Use of lncRNA in regulating bovine infectious rhinotracheitis virus replication

Abstract

The present invention discloses the use of lncRNA in regulating the replication of bovine infectious rhinotracheitis virus. This application first discovered a long non-coding RNA 6up in MDBK cell samples infected with bovine infectious rhinotracheitis virus, designed a primer sequence that can detect the gene, and designed and synthesized the small interfering RNA of the gene. Further studies have shown that its expression level is significantly upregulated in the virus-infected group, and lncRNA-6up inhibits the replication of the virus after silencing, which provides a new idea for the detection of bovine infectious rhinotracheitis virus infection and the treatment of related diseases.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine, and specifically relates to the use of lncRNA in regulating the replication of bovine infectious rhinotracheitis virus. Background Art

[0002] Long non-coding RNA (lncRNA) is a type of non-coding RNA (ncRNA) exceeding 200 nucleotides in length. It is primarily distributed in the cytoplasm, nucleus, and exosomes. Its structure is similar to that of messenger RNA, lacking an open reading frame (ORF). lncRNAs are transcribed by RNA polymerase II or III, with cell-, tissue-, and stage-specific transcription, and play diverse roles in different biological processes. They possess a 5′ cap and may or may not have a poly(A) tail. While they typically do not encode proteins, they participate in gene regulation through various RNA pathways, including epigenetic, transcriptional, and post-transcriptional regulation.

[0003] Infectious Bovine Rhinotracheitis Virus (IBRV), also known as bovine herpesvirus type 1 (BHV-1), is a member of the Herpesviridae family, subfamily Herpesvirinae, and genus Vesiculovirinae. The virus is a double-stranded DNA enveloped virus with a diameter of approximately 130-180 nm. Infectious Bovine Rhinotracheitis (IBR), also known as necrotizing rhinitis or red nose, is a respiratory contagious disease of cattle caused by BHV-1. Clinical manifestations vary, primarily affecting the respiratory tract, accompanied by conjunctivitis, abortion, mastitis, and sometimes calf encephalitis. Acute IBR respiratory infection can also lead to secondary bacterial pneumonia. This disease is currently prevalent worldwide, significantly impacting milk production in dairy cows, fertility in bulls, and the workability of draft cattle.

[0004] Therefore, detailed analysis of the host lncRNA that regulates IBRV replication is of great significance for the prevention and treatment of bovine infectious bronchitis. Summary of the Invention

[0005] To overcome the deficiencies of the prior art, the present invention provides the use of lncRNA in regulating the replication of bovine infectious rhinotracheitis virus.

[0006] To achieve the above object, the present invention adopts the following technical solutions:

[0007] The first aspect of the present invention provides a lncRNA, wherein the lncRNA has the following nucleotide sequence:

[0008] (1) the nucleotide sequence shown in SEQ ID NO: 1;

[0009] (2) A nucleotide sequence with equivalent function formed by replacing, deleting or adding one or more nucleotides based on the nucleotide sequence shown in SEQ ID NO: 1.

[0010] A second aspect of the present invention provides any of the following substances:

[0011] (1) A vector comprising the lncRNA described in the first aspect of the present invention;

[0012] (2) A host cell comprising the lncRNA described in the first aspect of the present invention or the vector described in (1).

[0013] Furthermore, the vector further comprises at least one promoter.

[0014] The third aspect of the present invention provides the use of a reagent for detecting the expression level of the lncRNA described in the first aspect of the present invention in the preparation of a product for diagnosing bovine infectious rhinotracheitis virus infection.

[0015] Furthermore, the reagent is selected from a probe that specifically recognizes the lncRNA and a primer that specifically amplifies the lncRNA.

[0016] Furthermore, the sequence of the primer for specifically amplifying the lncRNA is shown in SEQ ID NO: 2-3.

[0017] Furthermore, the reagent also includes a detectable label.

[0018] The fourth aspect of the present invention provides a product for diagnosing bovine infectious rhinotracheitis virus infection, wherein the product comprises a reagent capable of detecting the expression level of the lncRNA described in the first aspect of the present invention.

[0019] Furthermore, the product also includes reagents required for detecting the expression level of the lncRNA by RT-PCR and qRT-PCR.

[0020] Furthermore, the product includes a chip, a kit or a nucleic acid membrane strip.

[0021] The fifth aspect of the present invention provides a pharmaceutical composition for treating diseases related to bovine infectious rhinotracheitis virus infection, wherein the pharmaceutical composition comprises the lncRNA inhibitor according to the first aspect of the present invention.

[0022] Furthermore, the inhibitors include nucleic acid molecules, small molecule chemical drugs, and nucleic acid constructs.

[0023] Furthermore, the nucleic acid molecules include siRNA, shRNA, dsRNA, ribozymes, and antisense oligonucleotides.

[0024] Furthermore, the inhibitor is selected from siRNA.

[0025] Furthermore, the sequence of the siRNA is selected from one or more of SEQ ID NOs: 6-11.

[0026] Furthermore, the disease related to bovine infectious rhinotracheitis virus infection is bovine infectious rhinotracheitis.

[0027] The sixth aspect of the present invention provides use of the lncRNA inhibitor described in the first aspect of the present invention in the preparation of a pharmaceutical composition for treating diseases related to bovine infectious rhinotracheitis virus infection.

[0028] Furthermore, the pharmaceutical composition also includes a pharmaceutically acceptable carrier.

[0029] Furthermore, the disease related to bovine infectious rhinotracheitis virus infection is bovine infectious rhinotracheitis.

[0030] A seventh aspect of the present invention provides a method for screening candidate substances for treating diseases related to bovine infectious rhinotracheitis virus infection, the method comprising:

[0031] 1) contacting a test substance with a culture system expressing the lncRNA gene according to the first aspect of the present invention; and

[0032] 2) Selecting a test substance that reduces the expression level of the lncRNA gene compared to the expression level detected in the absence of the test substance.

[0033] Furthermore, the disease related to bovine infectious rhinotracheitis virus infection is bovine infectious rhinotracheitis.

[0034] The eighth aspect of the present invention provides the use of the lncRNA described in the first aspect of the present invention in screening candidate substances for treating diseases related to bovine infectious rhinotracheitis virus infection.

[0035] Furthermore, the disease related to bovine infectious rhinotracheitis virus infection is bovine infectious rhinotracheitis.

[0036] The ninth aspect of the present invention provides a method for regulating the replication of bovine infectious rhinotracheitis virus in vitro, comprising administering the lncRNA inhibitor according to the first aspect of the present invention.

[0037] Furthermore, lncRNA inhibitors regulate bovine infectious rhinotracheitis virus replication by modulating the levels of glycoproteins.

[0038] Furthermore, the glycoprotein includes gB and / or gD protein.

