A method for efficiently producing cytidylic acid and its application

Abstract

The present invention discloses a method and application for efficiently producing cytidylic acid, and belongs to the field of biotechnology. The present invention integrates the pyrimidine operon gene cluster pyr_Bs of Bacillus subtilis at the gene locus pta, reconstructs the UMP synthesis pathway in Escherichia coli, improves the metabolic flux of the 5'-cytidylic acid synthesis pathway, and realizes efficient production of 5'-cytidylic acid (5'-CMP). The yield of 60h fermentation in a 60L fermenter reaches 49g / L.

Description

Technical Field

[0001] The invention relates to a method for efficiently producing cytidylic acid and application thereof, belonging to the field of biotechnology. Background Art

[0002] Cytidine 5'-monophosphate (5'-CMP for short) is a type of cytosine nucleotide and one of the structural components of RNA. 5'-CMP is used in different fields. It can be used as a precursor or intermediate for drug synthesis in the medical field, and can also be used as a food nutrient enhancer in the food field. It is an important nucleotide. In the food field, 5'-CMP is an important flavor enhancer. It can be added to condiments such as monosodium glutamate to improve the flavor of food, which is of great significance in saving food. In the pharmaceutical field, 5'-CMP is a key intermediate for the synthesis of nucleotide drugs in the biopharmaceutical industry. In nucleotide drugs, such as cytidine triphosphate, cytosine β-D-furanarabinoside, cytosine diphosphate choline and polyinosinic acid-polycytidylic acid, the production requires 5'-CMP as an intermediate. 5'-CMP plays an important role in the immune system of humans and mammals. Studies have shown that the efficacy of infant formula with 5'-CMP added is closer to breast milk, and can significantly improve the immunity of infants and young children compared with infant formula without 5'-CMP added.

[0003] At present, the methods for producing 5'-CMP mainly include: yeast nucleic acid hydrolysis method, chemical synthesis method, enzyme synthesis method and biological fermentation method. The traditional method of yeast nucleic acid hydrolysis method uses RNA to prepare 5'-CMP, including nucleic acid chemical hydrolysis method and nucleic acid hydrolysis method using nucleic acid hydrolase. The commonly used nucleic acid hydrolase is 5'-phosphodiesterase. 5'-phosphodiesterase (5'-PDE) is used to hydrolyze yeast RNA to prepare flavor nucleotides and other nucleotides with medical value, and then the corresponding nucleoside monophosphates are separated by ion exchange method. The chemical hydrolysis method is to deaminize yeast RNA in a strong acid solution (sulfuric acid or nitric acid) to prepare cytidine or uridylate. The nucleic acid hydrolysis method has great advantages in terms of raw material sources and reaction conditions, but this method has problems such as long reaction time, complex separation process of the four nucleotide mixture obtained after hydrolysis, and high cost. The chemical synthesis method mainly uses methylated nucleosides to undergo phosphorylation reaction with phosphate or pyrophosphate, such as using 2',3'-isopropylmethylene nucleosides to undergo phosphorylation reaction with phosphoryl chloride to synthesize 5'-nucleotides. Adding a small amount of water before the reaction can greatly increase the yield of nucleotides. In addition, using trialkyl phosphates instead of phosphoryl chloride to undergo phosphorylation reaction with nucleosides can also obtain the corresponding nucleotide products. The cost of reagents required for chemical synthesis is high, and the wastewater after the reaction pollutes the environment. Uridine-cytidine kinase is an important catalyst in the salvage pathway of pyrimidine nucleotide metabolism in organisms. It can phosphorylate cytidine / uridine to produce 5'-CMP, but NTP is required to provide phosphate groups for the reaction. It has been reported that when uridine and cytidine undergo phosphorylation reaction in Escherichia coli, Lactobacillus bulgaricus and Bacillus subtilis, GTP is required to provide phosphate groups for the reaction, but the procurement cost of GTP is too high.

[0004] The biofermentation method relies on the fermentation of microorganisms to synthesize the required substances. The microbial fermentation method has the advantages of simple conditions, short growth cycle, high production cost, easy to control fermentation conditions, high yield, and low production raw material cost, which is suitable for large-scale industrial production. In the preliminary investigation, there were many studies on the microbial production of cytidine, a downstream metabolite of 5'-CMP, but there were few studies on the microbial production of 5'-CMP. There are two pathways to synthesize cytidine monophosphate in microorganisms, the de novo synthesis pathway and the pyrimidine salvage pathway. The pyrimidine salvage pathway is that the cell directly absorbs cytosine or deoxycytidine triphosphate from the external environment and converts it to cytidine, and cytidine is then converted to 5'-CMP by uridine cytidine kinase. The de novo synthesis pathway of 5'-CMP uses glutamine, carbonic acid and ATP as raw materials, and generates UMP through a series of reactions under the action of a series of enzymes. In the pyrimidine nucleotide metabolic pathway, UMP is a precursor substance for the synthesis of all pyrimidine nucleotides, and 5'-CMP is finally synthesized after a series of amination and hydrolysis reactions. In wild strains, the accumulation of 5'-CMP is very low. This is because 5'-CMP is a pyrimidine nucleotide metabolite. Pyrimidine nucleotide metabolism also includes UMP, UTP, CTP, CDP, etc. These substances are components of DNA or RNA and have complex regulatory mechanisms. With the development of microbiological technology, the pyrimidine nucleotide metabolic mechanism of microorganisms has gradually become clear, and the research on the de novo synthesis of uridine and cytidine by microorganisms has gradually increased. The clear metabolic pathway and regulatory mechanism provide a theoretical basis for studying the production of 5'-CMP by microorganisms through metabolic engineering.

