, dialyzed and lyophilized to obtain the purified components, designated as Al and A2. The purity of Al and A2 was 83% and 78.2%, respectively.

[0075] The single components Al and A2 were subjected to infrared spectrum and ultraviolet spectrum scanning (see Figure 8 ). The infrared spectrum results showed that the absorption peaks at 3399 cm -1 were O-H; the absorption peaks at 2954 cm -1 and 2991 cm -1 were C-H; the absorption peak at 1646 cm -1 was C=0; the absorption peak at 1420 cm -1 was COOH; the absorption peaks at 1261 cm -1 and 1269 cm -1 were C-O-C; and the absorption peak at 1080 cm -1 was C-O. The main functional groups of Al and A2 included carboxyl and hydroxyl groups. The ultraviolet spectrum results showed that there were no characteristic absorption peaks of nucleic acids and proteins near 260 nm and 280 nm. Al and A2 did not contain proteins and nucleic acids.

[0076] The single components Al and A2 were subjected to scanning electron microscopy (SEM) and atomic force microscopy (AFM) characterization (see Figure 9 ). Under 100, 50, 5x scanning electron microscopy, the microstructure of Al and A2 was observed to be irregular flaky / reticular, with a smooth and delicate surface, and the microstructure of A2 was porous and loose. It was speculated that Al and A2 had good water retention and rheological properties. The atomic force planar graph showed that the surface of Al and A2 was relatively rough, and the roughness of A2 was higher than that of Al, indicating that the biological activity of A2 was higher than that of Al; the three-dimensional stereogram showed that the three-dimensional structure characterization of Al presented dense valley pile, and the three-dimensional structure characterization of A2 presented high spikes and irregular protrusions. The polysaccharide chain thickness of Al was -1.2-2.3 nm, and the polysaccharide chain thickness of A2 was -2.7-4.2 nm, which was greater than the thickness of single-chain polysaccharide molecules (0.1-1.0 nm).

[0077] The molecular weight distribution of the single components Al and A2 was determined by GPC. See Table 7. The molecular weight of Al was 1.524 x 10 4 Da; and the molecular weight of A2 was 6.463 x 10 4 Da.

[0078] Table 7 Molecular weight distribution results of Al and A2 components

[0079]

[0080] The monosaccharide composition was determined by HPLC-derivation method. The monosaccharide composition of A1 and A2 is shown in Table 8 and Table 9. Glucose, galactose and arabinose were found in both components, with glucose and galactose as the main monosaccharides. In addition, mannose and rhamnose were also found in A1.

[0081] Table 8 Monosaccharide composition of A1 component

[0082]

[0083]

[0084] Table 9 Monosaccharide composition of A2 component

[0085]

[0086] II. UVA protection test of A1 and A2 components of polysaccharides from Ganoderma lucidum on photoaging cells

[0087] In the experiment of damage protection performance test, the following groups were set: blank control group (Control, without sample and UVA), model group (Model, without sample but with UVA), sample group (21 / A1 / A2, polysaccharides from Ganoderma lucidum No. 21 / A1 / A2, all at a concentration of 500 μg / mL, sample protection first and then UVA damage), and positive control group (Positive control, vitamin C, 0.100 mg / mL).

[0088] Human skin fibroblasts (HSFs) were selected for good growth, and the cell number was controlled at 1.5 x 10 6 mL -1 , and then placed in a 6-well plate at 2 mL per well. After overnight incubation at 37°C in a 5% CO2 incubator, the sample was added for protection for 8 h. Then, the HSFs cells were irradiated with UVA at 7 mJ / cm 2 (the damage dose), and after irradiation, the cells were cultured in serum-free medium for 24 h. The cell supernatant was collected and the adherent cells were lysed with lysis solution. After centrifugation, the supernatant was stored in a -20°C refrigerator for detection of various indicators. The indicators detected were COL-I (collagen I, the higher the value, the better), GSH-Px (antioxidant enzyme, the higher the value, the better), MDA (malondialdehyde, a lipid peroxidation product, the lower the value, the better), MMP-1 (matrix metalloproteinase, which degrades collagen, the lower the value, the better), and ELN (elastin, the higher the value, the better). The test method is described in the kit instruction manual.

