A molecular marker related to high altitude adaptation in sheep and its application

Abstract

The present invention belongs to the field of genetic biology technology, and specifically relates to a molecular marker related to high-altitude adaptation of sheep and its application. The molecular marker is a combination of DNA fragments shown in SEQ ID NO.1-3 and a combination of DNA fragments shown in SEQ ID NO.4-6; the combination of DNA fragments shown in SEQ ID NO.1-3 corresponds to the sheep β-globin locus A haplotype, and the haplotype sheep has high-altitude adaptability; the combination of DNA fragments shown in SEQ ID NO.4-6 corresponds to the sheep β-globin locus B haplotype, and the haplotype sheep does not have high-altitude adaptability. The present invention also provides a specific primer pair and a detection method for detecting the structural variation. The molecular marker of the present invention reveals that the sheep β-globin locus A haplotype is related to high-altitude adaptation, which can be used for the introduction of sheep high-altitude adaptability and variety breeding.

Description

Technical Field

[0001] The invention belongs to the technical field of genetic biology, and in particular relates to a molecular marker related to high-altitude adaptation of sheep and an application thereof. Background Art

[0002] The Qinghai-Tibet Plateau is the highest plateau in the world, with an average altitude of more than 4,000 meters. It is known as the "Roof of the World" and the "Third Pole" and is the source of many major rivers in Asia. On the Qinghai-Tibet Plateau, livestock migration and grazing are very common. With the migration of humans, livestock continue to adapt to various geographical environments and provide local residents with a variety of livestock products necessary for life. Humans and animals show convergent evolution in the process of adapting to high-altitude environments, that is, adapting to local environments through similar molecular genetic mechanisms.

[0003] Sheep is the most common livestock on the Qinghai-Tibet Plateau (>20 million), one of the oldest local sheep breeds in my country, and a unique livestock resource on the Qinghai-Tibet Plateau. It has the characteristics of cold resistance, roughage resistance, and strong disease resistance, and can adapt well to the hypoxic environment at high altitudes on the Qinghai-Tibet Plateau. Currently, the use of whole genome scanning technology has identified a variety of molecular mechanisms related to the high-altitude adaptability of Tibetan sheep and related genetic variations, such as EPAS1, GNPAT, CRYAA, CDT1, PPARG and MMP3 genes, which are mainly related to energy metabolism and oxygen transport, hypoxia response, and resistance to ultraviolet radiation.

[0004] Hemoglobin is the only oxygen transport protein in the blood, and its oxygen affinity determines its oxygen transport capacity. Hemoglobin beta-chain (HBB) gene plays a vital role in regulating the transport and exchange of oxygen and carbon dioxide. The single nucleotide polymorphism (SNP) of this gene may enhance the binding ability of hemoglobin to oxygen or inhibit the sensitivity of hemoglobin to allosteric factors, which is an important molecular mechanism for high-altitude vertebrates to adapt to the plateau hypoxic environment. In addition, unknown genomic elements such as large fragment structural variation may also be involved in regulating the key physiological phenotype functions of plateau adaptation. Therefore, the genetic correlation analysis between large fragment structural variation and key physiological phenotypes of sheep at high altitude needs further study. Summary of the invention

[0005] In order to solve the above technical problems, the present invention provides a molecular marker related to high altitude adaptation of sheep and application thereof.

[0006] In a first aspect, the present invention provides a molecular marker related to high altitude adaptation of sheep, wherein the molecular marker is a combination of DNA fragments shown by SEQ ID NOs. 1 to 3 and a combination of DNA fragments shown by SEQ ID NOs. 4 to 6.

[0007] Furthermore, the combination of DNA fragments shown in SEQ ID NOs. 1 to 3 corresponds to the sheep β-globin locus A haplotype, and sheep with this haplotype have high altitude adaptability; the combination of DNA fragments shown in SEQ ID NOs. 4 to 6 corresponds to the sheep β-globin locus B haplotype, and sheep with this haplotype do not have high altitude adaptability.