[0005] CN 111269870 A discloses a recombinant Escherichia coli with high cytidylic acid production and its application. The cytidine kinase gene is cloned from the cytidylic acid production strain. The crude enzyme liquid obtained after the recombinant bacteria is crushed has good catalytic activity and stability. Cytidine, adenosine triphosphate (ATP) and Mg are added to the recombinant bacteria. 2+ , the reaction obtains cytidylic acid. However, the method requires the recombinant bacteria to be crushed and the enzyme to be separated, and the yield is not high. CN 202111280840.4 discloses a method for producing 5'-cytidylic acid, in which the gene knockout technology knocks out the cytidine monophosphate pyrophosphorylase gene ushA and the nucleotide 5'-monophosphate nucleoside enzyme gene ppnN of Escherichia coli, and obtains an Escherichia coli mutant that can accumulate 5'-cytidylic acid (5'-CMP) by overexpressing the uridine kinase gene udk. However, the above-mentioned recombinant strain needs to add the inducer IPTG and antibiotics when accumulating 5'-CMP. The inducer and antibiotics are expensive and toxic to cells. At the same time, if the accumulation concentration of 5'-cytidylic acid (5'-CMP) is further improved, its industrial production will be further promoted.

[0006] Therefore, the current research goal is to use metabolic engineering and synthetic biology to transform the starting strain of E. coli to achieve efficient production of cytidine. Summary of the invention

[0007] [Technical issues]

[0008] The technical problem to be solved by the present invention is that there is a lack of recombinant strains capable of producing high 5'-cytidylic acid in the prior art.

[0009] [Technical solution]

[0010] The present invention uses gene integration technology to integrate the pyrimidine operon pyr_Bs of Bacillus subtilis into the Escherichia coli genome, reconstructs the UMP synthesis pathway in Escherichia coli, improves the metabolic flux of the 5'-CMP synthesis pathway, enhances the synthesis flux of 5'-cytidylic acid, can efficiently produce 5'-cytidylic acid (5'-CMP), and promotes its application in the fields of medicine and the like.

[0011] The invention provides a recombinant Escherichia coli for producing cytidylic acid. Aspartate carbamoyltransferase pyrB, dihydroorotase pyrC, pyrimidine-specific carbamoyl phosphate synthetase pyrAA, pyrimidine-specific carbamoyl phosphate synthetase pyrAB-E949, dihydroorotate dehydrogenase gene pyrK, dihydroorotate dehydrogenase gene pyrD, orotidine decarboxylase gene pyrF and orotate phosphoribosyltransferase gene pyrE are overexpressed in a starting strain. The pyrimidine-specific carbamoyl phosphate synthetase pyrAB-E949 is obtained by deleting glutamic acid at position 949 on the basis of pyrAB.

[0012] In one embodiment, the pyrimidine operon pyr_Bs of Bacillus subtilis is integrated into the genome of the starting strain, and the gene cluster order of the pyrimidine operon pyr_Bs is pyrB, pyrC, pyrAA, pyrAB-E949, pyrK, pyrD, pyrF and pyrE; the nucleotide sequence of the pyrB is shown in SEQ ID NO.1, the nucleotide sequence of the pyrC is shown in SEQ ID NO.2, the nucleotide sequence of the pyrAA is shown in SEQ ID NO.3, the nucleotide sequence of the pyrAB-E949 is shown in SEQ ID NO.4, the nucleotide sequence of the pyrK is shown in SEQ ID NO.5, the nucleotide sequence of the pyrD is shown in SEQ ID NO.6, the nucleotide sequence of the pyrF is shown in SEQ ID NO.7, and the nucleotide sequence of the pyrE is shown in SEQ ID NO.8.

[0013] In one embodiment, the integration site of the pyrimidine operon pyr_Bs is gene yghX or pta.

[0014] In one embodiment, the starting strain is E. coli CMP12 or E. coli CMP13.

[0015] In one embodiment, the E. coli CMP12 and its construction method have been disclosed in patent CN116463273A. The E. coli CMP12 uses E. coli MG1655 as the chassis cell, and knocks out the nucleotide 5'-monophosphate nucleosidase gene ppnN, cytidine monophosphate pyrophosphorylase gene ushA, purine nucleotidase gene yrfG, pyrimidine 5'-nucleotidase gene yjjG, UMP phosphatase gene umpH, 5'-nucleotidase gene umpG and cytidine deaminase gene cdd on the genome;

[0016] In one embodiment, the 5'-CTP diphosphohydrolase gene nudG is integrated at the umpH site; the nucleotide sequence of the gene nudG is shown in SEQ ID NO.20; the orotate phosphoribosyltransferase gene pyrE is integrated at the umpG site, and the nucleotide sequence of the gene pyrE is shown in SEQ ID NO.15;

[0017] In one embodiment, the uridine-cytidine kinase gene udk, the phosphoribosyl pyrophosphate synthetase gene prs, the glucose-6-phosphate dehydrogenase gene zwf and the 6-phosphogluconate dehydrogenase gene gnd are also integrated and expressed, the nucleotide sequence of the gene udk is shown in SEQ ID NO.16, the nucleotide sequence of the gene prs is shown in SEQ ID NO.19, the nucleotide sequence of the gene zwf is shown in SEQ ID NO.18, and the nucleotide sequence of the gene gnd is shown in SEQ ID NO.17.

[0018] In one embodiment, the gene pyrH (R92G / D93G) or pyrH (D93A) is integrated into the poxB site of the starting strain; the nucleotide sequence of the gene pyrH (R92G / D93G) is shown in SEQ ID NO.21, and the nucleotide sequence of the gene pyrH (D93A) is shown in SEQ ID NO.22.

[0019] In one embodiment, the nucleotide sequence of the gene ppnN is shown as SEQ ID NO.9, the nucleotide sequence of the gene ushA is shown as SEQ ID NO.10, the nucleotide sequence of the gene yrfG is shown as SEQ ID NO.11, the nucleotide sequence of the gene yjjG is shown as SEQ ID NO.12, the nucleotide sequence of the gene umpH is shown as SEQ ID NO.13, and the nucleotide sequence of the gene umpG is shown as SEQ ID NO.14; the nucleotide sequence of the gene cdd is shown as SEQ ID NO.23.