[0039] Furthermore, the inhibitors include nucleic acid molecules, small molecule chemical drugs, and nucleic acid constructs.

[0040] Furthermore, the nucleic acid molecules include siRNA, shRNA, dsRNA, ribozymes, and antisense oligonucleotides.

[0041] Furthermore, the inhibitor is selected from siRNA.

[0042] Furthermore, the sequence of the siRNA is selected from one or more of SEQ ID NOs: 6-11.

[0043] Furthermore, the method is a non-therapeutic method.

[0044] A tenth aspect of the present invention provides a diagnostic system for bovine infectious rhinotracheitis virus infection, the diagnostic system comprising:

[0045] (1) Detection unit: The detection unit is used to detect the expression level of the lncRNA described in the first aspect of the present invention;

[0046] (2) Result judgment unit: The result judgment unit is used to output the diagnosis result of bovine infectious rhinotracheitis virus infection based on the expression amount result detected by the detection unit.

[0047] Furthermore, the result judgment unit includes an input unit, an analysis unit and an output unit.

[0048] Furthermore, the input unit is used to input the expression level of the lncRNA.

[0049] Furthermore, the analysis unit is used to analyze the diagnosis result of bovine infectious rhinotracheitis virus infection based on the expression level of the lncRNA.

[0050] Furthermore, the output unit is used to output the analysis result of the analysis unit.

[0051] Furthermore, if the expression level of the lncRNA is significantly upregulated, it is diagnosed as bovine infectious rhinotracheitis virus infection.

[0052] Advantages and beneficial effects of the present invention:

[0053] This application discovered for the first time a long non-coding RNA6up (lncRNA-6up) in MDBK cell samples infected with bovine infectious rhinotracheitis virus, designed a primer sequence that can detect this gene, and designed and synthesized a small interfering RNA for this gene. Further studies showed that its expression level was significantly upregulated in the virus-infected group, and that silencing lncRNA-6up inhibited viral replication, providing new ideas for the detection of bovine infectious rhinotracheitis virus infection and the treatment of related diseases. BRIEF DESCRIPTION OF THE DRAWINGS

[0054] Figure 1 is a Venn diagram of differentially expressed genes;

[0055] Figure 2 is the lncRNA-6up expression graph;

[0056] Figure 3 This is a diagram showing the interference effect of the interference reagent on lncRNA-6up;

[0057] Figure 4 4A is a diagram of the state of MDBK cells infected with BHV-1, wherein 4B is a diagram of the state of cells after inoculation with lncRNA-6up silenced, 4C is a diagram of the state of MDBK cells infected with BHV-1, and 4D is a diagram of the state of MDBK cells not infected with BHV-1;

[0058] Figure 5 This is the result of the nucleic acid level test of BHV-1;

[0059] Figure 6 6A is a graph showing the relative transcription levels of lncRNA-6up, gB, and gD after lncRNA-6up is silenced, wherein 6B is a graph showing the relative transcription levels of lncRNA-6up, 6C is a graph showing the relative transcription levels of gD, and 6A is a graph showing the relative transcription levels of lncRNA-6up, 6B is a graph showing the relative transcription levels of gB, and 6C is a graph showing the relative transcription levels of gD.

[0060] Figure 7 7A is a graph showing the expression of gB and gD proteins, and 7B is a graph showing the relative quantitative analysis of Western Blot;

[0061] Figure 8 BHV-1 TCID after lncRNA-6up silencing 50 picture;

[0062] Figure 9 9A is a graph showing the results of the plaque assay after lncRNA-6up silencing, and 9B is a statistical graph showing the results of the plaque assay after lncRNA-6up silencing. DETAILED DESCRIPTION

[0063] The following provides definitions of some terms used in this specification. Unless defined otherwise, all technical and scientific terms used herein generally have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.

[0064] The present invention provides a lncRNA, wherein the lncRNA has the following nucleotide sequence:

[0065] (1) the nucleotide sequence shown in SEQ ID NO: 1;

[0066] (2) A nucleotide sequence with equivalent function formed by replacing, deleting or adding one or more nucleotides based on the nucleotide sequence shown in SEQ ID NO: 1.

[0067] As one embodiment of the present invention, replacing, deleting or adding one or several nucleotides preferably means that the nucleotide sequence after such replacement, deletion or addition has a nucleotide sequence that is at least 90%, at least 95%, at least 98%, or at least 99% identical to the nucleotide sequence shown in SEQ ID No: 1, and has basically the same function as the nucleotide sequence shown in SEQ ID NO: 1 in regulating infectious bovine rhinotracheitis virus.

[0068] The present invention provides any of the following substances:

[0069] (1) a vector comprising the aforementioned lncRNA;

[0070] (2) A host cell comprising the above-mentioned lncRNA or the vector described in (1).

[0071] As one embodiment of the present invention, vector refers to a vehicle into which nucleotides can be operably inserted to cause expression of the nucleotides. Vectors can be used for transforming, transducing or transfecting host cells so that the genetic elements carried are expressed in the host cells. Vectors can contain a variety of elements for controlling expression, including promoter sequences, transcription initiation sequences, enhancer sequences, selection elements and reporter genes. In addition, vectors can contain an origin of replication. Vectors can also include materials that help them enter cells, including but not limited to virus particles, liposomes or protein envelopes.

[0072] A promoter is a polynucleotide sequence that is capable of regulating or driving the expression of a polynucleotide sequence in a cell or cell-free transcription system, to which the promoter is operably linked. A promoter may contain a cis-acting initiation element and a conserved box, such as a TATA box and a transcription factor binding motif, that specifies the start site of transcription.

[0073] The vector may be a recombinant expression vector or a cloning vector. Examples of vectors include, but are not limited to, retroviruses (including lentiviruses), adenoviruses, adeno-associated viruses, herpes viruses (e.g., herpes simplex virus), poxviruses, baculoviruses, papillomaviruses, papovaviruses (e.g., SV40), lambda phages and M13 phages, plasmids, including but not limited to pcDNA3.3, pMD18-T, pOptivec, pCMV, pEGFP, pIRES, pQD-Hyg-GSeu, pALTER, pBAD, pcDNA, pCal, pL, pET, pGEMEX, pGEX, pCI, pEGFT, pSV2, pFUSE, pVITRO, pVIVO, pMAL, pMONO, pSELECT, pUNO, pDUO, Psg5L, pBABE, pWPXL, pBI, p15TV-L, pPro18, pTD, pRS10, pLexA, pACT2 .2. pCMV-SCRIPT.RTM., pCDM8, pCDNA1.1 / amp, pcDNA3.1, pRc / RSV, PCR2.1, pEF-1, pFB, pSG5, pXT1, pCDEF3, pSVSPORT, pEF-Bos.