[0008] In a second aspect, the present invention provides primers for detecting the molecular markers, wherein the primers for detecting the combination of DNA fragments shown in SEQ ID NOs. 1 to 3 are shown in SEQ ID NOs. 7 to 12, and the primers for detecting the combination of DNA fragments shown in SEQ ID NOs. 4 to 6 are shown in SEQ ID NOs. 13 to 18.

[0009] In a third aspect, the present invention provides a kit for detecting the molecular marker, wherein the kit comprises the primers and reagents for PCR amplification.

[0010] As described above, the reagents used for PCR amplification are 2×Rapid Taq Master Mix and ddH2O.

[0011] In a fourth aspect, the present invention provides the use of the molecular marker, the primer or the kit in identifying the high altitude adaptability of sheep.

[0012] In a fifth aspect, the present invention provides the use of the molecular marker, the primer or the kit in sheep breeding.

[0013] Furthermore, the breeding is to cultivate sheep breeds with high altitude adaptability.

[0014] In a sixth aspect, the present invention provides a method for identifying high altitude adaptability of sheep, comprising the following steps:

[0015] Using the primers, PCR amplification is performed on sheep genomic DNA to obtain an amplified product;

[0016] Identify the amplified product;

[0017] If the DNA fragments shown by SEQ ID NOs. 1 to 3 are all present, and the DNA fragments shown by SEQ ID NOs. 4 to 6 are all absent, it is determined that the sheep to be tested has high altitude adaptation characteristics;

[0018] If the DNA fragments shown by SEQ ID NOs. 1 to 3 are all absent, and the DNA fragments shown by SEQ ID NOs. 4 to 6 are all present, it is determined that the sheep to be tested does not have the high altitude adaptation characteristics.

[0019] Furthermore, in the PCR amplification reaction, the amplification system is 10 μL, which includes 1 μL of 50-100 ng / μL sheep blood genomic DNA template to be tested, 0.2 μL of 10 μM forward primer and reverse primer, 5 μL of 2×Rapid Taq Master Mix, and 3.6 μL of ddH2O.

[0020] Furthermore, in the PCR amplification reaction, the amplification reaction procedure was: 94°C pre-denaturation for 3 min, 94°C denaturation for 10 sec, 58°C annealing for 20 sec, 72°C extension for 1 min, 36 cycles; 72°C extension for 5 min, and 4°C storage.

[0021] The present invention has the following beneficial effects:

[0022] (1) The present invention uses PacBio HiFi data from 13 different breeds of sheep and combines it with the second-generation sequencing data of 924 domestic sheep to perform haplotype detection on the candidate region (chr15: 47,954,795-48,033,976). It is found that the B haplotype in the candidate region has a low coverage in this region due to the presence of a large fragment deletion of about 40 kb, while the homozygous carrier has almost no coverage ( Figure 1 ), further analysis of coverage showed that the frequency of haplotype A increased with increasing altitude, and it can be used as a molecular marker for high-altitude adaptation breeding of sheep.

[0023] (2) The frequency of the structural variation A haplotype provided by the present invention is 0.93 in high-altitude sheep populations, and is only 0.24 in low-altitude sheep populations, indicating that it has a high genetic correlation with sheep high-altitude adaptation, laying a foundation for molecular marker-assisted selection of sheep high-altitude adaptation.

[0024] (3) The method of the present invention for detecting the structural variation between base 47954795 and base 48033976 of chromosome 15 in the sheep blood genome is simple to operate, the results are accurate and reliable, and it can further realize the analysis of the functional differences of HBB haplotypes. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 Schematic diagram of the structure of the sheep β-globin locus (A), and the genomic arrangement of the β-globin gene region of argali, high altitude (Tibet) and low altitude (Texel) sheep (B). Red triangles indicate primer positions.

[0026] Figure 2 It is the agarose gel electrophoresis result of two haplotype structural variation products amplified by PCR reaction. P1-P6 are the 1st to 6th pairs of primers. High refers to the sheep to be tested at high altitude, and Low refers to the sheep to be tested at low altitude.