[0020] In one embodiment, E. coli CMP12-M4 is based on E. coli MG1655 as the starting strain, and seven genes ppnN, ushA, yrfG, yjjG, umpH, umpG, cdd, and yghX are knocked out respectively, and genes nudG, pyrE, pyrH (R92G / D93G), udk, and PPP are overexpressed.

[0021] In one embodiment, E. coli CMP12-B4 is based on E. coli MG1655 as the starting strain, and seven genes ppnN, ushA, yrfG, yjjG, umpH, umpG, cdd, and pta are knocked out respectively, and genes nudG, pyrE, pyrH (R92G / D93G), udk, and PPP are overexpressed.

[0022] In one embodiment, E. coli CMP13-M4 is based on E. coli MG1655 as the starting strain, and seven genes ppnN, ushA, yrfG, yjjG, umpH, umpG, cdd, and yghX are knocked out respectively, and genes nudG, pyrE, pyrH (D93A), udk, and PPP are overexpressed.

[0023] In one embodiment, E. coli CMP13-B4 is based on E. coli MG1655 as the starting strain, and seven genes ppnN, ushA, yrfG, yjjG, umpH, umpG, cdd, and pta are knocked out respectively, and genes nudG, pyrE, pyrH (D93A), udk, and PPP are overexpressed.

[0024] The present invention also provides a method for producing 5'-cytidylic acid by fermentation, which comprises fermenting the recombinant Escherichia coli in a medium containing glucose.

[0025] In one embodiment, no antibiotics and inducer (TPTG) are added during the fermentation process.

[0026] In one embodiment, the fermentation is to inoculate the strain into LB medium, culture at 37°C and 200rpm for 6-16h; for shake flask fermentation, inoculate into a 250mL Erlenmeyer flask containing 30-100mL LB medium at a 0.2-10% inoculation rate, culture at 37°C and 200rpm for 50-80h.

[0027] In one embodiment, the fermentation is to transfer the seed liquid in the LB medium to the fermentation medium at an inoculation rate of 1-12%, and to carry out fermentation culture at 37°C and 200rpm, and to control the glucose concentration to 10±2g / L by measuring the glucose in the fermentation liquid; to control the dissolved oxygen to 30%, and to increase the stirring speed, ventilation volume and tank pressure when the dissolved oxygen is lower than 30%. Ammonia water is used to control the pH to 6-8.

[0028] In one embodiment, the fermentation medium for fermentation contains: glucose 20-70 g / L, ferric chloride 2-15 mg / L, MgSO 4 0.1-3g / L, sodium citrate 1-20mg / L, calcium chloride 10-500mg / L, disodium hydrogen phosphate 1-6g / L, sodium dihydrogen phosphate 1-9g / L, zinc chloride 1-60mg / L, yeast powder 0.5-12g / L, peptone 0.2-15g / L, trace elements 1-30mL (containing copper chloride 2-51g / L, zinc sulfate 3-28g / L, sodium molybdate 3-50g / L).

[0029] In one embodiment, the fermentation process is further fed; the feed medium contains: 400-800 g / L glucose, 1-16 g / L peptone, and 1-15 g / L yeast powder.

[0030] The present invention also provides the use of the recombinant Escherichia coli in producing products containing 5'-cytidylic acid in the medical field.

[0031] Beneficial Effects

[0032] The present invention reconstructs the UMP synthesis pathway in Escherichia coli by integrating the pyrimidine operon gene cluster pyr_Bs of Bacillus subtilis, improves the metabolic flux of the 5'-cytidylic acid synthesis pathway, and realizes efficient production of 5'-cytidylic acid (5'-CMP). The yield reaches 49g / L after fermentation for 60h in a 60L fermenter, and basically no intermediate metabolites are accumulated, which is conducive to the separation and purification of 5'-cytidylic acid.

[0033] The recombinant Escherichia coli provided by the present invention can use glucose as a substrate and obtain 5'-cytidylic acid by one-step fermentation without adding an inducer IPTG and antibiotics. The 5'-cytidylic acid concentration in the fermentation supernatant is high, which is convenient for separation and purification and has a simple process. BRIEF DESCRIPTION OF THE DRAWINGS

[0034] Figure 1 This is a schematic diagram of the pyrimidine operon of Bacillus subtilis;

[0035] Figure 2 Schematic diagram of the iterative integration method of the pyrimidine operon in Bacillus subtilis;

[0036] Figure 3 These are the results of gene integration verification; A: pyrB-pyrC gene integration verification; B: pyrAA gene integration verification;

[0037] Figure 4 is the graph of 5'-cytidylic acid production (shake flask);

[0038] Figure 5 This is the graph of 5'-cytidylic acid production (60L fermenter). DETAILED DESCRIPTION

[0039] HPLC detection conditions of cytidylic acid: liquid chromatograph Shimadzu 10A, chromatographic column: INERTSIL ODS-SP 5μm4.6*250mm, mobile phase: buffer preparation: 0.1mol / L potassium dihydrogen phosphate aqueous solution: 0.01mol / L tetrabutylammonium hydroxide: methanol = 95:95:10, then adjust the pH to 4.5 with phosphoric acid, wavelength: 276nm, flow rate: 1.0ml / min.

[0040] The construction method of the pEtac plasmid used in the present invention has been disclosed in the paper "Metabolic Engineering of Escherichia coli to Synthesize Hydroxytyrosol".

