A RAA-PfAgo detection primer for PEDV and its application

Abstract

The present invention discloses a RAA-PfAgo detection primer for PEDV and an application thereof, and relates to the field of biotechnology. The technical key points are as follows: the scheme of the present invention provides a RAA-PfAgo detection primer for PEDV, a set of gDNAs and a probe, which constitute a RAA-PfAgo detection system, which is a method for detecting PEDV using RAA and PfAgo. The method can detect 100 copies of PEDV without cross-reaction with other pathogens. The entire reaction of RAA and PfAgo to detect PEDV does not require complex instruments, and the reaction results can be observed with the naked eye. In the method of the present invention, the integrated RAA-PfAgo cleavage analysis is a practical tool for accurate and rapid detection of PEDV.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to a RAA-PfAgo detection primer for PEDV and an application thereof. Background Art

[0002] Diarrhea in the global swine industry is most commonly caused by PEDV, an enveloped virus belonging to the Coronaviridae family and the Alphacoronavirus genus. PEDV infects pigs of all ages, causing vomiting, acute watery diarrhea, dehydration, and weight loss. Piglet mortality reaches 100%. Since PED was discovered in the United Kingdom in 1971, it has spread to many countries, including the United States, Europe, and China, causing significant economic losses to the swine industry. However, PEDV is frequently co-infected with other coronaviruses in pig farms, including porcine deltacoronavirus (PDCoV) and transmissible gastroenteritis virus (TGEV), which may cause similar clinical symptoms and make differential diagnosis challenging. Therefore, there is an urgent need to develop new, simple and effective methods for detecting PEDV.

[0003] At present, many technologies for detecting PEDV have been reported, including conventional virus isolation, enzyme-linked immunosorbent (ELISA), and molecular biology techniques. However, these technologies have certain limitations, such as the need for professional personnel or expensive, complex equipment, and are time-consuming and prone to high false positive rates. The current Cas12a-based PEDV detection method is rapid, specific, sensitive, and reliable; these properties will be crucial to the future development of POC molecular diagnostic technologies for viral infectious diseases. However, the CRISPR system also has some limitations. First, Cas proteins can only function at room temperature and lose their activity at high temperatures, thus affecting the cutting activity. Cas proteins require a gRNA guide to cut the target nucleic acid; however, RNA is easily degraded, which makes storage and transportation difficult. In addition, the synthesis of gRNA is quite expensive.

[0004] In recent years, PfAgo-based detection methods such as PCR combined with PfAgo, LAMP combined with PfAgo, and RPA combined with PfAgo have gradually emerged. This study focuses on RAA because PCR requires complex instruments and a long time, and LAMP is quite challenging in terms of primer construction. In addition, it has been reported that RAA and PfAgo were used to detect the new coronavirus. Although the specificity and sensitivity of this technology are very good, the additional challenges of performing PfAgo reactions after RAA amplification and purification of the amplification product make it prone to aerosol contamination.

[0005] To this end, the present invention aims to provide a RAA-PfAgo detection primer for PEDV and its application to solve the above problems. Summary of the invention

[0006] The purpose of the present invention is to solve the above problems and provide a RAA-PfAgo detection primer for PEDV and its application.

[0007] In order to achieve the above object, the technical solution of the present invention is as follows:

[0008] The present invention provides a RAA-PfAgo detection primer for PEDV, wherein the RAA-PfAgo detection primer is a pair of RAA primers, and the primer sequences are respectively:

[0009] PEDV-RAA2F: gggttaactaatgacaaacccctttctaagg and

[0010] PEDV-RAA2R: 5′-gcaacccagaaaacaccctcagtacgagtc-3′.

[0011] The present invention also provides a group of gDNAs for cutting the double-stranded DNA of the above-mentioned RAA product, and the sequence of the gDNAs is:

[0012] gDNA-1: 5′-cgcatgcgccagcgaa-3′,

[0013] gDNA-2: 5′-aattcgctcaccacgg-3′ and

[0014] gDNA-3: 5′-caaattcgctggcgca-3′.

[0015] Furthermore, the gDNAs cleave the double-stranded DNA of the RAA product to obtain single-stranded DNA for cleavage of the probe.

[0016] Furthermore, the sequence of the probe is: 5′6-FAM-tccacggcgcatgcgccttt-BHQ1-3′.

[0017] The present invention also provides a RAA-PfAgo detection system for PEDV, wherein the RAA-PfAgo detection system comprises RAA primer products, PfAgo, a probe, a group of gDNAs and Mncl2.