[0089] The results are shown in Figure 10 . From Figure 10As shown in each index, No. 21 and its components A1 and A2 can significantly increase the levels of COL-I, ELN and GSH-Px, and can significantly inhibit the accumulation of MDA. Among them, the promoting effect of A1 component on COL-I, ELN and GSH-Px is significantly higher than that of No. 21, and in terms of MDA and MMP-1, A1 component has a significant inhibitory effect compared with No. 21; the A2 component is only significantly higher than No. 21 in COL-I, and has no significant difference with No. 21 in other indicators.

[0090] Example 4: Human efficacy evaluation of freeze-dried powder of Agaricus blazei (Agaricus blazei) polysaccharides

[0091] In this example, the Agaricus blazei extract solution is a 5wt% solution prepared from Agaricus blazei extract (10:1), the Agaricus blazei extract (10:1) is purchased from Xi'an Anao Biotechnology Co., Ltd.; the Agaricus blazei polysaccharide solution is a 5wt% solution prepared from the freeze-dried powder of Agaricus blazei polysaccharides prepared in Example 3; and the 0.1% sodium hyaluronate solution is used as a positive control.

[0092] The test requirements are as follows: Test environment: temperature 22±1℃; humidity 50%-60%. Test area: skin moisture content test, skin moisture loss test: left and right forearms. Test time points: skin moisture content test, skin moisture loss test: before use, 5min, 20min and 60min after use. Volunteer selection: according to the Helsinki Declaration, the selection of volunteers follows the medical and ethical standards of human tests, and all volunteers must voluntarily participate in the test and sign an informed consent form before the test. Before signing the informed consent form, the test personnel need to inform the volunteers of the purpose of the test, the possible benefits, potential risks and problems, and the relevant rights and obligations. The inclusion criteria: volunteers who meet all the following conditions will be included: 1) volunteers aged 18-50 years old, male and female; 2) volunteers in good health at the time of the test; 3) no other reasons considered unsuitable for the test by the clinician; 4) volunteers who voluntarily participate and sign the informed consent form; 5) volunteers who can complete the specified content according to the test scheme. Exclusion criteria: anyone who meets any of the following criteria will be excluded: 1) those with serious systemic diseases, immune deficiency or autoimmune diseases; 2) those with allergic diseases or those who have had cosmetic allergies in the past 1-2 years; 3) women who plan to become pregnant or are pregnant or lactating, or within six months after delivery; 4) those who are allergic to skin care products or topical drugs; 5) those who have used tretinoin locally or systemically on the test site within the past 8 weeks; 6) those who have used antibiotics, steroids or other drugs locally or systemically on the test site within the past 4 weeks; 7) those who have participated in other tests on the test site within the past three months; 8) those with dermatological diseases or those receiving drug treatment on the test area.

[0093] The test method is as follows: 1) 30 qualified volunteers participate in the test. The test site has no direct light, no wind, room temperature 22-24℃, humidity 40%-60%. Before testing, wash both forearms with facial cleanser, rest for 30 min, mark 6 normal skin areas (3.5x3.5 cm) on the inner side of both forearms with a marker pen (6 test areas on both hands), and mark with numbers. Use the MPA580 CM825 probe of the German CK Company multi-probe skin test system and the Vapometer skin moisture loss tester to measure the skin moisture content and skin moisture loss of the 6 parts before use. 2) Cut the film into 3x3 cm size, respectively, and paste it on the corresponding marked part of the forearm, take it off after 15 min, gently wipe the remaining essence on the test site with a cotton pad, and start timing. 3) Measure the water content and TEWL value of the stratum corneum at 5 min, 20 min, and 60 min, respectively. Each part is measured 3 times to take the average value.