[0041] The gene sequences in the following embodiments are as follows: the nucleotide sequence of pyrB is shown in SEQ ID NO.1, the nucleotide sequence of pyrC is shown in SEQ ID NO.2, the nucleotide sequence of pyrAA is shown in SEQ ID NO.3, the nucleotide sequence of pyrAB-E949 is shown in SEQ ID NO.4, the nucleotide sequence of pyrK is shown in SEQ ID NO.5, the nucleotide sequence of pyrD is shown in SEQ ID NO.6, the nucleotide sequence of pyrF is shown in SEQ ID NO.7, the nucleotide sequence of pyrE is shown in SEQ ID NO.8, the nucleotide sequence of ppnN is shown in SEQ ID NO.9, the nucleotide sequence of ushA is shown in SEQ ID NO.10, the nucleotide sequence of yrfG is shown in SEQ ID NO.11, the nucleotide sequence of yjjG is shown in SEQ ID NO.12, the nucleotide sequence of umpH is shown in SEQ ID NO.13, the nucleotide sequence of umpG is shown in SEQ ID NO.14, the nucleotide sequence of pyrE is shown in SEQ ID NO.15, and the nucleotide sequence of udk is shown in SEQ ID NO. The nucleotide sequence of SEQ ID NO.1 is shown in SEQ ID NO.16, the nucleotide sequence of gnd is shown in SEQ ID NO.17, the nucleotide sequence of zwf is shown in SEQ ID NO.18, the nucleotide sequence of prs is shown in SEQ ID NO.19, the nucleotide sequence of nudG is shown in SEQ ID NO.20, the nucleotide sequence of pyrH (R92G / D93G) is shown in SEQ ID NO.21, the nucleotide sequence of pyrH (D93A) is shown in SEQ ID NO.22, and the nucleotide sequence of cdd is shown in SEQ ID NO.23. Among them, the nucleotide sequences SEQ ID NO.1-8, 20-23 are derived from Bacillus subtilis, and the nucleotide sequence SEQ ID NO.9-19 is derived from Escherichia coli.

[0042] Primer sequences required for constructing recombinant strains:

[0043] Table 1 Primer sequences used

[0044]

[0045]

[0046] The recombinant strain constructed:

[0047] Table 2 The strains involved in the specific implementation method:

[0048]

[0049] Example 1 Construction of starting strain

[0050] 1. Construction of E.coli CMP12 strain:

[0051] The strain construction method is disclosed in patent CN116463273A. E. coli MG1655 is used as the chassis cell, and the nucleotide 5'-monophosphate nucleosidase gene ppnN (nucleotide sequence is shown in SEQ ID NO.9), cytidine monophosphate pyrophosphorylase gene ushA (nucleotide sequence is shown in SEQ ID NO.10), purine nucleotidase gene yrfG (nucleotide sequence is shown in SEQ ID NO.11), pyrimidine 5'-nucleotidase gene yjjG (nucleotide sequence is shown in SEQ ID NO.12), UMP phosphatase gene umpH (nucleotide sequence is shown in SEQ ID NO.13), 5'-nucleotidase gene umpG (nucleotide sequence is shown in SEQ ID NO.14) and cytidine deaminase gene cdd (nucleotide sequence is shown in SEQ ID NO.23) on the genome are knocked out; 5'-CTP diphosphohydrolase gene nudG (nucleotide sequence is shown in SEQ ID NO.23) is integrated at the umpH site. NO.20); the orotate phosphoribosyltransferase gene pyrE (nucleotide sequence as shown in SEQ ID NO.8) is integrated at the umpG site; the uridine-cytidine kinase gene udk (nucleotide sequence as shown in SEQ ID NO.16), the phosphoribosyl pyrophosphate synthetase gene prs (nucleotide sequence as shown in SEQ ID NO.19), the glucose-6-phosphate dehydrogenase gene zwf (nucleotide sequence as shown in SEQ ID NO.18) and the 6-phosphogluconate dehydrogenase gene gnd (nucleotide sequence as shown in SEQ ID NO.17) are also integrated and expressed; the gene pyrH (R92G / D93G) (nucleotide sequence as shown in SEQ ID NO.21) is integrated at the poxB site.

[0052] 2. Construction of E. coli CMP13 strain

[0053] Using E. coli CMP12 as the starting strain, primers pyrH-D93A-RS and pyrH-D93A-FW were used, and pEtac-pyrH plasmid was used as a template to construct the integrated expression cassette pyrH (D93A). Gene editing technology was used to replace the gene pyrH (R92G / D93G) on the E. coli CMP12 genome with pyrH (D93A). Primers △poxB::pyrH-up-FW and △poxB::pyrH-up-RS, △poxB::pyrH-down-FW and △poxB::pyrH-down-RS were used to obtain the upstream and downstream homology arms of the knockout gene pyrH, and then primers △pyrH-up-FW and △pyrH-down-RS were used to construct the gene pyrH (R92G / D93G) knockout cassette. Plasmid pTargetF-pyrH was constructed by whole plasmid PCR using primers sg-pyrH-FW and pTargetF-RS with plasmid pTargetF as template. pTargetF-pyrH and Donor DNA pyrH (R92G / D93G) knockout cassette were introduced into the electroporation competent state of the recombinant strain E. coli CMP12 containing the pCas plasmid, and the recombinant strain with knockout gene pyrH (R92G / D93G) on the genome of E. coli CMP12 was screened and obtained. Then, by designing primers and expression cassettes, gene pyrH (D93A) was integrated into the intergenic region of gene yjiP-yjiR, and whole plasmid PCR was constructed by primers sg-SCD-FW and pTargetF-RS with plasmid pTargetF as template. Plasmid pTargetF-SCD was constructed. Using primers CD-zh-pyrH(D93A)-up-FW, CD-zh-pyrH(D93A)-up-RS, CD-zh-pyrH(D93A)-down-FW, CD-zh-pyrH(D93A)-down-RS, E. coli The MG1655 genome was used as a template to amplify the upstream and downstream homologous arms of the integrated gene pyrH (D93A) by PCR. The primers CD-zh-pyrH (D93A)-mid-FW and CD-zh-pyrH (D93A)-mid-RS were used to obtain the expression frame of the gene pyrH (D93A) with pEtac-pyrH as a template. Then, CD-zh-pyrH (D93A)-up-FW and CD-zh-pyrH (D93A)-down-RS were used to perform fusion PCR with the upstream and downstream homologous arms and the expression frame as templates. The constructed recombinant plasmid pTargetF-SCD and the integrated expression frame were introduced into the recombinant strain of the knockout gene pyrH (R92G / D93G), and the integrated gene pyrH (D93A) was constructed to obtain E. coli CMP13.