[0018] The present invention also provides a detection method for the RAA-PfAgo detection system, wherein the extracted viral RNA is reverse transcribed, the cDNA obtained is amplified by RAA at 39° C. for 30 minutes, the RAA product is mixed with PfAgo, reacted at 95° C. for 30 minutes, and the result is observed under blue light.

[0019] The difficulty and significance of the technical problem solved by the solution of the present invention are:

[0020] Compared with CRISPR, PfAgo only requires a short piece of gDNA to cut the target sequence, and because PfAgo is resistant to high temperatures, it is more suitable for on-site detection. In this paper, a visual detection method for PEDV was developed using RAA and PfAgo. To minimize the possibility of false negatives, we developed primers and gDNAs based on the conserved PEDVN gene. In addition, the efficiency and specificity of RAA amplification were improved by optimizing the amplification conditions. To reduce the complexity of the operation and reduce contamination, after RAA reaction at 39°C for 30 minutes, the RAA product was directly transferred to the PfAgo system without purification and then heated at 95°C for 30 minutes. The reaction results were checked by exposing the product to blue light. Since only heating and blue light equipment are required, the simplicity and versatility of this detection method are greatly enhanced. To facilitate the observation of the results, the RAA-PfAgo reaction was combined with LFD, and the specificity, sensitivity, and practicality of the developed method were evaluated. According to the results, both RAA-PfAgo and RAA-PfAgoLFD were able to detect 100 copies of viral nucleic acid without cross-reaction with other organisms. The reliability of the method was then evaluated using clinical samples and found to be consistent with the results of the PCR method.

[0021] Compared with the prior art, this solution has the following beneficial effects:

[0022] 1. The scheme of the present invention designs primers and gDNAs based on the conserved PEDVN gene; in addition, the efficiency and specificity of RAA amplification are improved by optimizing the amplification conditions. In order to reduce the complexity of the operation and reduce contamination, after reacting RAA at 39°C for 30 minutes, the RAA product is directly transferred to the PfAgo system without purification and then heated at 95°C for 30 minutes. The reaction results are checked by exposing the product to blue light. Since only heating and blue light equipment are required, the simplicity and versatility of this detection method are greatly enhanced.

[0023] 2. The detection method of the RAA-PfAgo detection system provided by the present invention does not require complicated instruments and equipment, and the results can be observed with the naked eye in a relatively short time; the method is simple to operate and does not require professional personnel; and the main components of the method are easy to preserve and have low cost. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 It is the PfAgo assay in the embodiment of the present invention;

[0025] Figure 2 This is the result of PfAgo purification in the embodiment of the present invention;

[0026] Figure 3 It is an optimization of the RAA determination in the embodiment of the present invention;

[0027] Figure 4 is to establish the RAA-PfAgo assay in the examples of the present invention;

[0028] Figure 5 It is to establish RAAPfAgoLFD in the embodiment of the present invention. DETAILED DESCRIPTION

[0029] In order to enable those skilled in the art to better understand the solution of the present invention, the technical solution of the present invention will be further described in detail below in conjunction with the embodiments of the present invention and the accompanying drawings. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work should fall within the scope of protection of the present invention.

[0030] It should be noted that, in the absence of conflict, the embodiments and features in the embodiments of the present invention can be combined with each other. The present invention will be described in detail below in conjunction with the embodiments.

[0031] Glossary: ​​RAA: recombinase polymerase amplification technique; PfAgo: a typical DNA-guided nuclease in archaea pAgos.

[0032] Example:

[0033] The solution provided by the embodiment of the present invention is as described in the above invention content, providing a RAA-PfAgo detection primer for PEDV, a set of gDNAs for cutting double-stranded DNA of RAA products, a probe (5′6-FAM-tccacggcgcatgcgccttt-BHQ1-3′), a RAA-PfAgo detection system for PEDV and a detection method thereof.

[0034] The following is a specific experiment of the embodiment of the present invention:

[0035] 1. Methods

[0036] 1.1 Preparation of genomic DNA samples

[0037] DNA or cDNA of porcine epidemic diarrhea virus (PEDV), transmissible gastroenteritis virus (TGEV), pseudorabies virus (PRV), porcine circovirus type 2 (PCV2), porcine circovirus type 3 (PCV3), and porcine deltacoronavirus (PDCoV) were isolated and stored. The PEDVN gene fragment was amplified and cloned into the pMD19-T plasmid, and the DNA concentration was measured using a Nanodrop2000 spectrophotometer (Thermo Fisher Scientific) after storage at -20°C.