[0094] Table 10 Change of TEWL with time

[0095]

[0096] Table 11 Change of water content with time

[0097]

[0098] Tables 10, 11 and Figure 11 are the trends of transdermal water loss TEWL and water content of the three samples with time. Statistical analysis shows that all three samples have a moisturizing effect (5 min, 20 min, and 60 min after use) significantly increasing the water content of the skin, and have no significant change in TEWL value.

[0099] Calculate the difference between each index at each time point and the background, and perform statistical analysis and comparison between samples. As shown in Table 12, the polysaccharide solution of Armillaria mellea has no significant difference in TEWL compared with the Armillaria mellea extract solution; the polysaccharide solution of Armillaria mellea has no significant difference in TEWL compared with the 0.1% sodium hyaluronate solution.

[0100] As shown in Table 13, the polysaccharide solution of Armillaria mellea is significantly higher than the Armillaria mellea extract solution in terms of water content; the polysaccharide solution of Armillaria mellea has no significant difference in water content compared with the 0.1% sodium hyaluronate solution.

[0101] Table 12 Statistical analysis of TEWL value (comparison between samples)

[0102]

[0103] Statistical analysis of water content (comparison between samples)

[0104]

[0105] Example 5, Safety test of polysaccharide solution of Tricholoma matsutake

[0106] The polysaccharide solution of Tricholoma matsutake was a solution with a concentration of 5wt% prepared from the Tricholoma matsutake polysaccharide lyophilized powder prepared in Example 3.

[0107] The skin occlusive patch test was carried out in accordance with the "Cosmetic Safety Technology Standard (2015 Edition)". The skin reactions were observed according to the standard in Table 14. The observation results were recorded. Table 15 is the results of the human occlusive patch test. Through the test of 30 volunteers, it was found that both samples did not have positive reactions, indicating that the samples were relatively safe.

[0108] Table 14 Grading standard for skin reactions in skin occlusive patch test

[0109]

[0110] Table 15 Results of skin occlusive patch test

[0111]

[0112] Example 6, Soothing efficacy test of Tricholoma matsutake polysaccharide toner

[0113] The polysaccharide solution of Tricholoma matsutake was a solution with a concentration of 5wt% prepared from the Tricholoma matsutake polysaccharide lyophilized powder prepared in Example 3.

[0114] Test environment: temperature: 22±1℃; humidity: 50%-60%. Test area: both sides of the nasolabial sulcus. Test time points: 0min, 0.5min, 2.5min, 5min, 10min, 15min. The test method is as follows:

[0115] 1. Lactic acid stinging screening test: 50μL of 10% lactic acid solution was dropped on a filter paper with a diameter of 8mm and placed in the bilateral nasolabial sulcus area of the subject. Within 30s, 2.5min and 5min after application, the subject evaluated the itching, stinging, burning pain and discomfort of the test site. The subject scored the burning pain, stinging, itching and other discomfort according to the evaluation standard of 0-3 points, and scored according to the 4-point method (0 points for no feeling, 1 point for mild, 2 points for moderate, and 3 points for severe, Table 16). The sum of the stinging scores of both sides of the nasolabial sulcus area at 2.5min and 5min was ≥3 points, which was lactic acid stinging positive. The volunteers with sensitive skin were screened by lactic acid stinging test. Table 16 is a reference scoring table.

[0116] 2. Lactic acid sting test: The subjects who met the inclusion criteria visited 7 days after the screening was qualified, washed the nasolabial groove site, waited for 15 min, and applied filter paper soaked with 10% lactic acid solution to both sides of the nasolabial groove of the volunteer at the same time. When the volunteer felt burning pain, or stinging, or itching sensation on both sides of the nasolabial groove with a score of ≥2, the filter paper was removed, and the test sample was applied by the tester to one of the test areas at a dosage of 50 μL, and the other side was not treated (blank). The subjective evaluation of the burning pain, stinging, and itching sensation scores on both sides of the nasolabial groove was performed by the volunteer before the sample was used (stimulation endpoint) and 0 min (immediately after the sample was used), 0.5 min, 2.5 min, 5 min, 10 min, and 15 min after the sample was used. By comparison with the blank, the immediate soothing effect of the test sample on the skin irritation caused by lactic acid was evaluated.