[0054] Example 2 Construction of recombinant Escherichia coli for producing 5' cytidylic acid

[0055] (1) Construction of a recombinant plasmid for overexpressing the uridine kinase gene

[0056] Using E.coli CMP13 as the starting strain, primers were used:

[0057] pEtac-pyrB-pyrC-FW:CGGAATTCATGAAGCATTTAACGACGATGAGTG;

[0058] pEtac-pyrB-pyrC-RS: CCGCTCGAGTCATTTGACAAGTCTCCCCTCT;

[0059] pEtac-pyrAA-FW:CGGAATTCATGAAGAGACGATTAGTACT;

[0060] pEtac-pyrAA-RS: CCGCTCGAGCTACGCGTTTTGGCATACCG;

[0061] pEtac-pyrAB-FW:AAGGAAAAAAGCGGCCGCATGCCAAAACGCGTAGACAT;

[0062] pEtac-pyrAB-RS:CCGCTCGAGTCATATAGTGACTGCCGCCTCC;

[0063] pEtac-pyrK-pyrD-pyrF-pyrE-FW:TCACACAGGAAACAGAATTCATGAAAAAAGCGTATTTGAC;

[0064] pEtac-pyrK-pyrD-pyrF-pyrE-RS:CAAGCTTGTCGACGGAGCTCTTATTTTTTAAACCAATCTT.

[0065] Using the genome of Bacillus subtilis 168 as a template, PCR amplification was performed to obtain the target fragments of pyrB-pyrC, pyrAA, pyrAB, pyrK-pyrD-pyrF-pyrE. The conditions for PCR amplification of nucleotide sequences were as follows: pre-denaturation at 98°C for 5 min; denaturation at 95°C for 30 s; annealing at 55°C for 30 s; extension at 72°C for 1 min; setting cycles for 29 times; re-extension at 72°C for 10 min; and finally insulation at 16°C. PCR amplification system: 5×PS buffer 20 μL, dNTP 10 μL, upstream / downstream primers (10 μmol·L 1 )2μL, template 1μL, enzyme 1μL, water 66μL. The pyrB-pyrC, pyrAA, pyrAB gene fragments obtained by PCR and the pEtac plasmid (the construction method of the pEtac plasmid has been disclosed in the paper "Metabolic Engineering of Escherichia coli to Synthesize Hydroxytyrosol") were digested with restriction endonucleases Xho I and EcoR I. The pyrB-pyrC, pyrAA, pyrAB, pyrK-pyrD-pyrF-pyrE gene fragments after digestion were connected to the pEtac plasmid respectively using ligase, and the recombinant plasmids pEtac-pyrB-pyrC, pEtac-pyrAA, pEtac-pyrAB and pEtac-pyrK-pyrD-pyrF-pyrE were constructed using C112 one-step cloning enzyme, and the ligation products were introduced into the competent state of E.coli JM109 by chemical transformation, and the transformants were picked to extract the plasmid for restriction enzyme digestion verification. Recombinant plasmids pEtac-pyrB-pyrC, pEtac-pyrAA, pEtac-pyrAB and pEtac-pyrK-pyrD-pyrF-pyrE were constructed and obtained.

[0066] (2) Construction of the pyrAB(E949*) mutant.

[0067] Whole plasmid PCR was performed with primers pEtac-pyrAB-949-FW and pEtac-pyrAB-949-RS using the constructed plasmid pEtac-pyrAB as a template to obtain a recombinant plasmid expressing a mutant with glutamic acid deleted at position 949 of pyrAB. The recombinant plasmid was introduced into the competent cell of E. coli JM109 by chemical transformation, and the transformants were picked for plasmid enzyme digestion verification to obtain the recombinant plasmid pEtac-pyrAB-E949 expressing the pyrAB-E949 mutant.

[0068] (3) Integrate the Bacillus subtilis pyrimidine operon pyr_Bs at the yghX gene locus or the pta gene locus

[0069] The iterative integration method of large-fragment gene integration in the study of (Wu H, Li Y, Qian M, et al. Metabolic engineering of Escherichia coli for high-yield uridine production [J]. Metabolic Engineering, 2018, 49: S1096717618302507-) was used to integrate the pyrimidine operon pyr_Bs of Bacillus subtilis into Escherichia coli E. coli MG1655 (ΔppnNΔushAΔyrfGΔyjjGΔumpHΔumpG nudG pyrE pyrH(D93A)Δcdd udkPPP). The gene cluster order of the pyrimidine operon pyr_Bs is pyrB, pyrC, pyrAA, pyrAB-E949, pyrK, pyrD, pyrF and pyrE.

[0070] The sgRNA recognition sequence of the yghX gene locus was designed by the benchling website (https: / / benchling.com / ), and the primers sg-yghX-FW and pTarget-RS, sg-pta-FW and pTarget-RS were designed. The whole plasmid PCR was performed using sg-yghX-FW and pTarget-RS, sg-pta-FW and pTarget-RS, and pTarget plasmid as a template. The PCR product was purified with a product cleaning kit, and the purified product was digested with DpnⅠ. The digestion product was introduced into the competent cell of E. coli JM109 by chemical transformation. The transformants were selected to extract the plasmids and sent for sequencing verification. If the sequence alignment was correct, the pTarget-yghX and pTarget-pta plasmids were successfully constructed. Then, according to the two high-efficiency PS+PAM sequences mentioned in the study (Wu H, Li Y, Qian M, et al. Metabolic engineering of Escherichia coli for high-yield uridine production [J]. Metabolic Engineering, 2018, 49: S1096717618302507), the sgRNA recognition sequence was designed. The primers sg-yghX-1-FW and pTarget-RS, sg-yghX-2-FW and pTarget-RS were used respectively. The whole plasmid PCR was performed with the pTarget plasmid as a template. The PCR product was purified using a product cleaning kit, and the purified product was digested with DpnⅠ. The digested product was introduced into the competent cell of E. coli JM109 by chemical transformation. The transformant was selected to extract the plasmid and send it for sequencing verification. If the sequence alignment was correct, the plasmid construction pTarget-yghX-1 and pTarget-yghX-2 was successful.