[0038] 1.2 Oligonucleotide primers for amplification, gDNA and probe preparation

[0039] A pair of RAA primers were designed with reference to the conserved region of the PEDV N gene. The primer sequences were PEDV-RAA2Fgggttactaatgacaaacccctttctaagg and PEDV-RAA2R 5′-gcaacccagaaaacaccctcagtacgagtc-3′. A set of conservative gDNAs were also designed to cut the double-stranded DNA of the RAA product. The gDNA sequences were gDNA-1 5′-cgcatgcgccagcgaa-3′, gDNA-2 5′-aattcgctcaccacgg-3′ and gDNA-3 5′-caaattcgctggcgca-3′. The cut single-stranded DNA was used to cut the probe (5′6-FAM-tccacggcgcatgcgccttt-BHQ1-3′). Primers, gDNA and probes were synthesized by Sangon Biotech (Table 1).

[0040] 1.3 Expression and purification of PfAgo

[0041] pET28a-His-PfAgo was chemically synthesized by Sangon Biotech (Shanghai) and transformed into Rosetta (DE3) competent cells (Millipore, Burlington, MA, USA). The overnight culture (10 mL) was added to 400 mL LB broth (containing kanamycin, 50 μg / ml) and grown at 37°C to an OD600 of 0.6. Isopropyl-β-d-1-thiogalactopyranoside (IPTG, 1 Mm) was added to the culture medium and induced at 16°C and 180 rpm for 20 hours. After centrifugation at 15000g for 20 minutes at 4°C, the supernatant protein was purified using a His-tag protein purification kit (Sangon Biotech). The purified target protein was concentrated using an ultrafiltration column (50 KD), and the total protein was determined by the BCA method and stored at -80°C.

[0042] 1.4 RPA response

[0043] RAA reactions were performed using a RAA reaction mixture (Hangzhou Zhongce Biotechnology Co., Ltd.) containing primer RAA-F (10 μM, 2 μl), primer RAA-R (10 μM, 2 μl), buffer A (25 μl), ultrapure water (13.5 μl) and buffer B (2.5 μl, template DNA or cDNA (5 μl). The temperature of the RAA reaction was maintained at 37 °C in a PTC-200 thermal cycler (MJ Research, USA) for 30 min.

[0044] 1.5 PfAgo reaction

[0045] PfAgo reaction system (20 μl), including 2 μM PfAgo, 0.25 μM MgDNA, 0.5 μM probe, 0.5 mM MnCl2 and 10 μl RAA product. The test tube was placed in a PTC-200 thermal cycler at 95°C for 30 minutes, and the fluorescence signal after PfAgo-mediated cleavage reaction was observed under blue light.

[0046] 1.6 Evaluation of the RAA-PfAgo Detection System

[0047] The use range is 1×10 4 Up to 1×10 1 The analytical sensitivity of the RAA-PfAgo detection system was determined by measuring the amount of pMD19-PEDV-NDNA copies / μl, and the RAA-PfAgo sensitivity and specificity reactions were performed by a PTC-200 thermal cycler or CFX96Touch real-time PCR detection system at 95 °C for 30 min, and the results were observed under blue light.

[0048] 1.7 RAA-PfAgo-LFD reaction

[0049] RAA-PfAgo-LFD reaction system (20 μl), including 2 μM PfAgo, 0.25 μM MgDNA, 125 nM probe, 0.5 mM MnCl2 and 10 μl RAA product. Place the test tube in a PTC-200 thermal cycler at 95 °C for 30 minutes. After the RAA-PfAgo reaction, add 30 μl ultrapure water to the reaction tube, mix well, insert the test strip into the reaction tube, and observe the results after 5 minutes.

[0050] 1.8 Identification of PEDV in clinical samples

[0051] Neonatal piglets with diarrhea were collected from seven farms in Sichuan, China, generating a total of 53 clinical samples (including feces and intestinal samples). Total RNA was extracted from these samples and then reverse transcribed into cDNA as a template in the RAA-PfAgo / RAA-PfAgoLFD assay.