[0117] Table 16 Score Table

[0118]

[0119] Table 17 Score Criteria

[0120]

[0121]

[0122] The results are as follows:

[0123] The burning pain was scored, and the statistical analysis results are shown in Table 18. The lactic acid stimulation endpoint of the sample side and the blank side was 1.80 and 1.70, respectively, and there was no significant difference between the sample group and the blank group (p = 0.75); from the time point, the burning pain score immediately after the sample was used was extremely significantly lower than the lactic acid stimulation endpoint, and the burning pain score was extremely significantly lower as the time after the sample was applied was prolonged; the burning pain score of the blank group until 10 min after the control (water) was applied was significantly different from the lactic acid stimulation endpoint score. From the comparison between the sample group and the blank group, the sample group score from 0 min to 15 min after the sample was applied was extremely significantly lower than that of the blank group.

[0124] The stinging sensation was scored, and the statistical analysis results are shown in Table 19. The lactic acid stimulation endpoint of the sample side and the blank side was 2.35 and 2.40, respectively, and there was no significant difference between the two samples (p = 0.77); from the time point, the stinging pain score immediately after the sample was used was extremely significantly lower than the lactic acid stimulation endpoint, and the stinging pain score was extremely significantly lower as the time after the sample was applied was prolonged; the stinging pain score of the blank group until 5 min after the control (water) was applied was significantly different from the lactic acid stimulation endpoint. From the comparison between the sample group and the blank group, the sample group score from 0 min to 15 min after the sample was applied was extremely significantly lower than that of the blank group.

[0125] The scores of the itching were analyzed statistically, and the results are shown in Table 20. The lactic acid irritation end point of the sample side and the blank side was 2.30 and 2.30, respectively, and there was no significant difference between the sample group and the blank group (p = 1.00); from the analysis of the time points, the itching score immediately after the sample was used was significantly lower than the lactic acid irritation end point, and the itching score was significantly reduced as the time after the sample was applied was prolonged; the itching score of the blank group until 15 min after the control (water) was applied had a significant difference from the lactic acid irritation end point. From the comparison between the sample group and the blank group, the itching scores immediately after the sample was used and until 15 min after the sample was used were significantly different.

[0126] Table 18: Scores of the burning sensation

[0127]

[0128] Table 19: Scores of the stinging sensation

[0129]

[0130]

[0131] Table 20: Scores of the itching

[0132]

[0133] Compared with the lactic acid irritation end point, the sample of the polysaccharide solution of Armillaria luteovirens could significantly reduce the scores of the burning sensation, the stinging sensation, and the itching of the volunteers immediately after the sample was applied and at the subsequent time points; compared with the blank, the polysaccharide solution of Armillaria luteovirens had a more significant reduction in the scores of the burning sensation, the stinging sensation, and the itching caused by lactic acid irritation of the volunteers immediately after the sample was applied and at each time point until 15 min after the sample was applied; in summary, the sample of the polysaccharide solution of Armillaria luteovirens had a soothing effect.

[0134] Example 7: Test of the improvement of the red area effect of the polysaccharide solution of Armillaria luteovirens

[0135] 1. Test environment: temperature 22±2℃; humidity 40%-60%. 2. Test number: 30 people, sensitive skin. 3. Experimental instrument: facial image analysis system (Visia CR). 4. Test area: full face. 5. Test index: red area map analysis, questionnaire (repairing and soothing). 6. Test sample usage: use twice a day, and do not use other similar anti-inflammatory soothing products during the test period. Test time points: test for 4 weeks, test before use, 14 days and 28 days after use. At each follow-up, the subjects clean their faces for 30 minutes, and then use Visia CR to collect facial images for comparison and observation of the improvement of facial skin. 7. Results - red area a value analysis: according to the results in Table 21, a total of 30 people participated in the test, of which 28 were effective. Two people withdrew for special reasons. After 14 days of use, the number of people with reduced a value was 22, and the effective person percentage was 79%; after 28 days of use, the number of people with reduced a value was 24, and the effective person percentage was 86%. See Figures 12-13 , the selected area is the site with more significant changes Figures 12-13 .