[0071] First, using the E. coli MG1655 genome as a template, zh-pyrBC-up-FW and zh-pyrBC-up-RS, zh-pyrBC-down-FW and zh-pyrBC-down-RS, PCR amplified the upstream and downstream homologous arms of the yghX gene site, and using pEtac-pyrB-pyrC as a template, primers zh-pyrBC-mid-FW and zh-pyrBC-mid-RS, PCR amplified the gene pyrB and pyrC expression cassette fragment pyrB-pyrC, and when designing primers to obtain the gene pyrB-pyrC expression cassette fragment, the exogenous PS 1+PAM sequence P1 (nucleotide sequence is TGCGCTGGTTGATTTCTTCTGTT), i.e., the pTarget-yghX-1 recognition site, should be introduced at the 3' end. The PS+PAM sequence is the sequence specifically recognized by sgRNA in gene editing. We obtained two highly efficient sgRNA-specific recognition sequences by consulting relevant materials and added them to the end of the integration expression frame as the specific recognition site for the next gene integration.

[0072] The upstream and downstream homologous arms of the yghX gene locus obtained were combined with the gene pyrB-pyrC expression cassette fragment as templates, and the primers zh-pyrBC-up-FW and zh-pyrBC-down-RS were used for fusion PCR to obtain the yghX gene locus integration frame. The pTarget-yghX recombinant plasmid and the integration frame of the yghX gene locus were introduced into the competent cells of E. coli CMP12 by electrotransformation. The transformants were picked for colony PCR verification. The band size of the control strain without integration of the pyrB-pyrC gene was 1728bp, and the band size of the correct transformant was 4051bp. The agarose gel electrophoresis results are shown in Figure 3 As shown in A, it can be seen from the figure that the genes pyrB-pyrC have been integrated into the E. coli genome, and the recombinant strains with pyrB-pyrC integrated into the yghX gene site were named E. coli CMP13-M1 and E. coli CMP12-M1.

[0073] Using the E. coli CMP13-M1 genome as a template, PCR amplification was performed, and the upstream and downstream homology arms required for integrating the pyrAA gene at the yghX gene site were amplified using primers zh-pyrAA-up-FW, zh-pyrAA-up-RS, zh-pyrAA-down-FW, and zh-pyrBC-down-RS respectively; using pEtac-pyrAA as a template, the pyrAA gene expression cassette fragment was amplified by PCR using primers pta-zh-pyrAA-mid-FW and pta-zh-pyrAA-mid-RS respectively. When designing the primers for the pyrAA gene expression cassette fragment, the exogenous PS 2+PAM sequence P2 (nucleotide sequence is AGGAATATCCGCAATAATTAGTT), i.e., the pTarget-yghX-2 recognition site, was introduced at the 3' end. The upstream and downstream homology arms and gene pyrAA expression cassette fragments were used as templates, and primers zh-pyrAA-up-FW and zh-pyrBC-down-RS were used for fusion PCR to obtain the integration frame of pyrAA at the yghX gene locus. The pTarget-yghX-1 recombinant plasmid and the pyrAA integration frame at the yghX gene locus were introduced into E. coli CMP13-M1 and E. coli CMP12-M1 competent cells by electrotransformation. Transformants were picked for colony PCR verification. The band size of the control strain without pyrAA gene integration was 1111bp, and the band size of the correct transformant was 2630bp. The agarose gel electrophoresis results are shown in Figure 3 As shown in B. It can be seen from the figure that the gene pyrAA has been integrated into the E. coli genome, and the recombinant strains E. coli CMP13-M2 and E. coli CMP12-M2 were obtained.

[0074] The remaining genes pyrAB, pyrK-pyrD-pyrF-pyrE are Figure 2The integration was carried out in sequence, and the upstream homology arm, expression cassette and downstream homology arm of the integrated gene pyrAB were constructed respectively using primers zh-pyrAB-up-FW and zh-pyrAB-up-RS, zh-pyrAB-mid-FW and zh-pyrAB-mid-RS, zh-pyrAB-down-FW and zh-pyrBC-down-RS. When designing the primers for the gene pyrAA expression cassette fragment, the exogenous PS 1+PAM sequence P1 was introduced at the 3' end, which was the recognition site of pTarget-yghX-1. Then, primers zh-pyrAB-up-FW and zh-pyrBC-down-RS were used to perform fusion PCR with the upstream homologous arm, expression cassette and downstream homologous arm gene fragments as templates to obtain the integration frame of gene pyrAB-E949. The integration frame of gene pyrAB-E949 and pTarget-yghX-2 were introduced into E. coli CMP13-M2 and E. coli CMP12-M2 competent cells to obtain recombinant strains E. coli CMP13-M3 and E. coli CMP12-M3.

[0075] Using the primers zh-pyrKDFE-up-FW and zh-pyrKDFE-up-RS, zh-pyrKDFE-mid-FW and zh-pyrKDFE-mid-RS, zh-pyrKDFE-down-FW and zh-pyrBC-down-RS, and using the E. coli CMP13-M3 genome as a template, the upstream homology arm, expression cassette, and downstream homology arm of the integrated pyrKDFE gene were obtained, respectively. Using the primers zh-pyrKDFE-up-FW and zh-pyrBC-down-RS, the upstream homology arm, expression cassette, and downstream homology arm of the pyrK-pyrD-pyrF-pyrE gene were used as templates for fusion PCR to obtain the integrated expression cassette of the integrated pyrK-pyrD-pyrF-pyrE. The integrated expression cassette of the pyrK-pyrD-pyrF-pyrE and pTarget-yghX-1 were introduced into E. coli CMP13-M3 and E. coli CMP12-M3 were competent, and recombinant strains E. coli CMP13-M4 and E. coli CMP12-M4 were obtained.