[0074] As one embodiment of the present invention, the host cell can be any cell for which the expression vector is available. Including prokaryotic cells, eukaryotic cells, the prokaryotic cells include but are not limited to true bacteria, such as Gram-negative or Gram-positive organisms, such as Enterobacteriaceae, such as Escherichia, such as Escherichia coli; Enterobacter; Erwinia; Klebsiella; Proteus; Salmonella, such as Salmonella typhimurium; Serratia, such as Serratia marcescens. marcescans); and Shigella, as well as Bacilli, such as B. subtilis and B. licheniformis; Pseudomonas, such as Pseudomonas aeruginosa; and Streptomyces.

[0075] Eukaryotic cells include but are not limited to protist cells, animal cells, plant cells or fungal cells, and the animal cells include mammalian cells, bird cells, and insect cells; wherein mammalian cells include but are not limited to Chinese hamster ovary cells, SP2 / 0 cells, HeLa cells, baby hamster kidney cells, and cancer cells.

[0076] The present invention provides the use of a reagent for detecting the expression level of the above-mentioned lncRNA in the preparation of a product for diagnosing bovine infectious rhinotracheitis virus infection.

[0077] The reagent is selected from a probe that specifically recognizes the lncRNA and a primer that specifically amplifies the lncRNA.

[0078] As one embodiment of the present invention, a probe refers to a molecule that can bind to a specific sequence or subsequence or other part of another molecule. Unless otherwise indicated, a probe generally refers to a polynucleotide probe that can bind to another polynucleotide (often referred to as a target polynucleotide) through complementary base pairing. Depending on the stringency of the hybridization conditions, the probe can bind to a target polynucleotide that lacks complete sequence complementarity with the probe. The probe can be directly or indirectly labeled, and its scope includes primers. Hybridization methods include but are not limited to: solution phase, solid phase, mixed phase or in situ hybridization assays. There is no limit to the length of the probe, as long as it completes specific hybridization and specifically binds to the target nucleotide sequence, any length is acceptable. The length of the probe can be as short as 25, 20, 15, 13 or 10 bases in length. Similarly, the length of the probe can be as long as 60, 80, 100, 150, 300 base pairs or longer, or even the entire gene.

[0079] As one embodiment of the present invention, a primer refers to a short nucleic acid sequence having a short free 3' terminal hydroxyl group (free 3' hydroxyl group), which can form a base pair with a complementary template and serve as a starting point for replicating the template.

[0080] The reagent also includes a detectable label.

[0081] As one embodiment of the present invention, label refers to the composition that can produce the detectable signal that shows that there is target polynucleotide in the assay sample.Suitable label includes but is not limited to radioisotope, nucleotide chromophore, enzyme, substrate, fluorescent molecule, chemiluminescent part, magnetic particle, bioluminescent part.Therefore, label is any composition that can be detected by device or method, includes but is not limited to spectrum, photochemistry, biochemistry, immunochemistry, electricity, optics, chemical detection device or any other suitable device.In some embodiments, label can be detected visually without the aid of device. Label is used to refer to any chemical group or part with detectable physical property or can cause chemical group or part to show any compound of detectable physical property, such as catalytic substrate is converted into the enzyme of detectable product.Label also contains the compound that suppresses the performance of specific physical property.Label can also be the compound as the member of binding pair, and its another member has detectable physical property.

[0082] Among them, radioactive isotopes include but are not limited to 3 H. 14 C. 35 S. 125 I. 131 I.

[0083] Enzymes include, but are not limited to, horseradish peroxidase, beta-galactosidase, luciferase, alkaline phosphatase, acetylcholinesterase.

[0084] Fluorescent molecules include, but are not limited to, FITC, rhodamine, and lanthanide phosphors.

[0085] The product includes a chip, a kit or a nucleic acid membrane strip.

[0086] The kit may also be accompanied by an instruction manual for the kit, which describes how to use the kit for testing, and how to use the test results to judge viral infection and select a treatment plan.

[0087] The components of the test kit can be packaged in the form of an aqueous medium or in a lyophilized form. Suitable containers in the test kit generally include at least a vial, test tube, flask, plastic bottle, syringe or other container, in which a component can be placed, and preferably, can be appropriately divided. When there is more than one component in the test kit, the test kit will generally also include a second, third or other additional container, in which additional components are placed separately. However, the components of different combinations can be contained in a vial. The test kit of the present invention also generally includes a container for accommodating reactants, sealed for commercial sale. Such a container can include a plastic container for injection molding or blow molding, in which the required vial can be retained.

[0088] As one embodiment of the present invention, chip, also referred to as array, refers to a solid support comprising connected nucleic acid or peptide probes. Arrays typically comprise a variety of different nucleic acid or peptide probes connected to a substrate surface at different known positions. These arrays, also referred to as microarrays, can typically be produced using mechanical synthesis methods or light-guided synthesis methods that incorporate a combination of photolithography and solid-phase synthesis methods. The array can comprise a flat surface, or can be a nucleic acid or peptide on a bead, gel, polymer surface, fiber such as an optical fiber, glass, or any other suitable substrate. The array can be packaged in a certain manner to allow for diagnosis of a fully functional device or manipulation of other methods.

[0089] As an embodiment of the present invention, the nucleic acid membrane strip includes a substrate and an oligonucleotide probe fixed on the substrate; the substrate can be any substrate suitable for fixing the oligonucleotide probe, such as a nylon membrane, a nitrocellulose membrane, a polypropylene membrane, a glass sheet, a silica gel wafer, a micro-magnetic bead, etc.

[0090] The present invention provides a pharmaceutical composition for treating diseases related to bovine infectious rhinotracheitis virus infection, wherein the pharmaceutical composition comprises the above-mentioned lncRNA inhibitor.

[0091] As one embodiment of the present invention, treatment may refer to therapeutic treatment or preventative measures, wherein the goal is to prevent or slow down (mitigate) an undesirable physiological condition, disorder or disease, or to obtain a beneficial or desired clinical result. As one embodiment of the present invention, treatment may refer to both treatment and prevention. Beneficial or desired clinical results include, but are not limited to, relief of symptoms; alleviation of the extent of a disorder, disorder or disease; stabilization (i.e., not worsening) of the state of a disorder, disorder or disease; delaying the occurrence of a disorder, disorder or disease or slowing its progression; improving a disorder, disorder or disease state; and alleviation (whether partial or complete) (whether detectable or undetectable) or improvement or amelioration of a disorder, disorder or disease. Treatment may include causing a clinically significant response without excessive side effects. Treatment also includes a prolonged survival period compared to the expected survival period when not receiving treatment.