[0136] Table 21 Red area a value analysis

[0137]

[0138] Note: *, special circumstances to exit the test.

[0139] 8. Questionnaire results: score the skin relief, the higher the score, the more recognition. From Table 22 and Table 23, it can be seen that the average score of the recognition degree of the skin state relief after using the sample for 14 days (D14) is between 4.90-5.63; the average score of the recognition degree of the skin state relief after using the sample for 28 days (D28) is between 5.27-5.70, and the average score is higher than that of 14 days.

[0140] Table 22 Skin state score

[0141]

[0142] Note: score note

[0143] 0 points No sensation at all 1 point Slight sensation, can feel it but not most of the time 2 points Moderate sensation, can feel it most of the time but can tolerate it 3 points Severe sensation, cannot tolerate it

[0144] Table 23 Skin state relief

[0145]

[0146] Note: score note

[0147] 1 point 2 points 3 points 4 points 5 points 6 points Very much disagree Somewhat disagree Mostly disagree Mostly agree Somewhat agree Very much agree

[0148] Although the present disclosure has been disclosed by the description of specific embodiments thereof, it is understood that modifications, improvements or equivalents thereof can be designed by those skilled in the art within the spirit and scope of the appended claims. Such modifications, improvements or equivalents are also intended to be included within the scope of the present disclosure.

Claims

1. A new strain of Agaricus blazei Murill, which is Agaricus blazei Murill JSR-1 and has a preservation number of CGMCC No.23250.

2. A freeze-dried powder of Agaricus blazei ferment, characterized in that, The preparation method comprises: activating the Agaricus blazei Murill JSR-1 strain of claim 1, transferring a single colony to a potato dextrose liquid medium for expansion culture, and culturing at 28℃ and 150rpm for 5d to obtain a fermentation broth, and then performing concentration and freeze-drying steps to obtain a fermentation product freeze-dried powder.

3. A polysaccharide of Agaricus blazei, characterized in that, The preparation method comprises: Step one, inoculating the Agaricus blazei Murill JSR-1 of claim 1 in a potato dextrose medium for fermentation treatment to obtain a fermentation broth; Step two, performing concentration on the fermentation broth, then performing first alcohol precipitation treatment, discarding the supernatant after centrifugation, adding deionized water to remove proteins by Sevage method, then performing second alcohol precipitation treatment, collecting the precipitate, removing impurities by dialysis, and then freeze-drying to obtain Agaricus blazei Murill crude polysaccharide.

4. The Agaricus bisporus polysaccharide according to claim 3, characterized in that, In step one, the fermentation temperature of the fermentation treatment is 28℃, the shaking speed is 150rpm, and the fermentation time is 5d.

5. The Agaricus bisporus polysaccharide according to claim 3 or 4, characterized in that, Step two specifically comprises: concentrating the fermentation broth, adding 3 times the volume of anhydrous ethanol, storing at 4℃ for a period of time, discarding the supernatant after centrifugation, adding deionized water, removing proteins by Sevage method for 5 times, performing alcohol precipitation treatment and collecting the precipitate, dissolving the precipitate in ultrapure water, dialyzing for 48h with a 10kDa MW cutoff, and then freeze-drying to obtain the Agaricus blazei Murill crude polysaccharide.

6. The Agaricus bisporus polysaccharide according to claim 5, characterized in that, The Agaricus blazei Murill crude polysaccharide obtained in step two has a purity of 80-85wt%.

7. A cosmetic product, characterized by, The cosmetic ingredient contains the Agaricus blazei Murill polysaccharide as claimed in any one of claims 3-6.

8. The cosmetic product according to claim 7, characterized in that, The mass percentage content of the Agaricus blazei Murill polysaccharide in the cosmetic ingredient is 0.5-5%.

Images