[0076] Using the E. coli MG1655 genome as a template, pta-zh-pyrBC-up-FW and pta-zh-pyrBC-up-RS, pta-zh-pyrBC-down-FW and zh-pyrBC-down-RS were used to PCR amplify the upstream and downstream homologous arms of the pta gene site, respectively. Using pEtac-pyrB-pyrC as a template, primers pta-zh-pyrBC-mid-FW and pta-zh-pyrBC-mid-RS were used to PCR amplify the pyrB gene and pyrC expression cassette fragment pyrB-pyrC, respectively. When designing primers to obtain the pyrB-pyrC expression cassette fragment, the exogenous PS 1+PAM sequence P1 (nucleotide sequence is TGCGCTGGTTGATTTCTTCTGTT), i.e., the pTarget-pta-1 recognition site, was introduced at the 3' end.

[0077] The upstream and downstream homologous arms of the obtained pta gene locus were combined with the gene pyrB-pyrC expression cassette fragment as templates, and the primers pta-zh-pyrBC-up-FW and zh-pyrBC-down-RS were used for fusion PCR to obtain the pta gene locus integration frame. The pTarget-pta recombinant plasmid and the integration frame of the pta gene locus were introduced into the competent cells of E. coli CMP12 by electroporation. The transformants were picked for colony PCR verification, and the recombinant strains with pyrB-pyrC integrated in the pta gene locus were named E. coli CMP13-B1 and E. coli CMP12-B1.

[0078] Using the genomes of E. coli CMP13-B1 and E. coli CMP12-B1 as templates, PCR amplification was performed, and the upstream and downstream homology arms required for integrating the pyrAA gene at the pta gene site were amplified using primers pta-zh-pyrAA-up-FW, pta-zh-pyrAA-up-RS, pta-zh-pyrAA-down-FW, and zh-pyrBC-down-RS, respectively; using pEtac-pyrAA as a template, the primers pta-zh-pyrAA-mid-FW and pta-zh-pyrAA-mid-RS were used to PCR amplify the pyrAA gene expression cassette fragment, and when designing the primers for the pyrAA gene expression cassette fragment, the exogenous PS 2+PAM sequence P2 (nucleotide sequence is AGGAATATCCGCAATAATTAGTT), i.e., the pTarget-yghX-2 recognition site, was introduced at the 3' end. The upstream and downstream homology arms and gene pyrAA expression cassette fragments were used as templates, and primers pta-zh-pyrAA-up-FW and zh-pyrBC-down-RS were used for fusion PCR to obtain the integration frame of pyrAA at the pta gene site. The pTarget-pta-1 recombinant plasmid and the pyrAA integration frame at the pta gene site were introduced into E. coli CMP13-B1 and E. coli CMP12-B1 competent cells by electrotransformation. Transformants were picked for colony PCR verification to obtain recombinant strains E. coli CMP13-B2 and E. coli CMP12-B2.

[0079] The remaining genes pyrAB, pyrK-pyrD-pyrF-pyrE are Figure 2The integration was carried out in sequence, and the upstream homology arm, expression cassette and downstream homology arm of the integrated gene pyrAB were constructed respectively using primers pta-zh-pyrAB-up-FW and pta-zh-pyrAB-up-RS, pta-zh-pyrAB-mid-FW and pta-zh-pyrAB-mid-RS, pta-zh-pyrAB-down-FW and zh-pyrBC-down-RS. When designing the primers for the expression cassette fragment of the gene pyrAA, the exogenous PS 1+PAM sequence P1 was introduced at the 3' end, which was the recognition site of pTarget-pta-1. Then, primers pta-zh-pyrAB-up-FW and zh-pyrBC-down-RS were used to perform fusion PCR with the upstream homologous arm, expression cassette and downstream homologous arm gene fragments as templates to obtain the integration frame of gene pyrAB-E949. The integration frame of gene pyrAB-E949 and pTarget-pta-2 were introduced into E. coli CMP13-B2 and E. coli CMP12-B2 competent cells to obtain recombinant strains E. coli CMP13-B3 and E. coli CMP12-B3.

[0080] Using primers pta-zh-pyrKDFE-up-FW and pta-zh-pyrKDFE-up-RS, pta-zh-pyrKDFE-mid-FW and pta-zh-pyrKDFE-mid-RS, pta-zh-pyrKDFE-down-FW and zh-pyrBC-down-RS, E. coli The CMP13-B3 genome was used as a template to obtain the upstream homologous arm, expression cassette and downstream homologous arm of the integrated pyrKDFE gene, respectively. Primers pta-zh-pyrKDFE-up-FW and zh-pyrBC-down-RS were used with the upstream homologous arm, expression cassette and downstream homologous arm of the pyrK-pyrD-pyrF-pyrE gene as templates for fusion PCR to obtain the integrated expression frame of the integrated pyrK-pyrD-pyrF-pyrE. The integrated expression frame of the pyrK-pyrD-pyrF-pyrE and pTarget-pta-1 were introduced into the competent cells of E. coli CMP13-B3 and E. coli CMP12-B3 to obtain the recombinant strains E. coli CMP13-B4 and E. coli CMP12-B4.

[0081] Example 3 Fermentation production of 5'-CMP in a shake flask

[0082] Shake flask fermentation: inoculate the strain into LB medium, culture at 37°C and 200 rpm for 6-16 h; for shake flask fermentation, inoculate into a 250 mL Erlenmeyer flask containing 50 mL LB medium at 1% inoculum, culture at 37°C and 200 rpm for 72 h.