[0092] As one embodiment of the present invention, the inhibitor includes a nucleic acid molecule, including but not limited to shRNA (small hairpin RNA), small interfering RNA (siRNA), dsRNA, antisense oligonucleotide, or a construct that can express or form the shRNA, small interfering RNA, dsRNA, antisense oligonucleotide.

[0093] In a particular embodiment of the invention, the inhibitor is selected from siRNA. siRNA may include partially purified RNA, substantially pure RNA, synthetic RNA or recombinantly produced RNA and RNA that is different from the changes of natural RNA by adding, deleting, replacing and / or changing one or more nucleotides. The changes may include adding non-nucleotide substances, such as adding to the end of the siRNA or one or more internal nucleotides of the siRNA; making the siRNA resistant to nuclease digestion (e.g., using 2'-substituted ribonucleotides or modifying the sugar phosphate backbone); or replacing one or more nucleotides in the siRNA with deoxyribonucleotides. In addition, as described above for modified oligonucleotides, siRNA can be modified to improve its stability, especially by introducing one or more phosphorothioate linkages to achieve.

[0094] The pharmaceutical composition further includes a pharmaceutically acceptable carrier.

[0095] Pharmaceutically acceptable carriers include, but are not limited to, diluents, binders, surfactants, wetting agents, adsorbents, lubricants, fillers, and disintegrants.

[0096] Among them, diluents such as lactose, sodium chloride, glucose, urea, starch, water, etc.; binders such as starch, pregelatinized starch, dextrin, maltodextrin, sucrose, gum arabic, gelatin, methyl cellulose, carboxymethyl cellulose, ethyl cellulose, polyvinyl alcohol, polyethylene glycol, polyvinyl pyrrolidone, alginic acid and alginates, xanthan gum, hydroxypropyl cellulose and hydroxypropyl methylcellulose, etc.; surfactants such as polyoxyethylene sorbitan fatty acid esters, sodium lauryl sulfate, stearic acid monoglyceride, cetyl alcohol, etc.; wetting agents such as glycerol, starch, etc.; adsorption carriers such as starch, lactose, bentonite, silica gel, kaolin and bentonite, etc.; lubricants such as zinc stearate, monostearin, etc. Fatty acid glycerides, polyethylene glycol, talc, calcium and magnesium stearate, polyethylene glycol, boric acid powder, hydrogenated vegetable oil, sodium stearyl fumarate, polyoxyethylene monostearate, monolauric sucrose ester, sodium lauryl sulfate, magnesium lauryl sulfate, magnesium lauryl sulfate, etc.; fillers such as mannitol (granular or powdered), xylitol, sorbitol, maltose, erythrose, microcrystalline cellulose, polymeric sugars, coupling sugars, glucose, lactose, sucrose, dextrin, starch, sodium alginate, kelp polysaccharide powder, agar powder, calcium carbonate and sodium bicarbonate, etc.; disintegrants such as cross-linked vinyl pyrrolidone, sodium carboxymethyl starch, low-substituted hydroxypropyl methyl, cross-linked sodium carboxymethyl cellulose, soybean polysaccharides.

[0097] As an embodiment of the present invention, the pharmaceutical composition can be manufactured by methods well known in the art, such as conventional granulation, mixing, dissolution, encapsulation, lyophilization or emulsification, etc. The pharmaceutical composition can be prepared in various forms, including granules, precipitates or microparticles, powders (including lyophilized powders, rotary dried powders or spray dried powders, amorphous powders), tablets, capsules, syrups, suppositories, injections, emulsions, elixirs, suspensions or solutions.

[0098] As an embodiment of the present invention, medicine is formulated for administering medicine to mammals, preferably cattle. Such pharmaceutical compositions of the present application can be administered orally, parenterally, by inhalation spray, surface, rectum, nasal, buccal, vaginal or via an implanted reservoir. Parenteral includes subcutaneous, intravenous, intramuscular, intraarticular, intrasynovial, intrasternal, intrathecal, intrahepatic, intralesional and intracranial injection or infusion technology. The pharmaceutical composition can be designed to be short-acting, rapid-release or long-acting. In addition, the pharmaceutical composition can be applied locally rather than systemically.

[0099] The present invention provides a diagnostic system for bovine infectious rhinotracheitis virus infection, the diagnostic system comprising:

[0100] (1) Detection unit: The detection unit is used to detect the expression level of the above-mentioned lncRNA;

[0101] (2) Result judgment unit: The result judgment unit is used to output the diagnosis result of bovine infectious rhinotracheitis virus infection based on the expression amount result detected by the detection unit.

[0102] As an embodiment of the present invention, the system can be programmed to embody multiple aspects of the technology and can be considered as a product in the form of machine (or processor) executable code and / or related data, which is usually executed or embodied in a machine-readable medium. The machine executable code can be stored in an electronic storage unit such as a memory (e.g., read-only memory, random access memory, flash memory) or a hard disk. The storage medium can include any or all tangible memories of a computer, processor, etc., or related modules thereof, such as various semiconductor memories, tape drives, disk drives, etc., which can provide non-transitory storage for software programming at any time. All or part of the software can sometimes be communicated via the Internet or various other communication networks. For example, such communication can enable the software to be loaded from one computer or processor to another, for example, from a management server or host to the computer platform of an application server. Therefore, another type of medium capable of carrying software elements includes optical waves, radio waves, and electromagnetic waves such as physical interfaces between local devices, through wired and fiber optic landline networks, and on various air links. Physical elements that carry such waves, such as wired or wireless links, optical links, etc., can also be considered as media that carry software. As used herein, unless restricted to non-transitory, tangible storage media, terms such as computer or machine readable media refer to any medium that participates in providing instructions to a processor for execution.

[0103] The system of the present invention may be implemented by one or more algorithms. The algorithms may be implemented by software after being executed by a processor.

[0104] The present invention will be further described below with reference to specific examples. It should be understood that the specific embodiments described herein are presented by way of example and are not intended to limit the present invention. The main features of the present invention may be applied to various embodiments without departing from the scope of the present invention.

[0105] Example 1 Detection of lncRNA-6up expression in virus-infected MDBK cells

[0106] 1 Experimental methods

[0107] 1.1 Recovery and passaging of MDBK cells

[0108] MDBK cells were removed from liquid nitrogen and revived, placed in DMEM complete medium containing 10% fetal bovine serum + 1% penicillin-streptomycin double antibody, and cultured in a cell culture incubator (37°C, 5% CO2) for 24-36 hours. When the cell density reached about 80%, they were digested with trypsin-EDTA (0.25%) digestion solution containing phenol red and passaged at a ratio of 1:2. The DMEM complete medium was the same as above and cultured in a cell culture incubator at 37°C, 5% CO2 for 24-36 hours to achieve a cell density of about 80%.