[0052] 2 Results

[0053] 2.1 Principle of RAAPfAgo

[0054] The RNA of the virus is extracted and reverse transcribed into cDNA. A large number of target fragments are obtained by amplifying cDNA with RAA. By using gDNA as a guide, PfAgo can specifically cut the amplified fragment chain complementary to the gDNA sequence (first cut) and release 16bp of new gDNA. The new gDNA fragment with 5′-phosphorylation (g') can bind to the empty PfAgo protein to cut the gDNA complementary molecular probe ( Figure 1 a) In order to obtain more conservative primers and gDNA, a pair of RAA primers, a set of gDNA and a target probe were designed based on the conserved sites of the PEDVN gene; the locations of these sequences are as follows Figure 1 As shown in b.

[0055] 2.2 Expression and purification results of PfAgo

[0056] PfAgo protein expression was induced by 1 mM IPTG at 16 °C for 20 h. The pellet was resuspended after harvesting, then lysed and finally concentrated. The expressed PfAgo was mainly dissolved in the supernatant and eluted by elution buffer ( Figure 2 ).

[0057] 2.3 RAA reaction optimization results

[0058] Use ddH2O and 1×10 5 pMD19-PEDV-NDNA with 100 copies / μl was used as RAA template. After 30 minutes of RAA reaction at 37°C, a band of a specific size was found in PEDV positive DNA, but not in negative control ( Figure 3 a), demonstrating the effectiveness of the RAA primers (RAA-F / R). To optimize the RAA reaction conditions, 1×10 5 pMD19-PEDV-NDNA was used as RAA template at 39°C ( Figure 3 b) and 30 min reaction time ( Figure 3 c) is implemented under

[0059] 2.4 Results of the RAA-PfAgo detection system

[0060] PfAgo and RAA were combined to improve the sensitivity of PfAgo detection. The procedure was as follows: the extracted viral RNA was reverse transcribed, the cDNA obtained was amplified by RAA at 39°C for 30 minutes, the RAA product was mixed with PfAgo, reacted at 95°C for 30 minutes, and the results were observed under blue light ( Figure 4 a). For the RAA-PfAgo detection system, 1×10 5 pMD19-PEDV-NDNA and ddH2O were used as RAA templates, and the amplified products were added to the PfAgo system to measure the fluorescence value. The results showed that under blue light, the positive fluorescence value was significantly higher than the negative light value ( Figure 4 b) The application range is 1×10 4 Up to 1×10 1 The sensitivity of the RAA-PfAgo reaction was evaluated by using 10-fold serial dilutions of pMD19-PEDV-NDNA template at 1 × 10 copies / μl. The obtained findings demonstrated that the developed detection system can detect as low as 1 × 10 2 copies / μl of dsDNA template potential ( Figure 4 c). This observed limit of detection (LOD) is consistent with the fluorescence value detected by the fluorescence quantitative PCR instrument ( Figure 4 d). Figure 4 e demonstrated the ability of the RAA-PfAgo detection system to detect PEDV, while the fluorescence values ​​of other viruses or the control group did not increase. The above results show that the established PEDVRAA-PfAgo detection method has high sensitivity and specificity.

[0061] 2.5 Results of RAA-PfAgo-LFD reaction

[0062] To establish the RAA-PfAgo-LFD method for detecting PEDV, 5′6-FAM-tccacggcgcatgcgccttt-BHQ1-3′ (fluorescent ssDNA reporter) was also replaced by 5′6-FAM-tccacggcgcatgcgccttt-Biotin-3′ (lateral flow strip test reporter). Viral RNA was extracted and reverse transcribed into cDNA; the cDNA was then used for RAA amplification at 39°C for 30 minutes. The RAA product was added to the PfAgo system and allowed to react at 95°C for 30 minutes, followed by the LFD reaction. If the 5'-6-FAM-tccacggcgcatgccttt-Biotin-3' reporter was used, the FAM-modified group bound to the gold NP anti-FAM antibody to form a complex that was captured by the antibody detection line. The streptavidin (control strip) line can capture the biotin-modified group. When the ssDNA reporter is not destroyed by PfAgo but captured by the streptavidin system, the band is only seen on the control line. After PfAgo-mediated degradation of the ssDNA reporter, although the streptavidin line (control band) captures the biotin-modified group due to the scission of the ssDNA reporter, the broken FAM-modified group can also be captured by the antibody detection line, resulting in the appearance of bands on both the control and detection lines ( Figure 5 a). Figure 5 As shown in (b), both the test line and the control line of the positive sample showed bands, but only the control line of the negative ddH2O showed a band, which means the feasibility of the developed RAA-PfAgo-LFD method. The LOD of RAA-PfAgo-LFD for PEDV was 1×10 2 copies / μl( Figure 5 c), specific testing showed that the method could not detect other pathogens ( Figure 5 d).