[0083] When the integration site was yghX, the 5'-CMP yield of E. coli CMP13-M4 reached 468.0 mg·L at 72 h of fermentation in shake flasks. -1 , compared with the 5'-CMP yield of the control strain E. coli CMP13 (431.5 mg·L -1 ) increased by 1.08 times; at the shake flask level, the 5'-CMP production of E. coli CMP12-M4 reached 503.7 mg·L at 72 h of fermentation. -1 , compared with the 5'-CMP yield of the control strain E. coli CMP12 (456 mg·L -1 ) increased by 1.1 times. Similarly, when the integration site was pta, at the shake flask level, the 5'-CMP yield of E. coli CMP13-B4 reached 485.2 mg·L at 72 h of fermentation. -1 , compared with the 5'-CMP yield of the control strain E. coli CMP13 (431.5 mg·L -1 ) increased by 1.12 times. At the shake flask level, the 5'-CMP production of E. coli CMP12-B4 reached 536.9 mg·L at 72 h of fermentation. -1 , compared with the 5'-CMP yield of the control strain E. coli CMP12 (456 mg·L -1 ) increased by 1.18 times.

[0084] Example 4 Fermentation production of 5'-CMP in a 60L fermenter

[0085] The strains E.coli CMP12-M4 and E.coli CMP13-M4 were fermented at high density in a 60L fermenter system. The fermentation conditions were as follows: the seed liquid in the LB medium was transferred to the fermentation medium (60L fermenter, the initial liquid volume was 28L, and the initial OD value of the strain was 0.12) at a 6% inoculation rate, and the fermentation culture was carried out at 37°C and 200rpm. The glucose concentration was controlled to be 10±2g / L by measuring the glucose in the fermentation liquid; the dissolved oxygen was controlled to be 30%, and when it was lower than 30%, the stirring speed, ventilation volume and tank pressure were increased. Ammonia water was used to control the pH to 6.8. After the fermentation was completed, the bacteria were centrifuged and the supernatant was taken to determine the content of 5'-CMP therein. 5'-CMP can be efficiently produced after 60h of fermentation, with the yield of strain E. coli CMP12 reaching 39.6g / L, the yield of strain E. coli CMP13 reaching 36.3g / L, and the yields of strains E. coli CMP12-M4 and E. coli CMP13-M4 reaching 43.6g / L and 41.5g / L, respectively. Similarly, 5'-CMP can be efficiently produced after 60h of fermentation, with the yields of strains E. coli CMP12-B4 and E. coli CMP13-B4 reaching 49.0g / L and 42.8g / L, respectively.

[0086] Although the present invention has been disclosed as above in the form of a preferred embodiment, it is not intended to limit the present invention. Anyone familiar with this technology can make various changes and modifications without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be based on the definition of the claims.

Claims

1. A recombinant Escherichia coli for producing cytidylic acid, characterized in that: Integrating the pyrimidine operon pyr_Bs of Bacillus subtilis into the genome of the starting strain, wherein the gene cluster of the pyrimidine operon pyr_Bs includes pyrB, pyrC, pyrAA, pyrAB-E949, pyrK, pyrD, pyrF and pyrE in sequence; The nucleotide sequence of the pyrB is shown in SEQ ID NO.1, the nucleotide sequence of the pyrC is shown in SEQ ID NO.2, the nucleotide sequence of the pyrAA is shown in SEQ ID NO.3, the nucleotide sequence of the pyrAB-E949 is shown in SEQ ID NO.4, the nucleotide sequence of the pyrK is shown in SEQ ID NO.5, the nucleotide sequence of the pyrD is shown in SEQ ID NO.6, the nucleotide sequence of the pyrF is shown in SEQ ID NO.7, and the nucleotide sequence of the pyrE is shown in SEQ ID NO.8; The pyrimidine operon pyr_Bs is integrated at the location of the gene pta; The starting strain uses E. coli MG1655 as the chassis cell, and knocks out the nucleotide 5'-monophosphate nucleosidase gene ppnN, the cytidine monophosphate pyrophosphorylase gene ushA, the purine nucleotidase gene yrfG, the pyrimidine 5'-nucleotidase gene yjjG, the UMP phosphatase gene umpH, the 5'-nucleotidase gene umpG and the cytidine deaminase gene cdd on the genome; The 5'-CTP diphosphohydrolase gene nudG is integrated into the umpH site; the nucleotide sequence of the gene nudG is shown in SEQ ID NO.20; the orotate phosphoribosyltransferase gene pyrE is integrated into the umpG site; the nucleotide sequence of the gene pyrE is shown in SEQ ID NO.8; The uridine-cytidine kinase gene udk, the phosphoribosyl pyrophosphate synthetase gene prs, the glucose-6-phosphate dehydrogenase gene zwf and the 6-phosphogluconate dehydrogenase gene gnd are also integrated and expressed, wherein the nucleotide sequence of the gene udk is shown in SEQ ID NO.16, the nucleotide sequence of the gene prs is shown in SEQ ID NO.19, the nucleotide sequence of the gene zwf is shown in SEQ ID NO.18, and the nucleotide sequence of the gene gnd is shown in SEQ ID NO.17; The gene pyrH (R92G / D93G) is integrated into the poxB site of the starting strain; the nucleotide sequence of the gene pyrH (R92G / D93G) is shown in SEQ ID NO.

21.

2. A method for producing 5'-cytidylic acid, characterized in that: The recombinant Escherichia coli according to claim 1 is fermented in a medium containing glucose.

3. The method according to claim 2, characterized in that The concentration of the glucose is 8-12 g / L.

4. The method according to claim 3, characterized in that Ferment at 35-40°C for at least 72 hours.

5. Use of the recombinant Escherichia coli according to claim 1 in producing products containing 5'-cytidylic acid in the medical field.

Images