[0109] 1.2 BHV-1 infection of MDBK cells

[0110] MDBK cells grown to about 80% were washed with Hanks solution, and BHV-1 was inoculated into MDBK cells cultured to a monolayer at a dose of 1 MOI. After 1 h, DMEM culture medium containing only 1% penicillin and streptomycin was added, and the cells were cultured in a cell culture incubator (37°C, 5% CO2). At the same time, cells not inoculated with the virus were set as the control group. The cytopathic effect (CPE) was observed and photographed at different times after infection (18 h, 24 h, and 33 h).

[0111] 1.3 Sampling

[0112] Sampling was performed at different time periods (18 h, 24 h, and 33 h). The samples were first washed with Hanks solution, then digested with Trizol, and finally collected into nuclease-free cell cryopreservation tubes. The cryopreservation tubes were sealed with sealing film, quickly frozen in liquid nitrogen, and then transported on dry ice to Guangzhou Kidio Biotechnology Co., Ltd. for high-throughput sequencing.

[0113] 1.4 High-throughput sequencing

[0114] Transcriptome sequencing of the samples was performed using Illumina HiSeq second-generation high-throughput sequencing technology. After total RNA was extracted, ribosomal RNA was removed to maximize the retention of all coding RNAs and lncRNAs. The resulting RNA was randomly fragmented into short fragments. The fragmented RNA was then used as a template for first-strand cDNA synthesis using six-base random primers. Second-strand cDNA was then synthesized using buffer, dNTPs (dUTP instead of dTTP), RNase H, and DNA polymerase I. Purification was performed using a QiaQuick PCR kit, elution with EB buffer, end-repair, addition of A bases, and sequencing adapters. The second-strand cDNA was then degraded with UNG (Uracil-N-Glycosylase) enzyme, and sequencing libraries were constructed. The constructed sequencing libraries were then sequenced using an Illumina HiSeq™ 4000.

[0115] 1.5 lncRNA transcript analysis and statistics

[0116] After filtering the offline data to obtain clean data, the reads were compared to the reference genome using Hisat2. Because the sources of lncRNAs are complex and different transcripts from the same gene can produce significant differences in lncRNAs, lncRNA analysis is performed based on transcripts. Currently, lncRNA research is incomplete, necessitating the prediction of novel lncRNAs. The identification steps are as follows: ① Reconstruct transcripts using Stringtie software; ② Filter transcripts with a length ≥ 200 bp and a number of exons ≥ 2 (≥ 1 for plant samples); ③ Predict the coding capacity of novel transcripts using CPC and CNCI software, taking the intersection of these transcripts without coding potential as the reliable prediction result.

[0117] In this study, gene expression is expressed in FPKM (fragments per kilobase of transcript per million mapped reads), which is the number of sequenced fragments per thousand sequenced bases per million sequenced bases. In this study, a lncRNA FPKM > 0.5 was considered expressed. Expression distribution plots were used to visualize the expression distribution of lncRNA transcripts across different samples.

[0118] 1.6 lncRNA overall differential analysis

[0119] According to the experimental design, differentially expressed lncRNAs were screened at three different time periods (18 hours, 24 hours, and 33 hours) after MDBK cells were infected with BHV-1. The groups with the highest number of differentially expressed lncRNAs were identified by comparing the experimental groups with the control group and by pairwise comparisons between the experimental groups. Based on the results of the differential analysis, the differentially expressed lncRNAs were analyzed using DESeq2 software. lncRNAs with a FDR < 0.05 and |log2FC| > 1 were identified as significantly differentially expressed lncRNAs. After identifying the differentially expressed lncRNA genes in each group, the conditional function (ifelse) was used to add gene expression significance to the differentially expressed genes. The criteria for determining gene expression significance were: log2FC > 1 and FDR < 0.05 for up-regulated genes, and log2FC < -1 and FDR < 0.05 for down-regulated genes.

[0120] 1.7 RT-qPCR detection

[0121] 1) Primer design

[0122] Primers were designed based on the gene sequences of lncRNA-6up and UCHL5. The specific primer sequences are as follows:

[0123] lncRNA-6up gene:

[0124] The forward primer was 5′GCCCTCAATCTTTCCCAGCATC 3′ (SEQ ID NO: 2);

[0125] The reverse primer was 5'GGCAGCAAGGAGATCAAACCAGT 3' (SEQ ID NO: 3).

[0126] UCHL5 gene:

[0127] The forward primer was 5′ACAAAGACAACTTGCTGAGGAACCC 3′ (SEQ ID NO: 4);

[0128] The reverse primer was 5'GGCAACCTCTGACTGAATAGCACTT 3' (SEQ ID NO: 5).

[0129] 2) RT-qPCR amplification

[0130] Real-time fluorescence quantitative PCR primers for differentially expressed lncRNA genes were designed using Primer Premier 3 software and aligned with NCBI. Primers were synthesized at Shanghai Bioengineering Co., Ltd. The RT-qPCR reaction system is detailed in Table 1.

[0131] Table 1 RT-qPCR reaction system

[0132]

[0133] The program conditions of RT-qPCR were as follows: 95°C for 120 s; 95°C for 20 s, 58°C for 20 s, 40 cycles; 95°C for 15 s, 60°C for 60 s, 98°C for 1 s, 1 cycle.

[0134] Ubiquitin C-terminal hydrolase L5 (UCHL5) was used as an internal reference gene. The relative transcript levels of each lncRNA were analyzed using the ΔΔCt method and t-test. Each experiment was repeated three times with three replicates per gene, and the average of the relative transcript levels was calculated. The relative transcript levels of each lncRNA were calculated using the following formula: relative lncRNA expression = -2ΔΔCt, where ΔCt value = target gene Ct value - reference gene Ct value. qRT-PCR results were processed and analyzed for significance using GraphPad Prism software and SPSS 19.0. Statistically significant differences were considered when p < 0.05. *: p < 0.05, **: p < 0.01, ***: p < 0.001, ****: p < 0.0001.

[0135] 2 Experimental results

[0136] The sequencing results showed that 775 lncRNAs were significantly differentially expressed in MDBK cells at 18 hours, 24 hours, and 33 hours after IBRV infection compared with the blank control group, and 681 lncRNAs were newly discovered ( Figure 1 ).

[0137] lncRNA-6up was selected for RT-qPCR, and the results showed that its expression level was significantly upregulated in the virus infection group ( Figure 2 ), the sequence of lncRNA-6up is shown in SEQ ID NO: 1.

[0138] lncRNA-6up sequence:

[0139]

[0140] Example 2 Detection of the role of lncRNA-6up in IBRV replication

[0141] 1 Experimental methods

[0142] 1.1 Cell culture

[0143] The bovine kidney cell line MDBK was maintained in the Cell Biology Laboratory, College of Life Science and Technology, Heilongjiang Bayi Agricultural University. All cell lines were cultured in DMEM supplemented with 10% fetal bovine serum and 1% P / S in a 37°C, 5% CO2 incubator. Cell growth was observed daily, and the medium was changed every other day.