[0063] 2.6 Results of RAA-PfAgo / RAA-PfAgoLFD detection of PEDV in clinical samples

[0064] A total of 53 typical clinical samples (9 positive for PEDV by PCR) were successfully evaluated to determine the validity of the RAA-PfAgo test. The detection rates of RAA-PfAgo and RAA-PfAgo LFDPEDV were consistent with those of PCR.

[0065] In this embodiment, Figure 1 For an overview of the PfAgo assay, Figure 1 a in FIG. is a schematic diagram of the workflow of the RAA-PfAgo reaction. Figure 1Figure b is a schematic diagram of the locations of various genes in the PEDV genome and the locations of RAA primers and gDNAs. Green and red represent the forward primer and reverse primer of RAA, respectively; yellow, purple and blue represent three different gDNAs.

[0066] Figure 2 is the PfAgo purification result. Figure 2 Middle: M: Marker; 1: PfAgo.

[0067] Figure 3 Optimization of the RAA assay. Figure 3 The a in the table is for RAA determination. Figure 3 b in the figure is the evaluation of different incubation temperatures (37°C, 38°C, 39°C, 40°C, 41°C and 42°C). Figure 3 c in the figure is the evaluation of different incubation times (0, 10, 20, 30 and 40 minutes).

[0068] Figure 4 To establish the RAA-PfAgo assay. Figure 4 a in FIG. 1 is a schematic diagram of the RAA-PfAgo assay for detecting PEDV. Figure 4 b in the figure is the result of detecting the RAA-PfAgo reaction of PEDV under blue light. Figure 4 The c in the figure is the sensitivity of RAA-PfAgo for detecting PEDV under blue light. The detection limit of RAA-PfAgo was determined by 4 The DNA standard was determined by testing 10-fold subsequent dilutions of the DNA standard in the range of 10 copies / μL to 10 copies / μL. Figure 4 The d in the figure is the sensitivity of RAA-PfAgo in detecting PEDV by real-time fluorescence. 4 Ten-fold serial dilutions of the DNA standards were tested in the range of copies / μL to 10 copies / μL to determine the detection limit of the RAA-PfAgo assay. Figure 4 e in the figure is the specificity of the RAA-PfAgo assay for detecting PEDV under blue light.

[0069] Figure 5 To establish RAAPfAgoLFD. Figure 5 a in the figure is a schematic diagram of the RAA-PfAgo-LFD assay for detecting PEDV; Figure 5 b in the figure is the result of RAA-PfAgo-LFD reaction for detecting PEDV. Figure 5 c is the sensitivity of RAA-PfAgo-LFD, at 10 4 Serial 10-fold dilutions of DNA standards were used in the range of 10 copies / μL to 10 copies / μL to examine the detection limit of the RAA-PfAgoLFD assay; Figure 5 The d in the figure is the specificity of RAA-PfAgo-LFD in detecting PEDV.

[0070] Through the above embodiments of the present invention, the scheme of the present invention provides a RAA-PfAgo method for sensitive and rapid detection of PEDV, which can detect 100 copies of PEDV nucleic acid and has no cross-reactivity with other pathogens. In addition, only two temperatures are required to complete this process, and the method is more suitable for field environments. In addition, the method of the present invention provides substantial support for precise PEDV epidemic control and medicine.

[0071] The above specific embodiments are merely explanations of the present invention and are not limitations of the present invention. After reading this specification, those skilled in the art may make modifications to the embodiments without any creative contribution as needed. However, such modifications are protected by the patent law as long as they are within the scope of the claims of the present invention.

Claims

1. A RAA-PfAgo detection system for PEDV, characterized by: The RAA-PfAgo detection system includes the amplification product of the RAA primer, PfAgo, a probe, gDNAs and MnCl2; the sequences of the RAA primers are respectively: PEDV-RAA2F: gggttaactaatgacaaacccctttctaagg and PEDV-RAA2R: 5′-gcaacccagaaaacaccctcagtacgagtc-3′; The gDNAs are a group of double-stranded DNAs used to cut RAA products, and the sequences of the gDNAs are: gDNA-1: 5′-cgcatgcgccagcgaa-3′, gDNA-2: 5′-aattcgctcaccacgg-3′ and gDNA-3: 5′-caaattcgctggcgca-3′; The sequence of the probe is: 5′-6-FAM-tccacggcgcatgcgccttt-BHQ1-3′.

Images