[0144] 1.2 Transfection

[0145] 1.2.1 siRNA Synthesis

[0146] Guangzhou Ruibo Biotechnology Co., Ltd. synthesized the interfering siRNA-lncRNA-6up targeting lncRNA-6up, and the control was a universal siRNA-NC. The sequence of the interfering siRNA-lncRNA-6up is as follows:

[0147] (1)CTTATCCCACATTCAGAGTA(SEQ ID NO:6)

[0148] (2)TCTTTCTCCTTGGCTTCCTA (SEQ ID NO:7)

[0149] (3)CTTCGCCATTCCTTATTCCC(SEQ ID NO:8)

[0150] (4)CCTTTAATTCCCAGTTTCA(SEQ ID NO:9)

[0151] (5)GATGTAATTCTCACAATGA(SEQ ID NO:10)

[0152] (6) CCTCCTATTGATCCTATTA (SEQ ID NO: 11).

[0153] 1.2.2 Transfection

[0154] The experiment was divided into four groups: a blank control group (MDBK) without any treatment, a positive control group (MB group) of MDBK infected with BHV-1, a negative control group (siRNA NC), and an experimental group (siRNA-lncRNA-6up). Transfection was performed according to the instructions of the transfection reagent provided by Guangzhou Ruibo Biotechnology Co., Ltd.

[0155] The specific steps are as follows:

[0156] One day before transfection, MDBK cells were plated at a concentration of 5 × 10 5 The cells were seeded into 6-well plates at a density of 60-80% at the time of transfection. The cells were then divided into the following groups: an experimental group containing the target interference sequence (siRNA-ASO-lncRNA-6up), a negative control group containing the interference control sequence (siRNA-ASO NC), a BHV-1-infected MDBK control group (MB group), and an untreated MDBK cell group (Blank group).

[0157] Transfection and virus infection

[0158] First, wash the riboFECT with sterile 1× PBS. TM CP Buffer (10×) was used to dilute riboFECT TM CP Buffer (1×). TM Remove the CP Reagent from 4°C, shake it thoroughly on a vortex shaker, and place it at room temperature to allow it to return to room temperature. TM CP Buffer (V1) was added to a nuclease-free centrifuge tube, followed by 1.25 μL of 20 μM smart silencers iRNA storage solution (V2), gently mixed and incubated at room temperature for 5 minutes. Then, 3 μL of riboFECT TM CP Reagent (V3) and mix well, incubate at room temperature for 15 minutes. TM The CP mixture was added to an MDBK cell culture plate pre-filled with 465.75 μL of cell culture medium (V4), gently mixed, and the plate was incubated at 37°C in a 5% CO2 incubator for 24 h. The original culture medium was discarded, and BHV-1 was inoculated into MDBK cells at an MOI of 1. Adsorption was allowed for 1 h at 37°C in 5% CO2. DMEM supplemented with 1% penicillin-streptomycin was then added and incubated at 37°C in 5% CO2. Cytopathic effect (CPE) was observed and photographed every h after 24 h of infection. Samples were collected when cracks and pea-sized holes were observed in the cell layer. The cell culture medium was discarded, and the cells were washed twice with sterile Hanks' gel and digested with Trizol for 1-2 min. Finally, the cells were pipetted off and collected in nuclease-free cryovials. Some samples were used directly in the next step, while others were sealed in cryovials with parafilm and stored at -80°C.

[0159] 1.3 RT-qPCR detection of lncRNA-6up expression level in cells

[0160] After 48 h of transfection and culture of cells in each group, total cellular RNA was extracted using the Trizol method, and reverse transcription and real-time quantitative PCR were performed according to the method in Example 1.

[0161] 1.4 IBRV replication-related detection

[0162] 1.4.1 Detection of viral nucleic acid

[0163] To examine the effect of lncRNA-6up on IBRV DNA replication, cells were collected from each sample group described in Example 1. DNA was then extracted using the Tiangen Biotech Company viral DNA extraction kit (DP315). TaqMan fluorescent quantitative PCR was used to detect the amount of BHV-1 viral nucleic acid. Based on the Bovineherpesvirus 1, complete genome NCBI Reference Sequence: NC-001847.1 DNA sequence published in NCBI GenBank, TaqMan probes and primers were designed using Primer 3.0 software. The probes were labeled with a 6-FAM fluorescent group at the 5' end and a BHQ1 quencher at the 3' end. Primers (Table 2) and probes (Table 3) were synthesized by Shanghai Bioengineering Co., Ltd. The TaqMan fluorescent quantitative PCR reaction system is detailed in Table 4.

[0164] Table 2 TaqMan fluorescence quantitative PCR primer sequences

[0165]

[0166] Table 3 TaqMan fluorescent quantitative PCR probe sequences

[0167]

[0168] Table 4 TaqMan fluorescence quantitative PCR reaction system

[0169]

[0170] The program conditions of TaqMan fluorescence quantitative PCR were as follows: 95°C for 600 s; 95°C for 30 s, 58°C for 30 s, for 45 cycles.

[0171] 1.4.2 Detection of IBRV transcription levels

[0172] In order to detect the effect of lncRNA-6up on IBRV RNA levels, the present invention collected cells from each group of samples in Example 1, removed the cell culture medium, washed the cells twice with sterile Hanks, digested the cells with Trizol for 1-2 minutes, and finally blew off the cells with a pipette. The samples were collected using a nuclease-free cell cryopreservation tube. Total RNA was extracted from each group of samples using the RNA extraction kit RC101 from Novozymes, and then the RNA was reverse transcribed into cDNA using the Novozymes cDNA synthesis kit. The synthesized cDNA was used as a template for real-time fluorescence quantitative PCR. The primers in Table 5 were used to detect the transcription levels of the IBRV surface glycoprotein gB and gD genes in each group by RT-PCRq. The reaction system of RT-qPCR is detailed in Table 6. The internal reference gene is ubiquitin C-terminal hydrolase L5 (UCHL5). The relative lncRNA transcript levels for each gene were analyzed using the t-test and ΔΔCt method. Each experiment was repeated three times with three replicates per gene, and the average of the relative transcript levels was calculated. The relative transcript levels of each lncRNA were calculated using the following formula: lncRNA relative expression = 2 - ΔΔCt, where ΔCt = Ct value of target gene - Ct value of reference gene. qRT-PCR results were analyzed and significance was determined using GraphPad Prism statistical software. *: p < 0.05, **: p < 0.01, ***: p < 0.001, ****: p < 0.0001, indicating statistical significance.

[0173] Table 5 RT-qPCR primer sequences

[0174]

[0175] Table 6 RT-qPCR reaction system

[0176]

[0177]

[0178] The program conditions of RT-qPCR were as follows: 95°C for 120 s; 95°C for 20 s, 58°C for 20 s, 40 cycles; 95°C for 15 s, 60°C for 60 s, 98°C for 1 s, 1 cycle.

[0179] 1.4.3 Detection of IBRV protein levels

[0180] Cells were collected from each group of samples in Example 1 and lysed with a high-efficiency RIPA cell lysis buffer (Solarbio). The samples were placed on ice for 30 minutes, gently tapped every 10 minutes, and the cells were processed with a cell scraper and transferred to a centrifuge tube. The cells were centrifuged at 12000 rpm / min for 5 minutes at 4°C. The supernatant was aspirated and packaged, stored, and the protein was quantified using a BCA protein quantification kit to determine its concentration. PAGE separation gel and stacking gel were then configured. After the gel solidified, the gel was placed in an electrophoresis tank and loaded in the order of the samples. The loading amount of each sample was 20 μg, 80V, and after 30 minutes, the voltage was switched to 120V, and then electrophoresis was performed for 1 hour. After the electrophoresis is completed, the gel is removed and the gel is cut off; filter paper, nitrocellulose membrane (NC membrane), gel, and filter paper soaked in transfer solution are placed in the semi-dry transfer tank in sequence, and the bubbles are driven out with a glass rod. After the installation is completed, the transfer tank lid is covered, the power is turned on, and the membrane is transferred under a 200mA constant current for 2 hours; the transferred NC membrane is washed with TBST and then soaked in 5% skim milk and blocked at room temperature for 2 hours; the NC membrane is removed, washed with TBST 3 times, and the primary antibody (monoclonal antibodies against BHV-1 virus gB and gD proteins, respectively) diluted at 1:500 is added, and incubated overnight at 4°C; the NC membrane is washed with TBST 3 times, and goat anti-mouse IgG-HRP antibody diluted at 1:2000 is added, and incubated at room temperature for 1 hour; the NC membrane is washed with TBST 3 times, and then ECL color development solution is used for color development and photography, and images are developed and photographed by a chemiluminescence imaging system, and protein quantitative analysis is performed using ImageJ image analysis software.

[0181] 1.4.4IBRV TCID 50 Detection

[0182] Cells were collected from each sample group in Example 1, digested with trypsin containing EDTA, and placed in DMEM medium containing 10% FBS to prepare a cell suspension at a cell density of 5×10 5 Cells / mL, 100 μL / well were plated into a 96-well plate and cultured until the cell confluency reached 80%. Take 9 sterile, clean 1.5 mL centrifuge tubes, add 900 μL of serum-free DMEM medium to each, then pipette 100 μL from the virus solution and add it to the first centrifuge tube. Use a pipette to mix thoroughly, then pipette out 100 μL of the mixture and add it to the second centrifuge tube. Repeat this process to dilute the virus solution 10-fold to 10. -1 , 10 -2 , 10 -3 , 10 -4 , 10 -5 , 10 -6 , 10 -7 and 10-8 ; The diluted viruses of each group were added to a 96-well plate at 10 μL / well. Eight replicate wells were prepared for each dilution. The control was the last three columns, one of which contained undiluted virus solution as a positive control, and the other two columns contained only MDBK cells as negative controls. The experiment was repeated three times independently. The 96-well plate was placed in a 37°C, 5% CO2 incubator for 1 hour. After that, 90 μL of DMEM medium containing only 1% penicillin-streptomycin double antibody was added to each well and placed in a 37°C, 5% CO2 incubator for 24 hours. The cell pathological changes were observed and the TCID was calculated based on the number of wells with pathological changes. 50 / 100μL. The Reed-Muench algorithm was used to calculate the TCID of the treated strain. 50 Distance ratio = (percentage above 50% - 50%) / (percentage above 50% - percentage below 50%), LgTCID 50 = distance ratio × difference between logarithms of dilution + logarithm of dilution with lesion rate higher than 50%.

[0183] 1.4.5 Pathological changes and grouping of BHV-1-infected cells after lncRNA-6up silencing

[0184] To investigate the pathological changes in MDBK cells following lncRNA-6up silencing and BHV-1 infection, this study observed the pathological changes in the cells 33 hours after infection after BHV-1 infection. The experimental groups were as follows: an experimental group containing an interfering targeting sequence (6T group), a negative control group containing an interfering control sequence (NC group), an MDBK cell group infected with BHV-1 (MB group), and a control group of MDBK cells not infected with BHV-1 (Blank group).

[0185] 1.4.6 Virus TCID 50 Detection and grouping

[0186] To investigate the effect of lncRNA-6up silencing and BHV-1 infection on viral production, a Tissue Culture Infective Dose 50% (TCID 50) was measured, and the experimental groups were: experimental group containing lncRNA-6up interference target sequence (6T group), negative control group containing control sequence (NC group), and MDBK cell control group infected with BHV-1 (MB group). The number of cytopathic effect (CPE) wells in each dilution was observed under a microscope. The occurrence of lesions was indicated as CPE+, and the absence of lesions was indicated as CPE-. Generally, when CPE occurs, it can be observed under a microscope that the cell boundaries become blurred and irregular, plaques, vacuoles, and wire mesh appear, and the plaques become larger and fall off. The number of CPE wells was recorded, as shown in Tables 7-9. The data were calculated using the Reed-Muench method, and the TCID of each group was 0. 50 The values ​​are as follows: TCID of the 6T group 50 is 10 -4.28 / 0.1mL, TCID of NC group 50 is 10 -4.53 / 0.1mL, TCID of MB group 50 is 10 -5.58 / 0.1mL, the obtained TCID 50 Plot the values ​​in a bar graph.

[0187] Table 7 TCID of 6T group 50

[0188]

[0189] Table 8 TCID of NC group 50

[0190]

[0191] Table 9 TCID of MB group 50

[0192]

[0193] 2 Experimental results

[0194] 2.1 Detection of the effect of lncRNA-6up transfection

[0195] The transfection results showed that, with the expression level of lncRNA-6up in the control group as the benchmark set at 1, the expression level of lncRNA-6up was significantly downregulated in the experimental group after transfection with siRNA-lncRNA-6up compared with the control group, while the expression level of lncRNA-6up in the negative control transfected with siRNA NC did not change significantly.

[0196] Virus replication-related tests showed that lncRNA-6up promoted the replication of IBRV in MDBK cells.

[0197] 2.2 Detection of the interference effect of interference reagents on lncRNA-6up

[0198] Interference reagents have a good interference effect on lncRNA-6up ( Figure 3 ).

[0199] 2.3 Detection of lncRNA-6up Silencing and Viral Infection

[0200] 2.3.1 Pathogenicity of BHV-1-infected Cells after lncRNA-6up Silencing

[0201] The results of the pathological changes of MDBK cells after lncRNA-6up was silenced and infected with BHV-1 showed that the pathological changes of 6T cells were alleviated compared with the NC group and MB group, indicating that lncRNA-6up silencing inhibited the occurrence of BHV-1 pathological changes ( Figure 4 ).

[0202] 2.3.2 Viral nucleic acid level test results

[0203] Taqman real-time fluorescence quantitative PCR was used to detect the viral nucleic acid load. The results showed that the effect of lncRNA-6up silencing on BHV-1 nucleic acid replication showed that the amount of BHV-1 viral nucleic acid in the 6T group was significantly reduced compared with the negative NC control group and the BHV-1 infected MDBK cell group, indicating that lncRNA-6up silencing inhibited the replication of viral nucleic acid ( Figure 5 ).

[0204] 2.3.3 Detection results of viral glycoprotein gB and gD transcription levels

[0205] To further determine the effect of lncRNA-6up gene silencing on BHV-1 proliferation, lncRNA-6up was silenced and BHV-1 virus was inoculated, and the transcription levels of lncRNA-6up gene, viral glycoprotein gB and gD genes were detected. Figure 6 As shown in the results, when lncRNA-6up was silenced and infected with the virus, the transcription level of lncRNA-6up in the 6T group was significantly decreased compared with the NC group containing the control sequence and the MB control group of BHV-1-infected MDBK cells. The transcription levels of viral glycoproteins gB and gD were also significantly decreased, which also indicated that lncRNA-6up promoted the replication of BHV-1 virus in MDBK cells.

[0206] 2.3.4 Viral glycoprotein gB and gD protein level detection results

[0207] To determine the effect of lncRNA-6up on the levels of viral glycoproteins gB and gD, we silenced lncRNA-6up and infected BHV-1, and then analyzed the protein expression levels by WB. The results are shown in Figure 2. Figure 7 As shown in the figure, the protein expression levels of gB / gD in the 6T group were significantly reduced compared with the NC and MB groups, indicating that silencing of lncRNA-6up would inhibit viral replication.

[0208] 2.3.5 Virus TCID 50 Test results

[0209] The results are as follows Figure 8 As shown, TCID of 6T group 50 The TCID values ​​of the virus after lncRNA-6up silencing were compared with those of the NC control group and the MB control group. 50 The value increased, indicating that lncRNA-6up suppressed viral replication after silencing.

[0210] 2.3.6 Plaque assay results

[0211] The virus yield was then further tested by plaque assay. In the plaque assay, the dilution with 10-100 plaques was generally selected for calculation. -3 -10 -5 The results of the spot picture are as follows Figure 9 As shown in Figure A, it can be seen from the figure that 10 -3 The number of spots at dilution is greater than 100, 10 -5 The number of spots at the dilution is less than 10, so the -4 The number of plaques was calculated based on the dilution, where the virus titer of 6T was 6.33×10 5 (PFU / mL), and the virus titer of NC was 9.83×10 5 (PFU / mL), and the virus titer of MB was 1.15×10 6 (PFU / mL). Statistical results are as follows Figure 9 As shown in B, the viral titer in the 6T group was lower than that in the NC and MB groups, indicating that silencing of lncRNA-6up inhibited viral replication.

[0212] The above embodiments are only provided for understanding the method and core concept of the present invention. It should be noted that, without departing from the principles of the present invention, a number of improvements and modifications may be made to the present invention by a person skilled in the art, and such improvements and modifications shall fall within the scope of protection of the claims of the present invention.

Claims

1. A lncRNA, characterized in that: The nucleotide sequence of the lncRNA is shown in SEQ ID NO:

1.

2. Any of the following substances: (1) A vector comprising the lncRNA according to claim 1; (2) A host cell comprising the lncRNA according to claim 1 or the vector according to (1).

3. The substance according to claim 2, characterized in that The vector also includes at least one promoter.

4. A pharmaceutical composition for treating diseases related to bovine infectious rhinotracheitis virus infection, characterized in that: The pharmaceutical composition comprises the lncRNA inhibitor according to claim 1, wherein the inhibitor is selected from siRNA, and the sequence of the siRNA is selected from one or more of SEQ ID NOs: 6-11.

5. The pharmaceutical composition according to claim 4, characterized in that The disease related to bovine infectious rhinotracheitis virus infection is bovine infectious rhinotracheitis.

6. Use of the lncRNA inhibitor according to claim 1 in the preparation of a pharmaceutical composition for treating diseases related to bovine infectious rhinotracheitis virus infection.

7. The use according to claim 6, characterized in that: The pharmaceutical composition also includes a pharmaceutically acceptable carrier.

8. The use according to claim 6, characterized in that: The disease related to bovine infectious rhinotracheitis virus infection is bovine infectious rhinotracheitis.

9. A method for screening candidate substances for treating diseases related to bovine infectious rhinotracheitis virus infection, characterized in that: The method comprises: 1) contacting a test substance with a culture system expressing the lncRNA gene according to claim 1; 2) Selecting a test substance that reduces the expression level of the lncRNA gene compared to the expression level detected in the absence of the test substance.

10. The method according to claim 9, characterized in that The disease related to bovine infectious rhinotracheitis virus infection is bovine infectious rhinotracheitis.

11. Use of the lncRNA according to claim 1 in screening candidate substances for treating diseases related to bovine infectious rhinotracheitis virus infection.

12. The use according to claim 11, characterized in that: The disease related to bovine infectious rhinotracheitis virus infection is bovine infectious rhinotracheitis.

13. A method for inhibiting the replication of bovine infectious rhinotracheitis virus in vitro, characterized in that: The method comprises administering the lncRNA inhibitor of claim 1.

14. The method according to claim 13, characterized in that lncRNA inhibitors regulate the level of glycoprotein by inhibiting the expression level of lncRNA to regulate the replication of bovine infectious rhinotracheitis virus.

15. The method according to claim 14, characterized in that The glycoprotein includes gB and / or gD protein.

16. The method according to claim 13, characterized in that The inhibitors include nucleic acid molecules, small molecule chemicals, and nucleic acid constructs.

17. The method according to claim 16, characterized in that The nucleic acid molecules include siRNA, shRNA, dsRNA, ribozymes, and antisense oligonucleotides.

18. The method according to claim 17, characterized in that The inhibitor is selected from siRNA.

19. The method according to claim 18, characterized in that The sequence of the siRNA is selected from one or more of SEQ ID NOs: 6-11.

Images