[0027] Figure 3 At 37℃ and pH=7.4, the Hb solution of sheep A haplotype and B haplotype in Cl - and DPG are not present (stripped) and 0.1mol / L Cl - Oxygen dissociation curves in the presence of (0.1 mol / L KCl) and DPG (concentration is twice that of Hb). DETAILED DESCRIPTION

[0028] The present invention is described in detail below in conjunction with the accompanying drawings and specific examples, but should not be construed as limiting the present invention. Unless otherwise specified, the technical means used in the following examples are conventional means well known to those skilled in the art, and the materials, reagents, etc. used in the following examples, unless otherwise specified, can be obtained from commercial sources.

[0029] Example 1: Genome-wide analysis of potential functional variation in the sheep β-globin locus and high-altitude adaptation

[0030] Using PacBio HiFi data from 13 different sheep breeds, structural variation of the β-globin locus was detected, and the coverage of the candidate region (chr15: 47,954,795-48,033,976) was divided by the average coverage of chromosome 15 to distinguish haplotypes A and B. The results showed that Tibetan sheep, Yunnan sheep, Merino sheep, East Friesian sheep, Ujumchin sheep and Charolais sheep carried haplotype A, while Kazakh sheep, Dorset sheep, Romney sheep, Suffolk sheep, Texel sheep, Dorper sheep and Sunite sheep carried haplotype B.

[0031] Using the second-generation sequencing data of 924 domestic sheep, the distribution of haplotype A in sheep populations at different altitudes around the world was studied. The coverage analysis results showed that the frequency of haplotype A increased with increasing altitude. For example, in 98 high-altitude sheep (habitat altitude of about 5000m), the frequency of haplotype A was 0.93, while in 422 low-altitude sheep (habitat altitude of about 1000m), the frequency of haplotype A was only 0.24.

[0032] Therefore, this structural variation can be used to predict the high-altitude adaptation characteristics of individual sheep, providing important guidance for the introduction and breeding of sheep in plateau areas. When sheep carry an insertion-type structural variation (haplotype A), it is judged that the sheep has a strong adaptability to high altitudes. When sheep carry a deletion-type structural variation (haplotype B),

[0033] The sheep is judged to have weak adaptability to high altitudes. By hybridizing excellent individuals carrying deletion-type structural variations with local breeds, high-altitude adaptability genes can be introduced to improve the overall adaptability of hybrid offspring. At the same time, using molecular marker-assisted selection technology, individuals carrying deletion-type structural variations can be screened out, further accelerating the sheep breeding process in plateau areas.

[0034] Example 2: Identification of structural variation types in sheep β-globin locus

[0035] 1. Extract genomic DNA from sheep blood

[0036] Blood samples were collected from 39 sheep living in plateau areas and 30 sheep living in non-plateau areas from various parts of China. Detailed information is shown in Table 1. Genomic DNA in the blood was extracted using the Blood Genomic DNA Mini Kit (CW2087S).

[0037] Table 1 Sheep sample collection table

[0038]

[0039] Note: Sheep living in high altitude areas are by default adapted to high altitudes.

[0040] 2. PCR amplification of nucleotide fragments containing structural variation sites

[0041] For the structural variation sites of the β-globin locus screened in Example 1, specific primers were designed according to the HBB gene sequence recorded in the NCBI website (Gene ID: 100049064). The nucleotide sequences of the primers are as follows:

[0042] Table 2 Primer information

[0043]

[0044] In the PCR amplification reaction, the amplification system is 10 μL, which contains 50-100 ng / μL of the sheep to be tested.

[0045] 1 μL of blood genomic DNA template, 0.2 μL of 10 μM forward primer and reverse primer, 5 μL of 2× Rapid TaqMaster Mix, and 3.6 μL of ddH2O.

[0046] The amplification reaction program was as follows: pre-denaturation at 94°C for 3 min, denaturation at 94°C for 10 sec, annealing at 58°C for 20 sec, extension at 72°C for 1 min, 36 cycles; extension at 72°C for 5 min, and storage at 4°C.

[0047] The nucleotide sequences of the amplification products of primers SEQ ID NO.7 to 8 are as follows:

[0048] SEQ ID NO.1: ATCTTGGCGCTACTGTCTCGGGGAAAATGTCTTACCTT CTAGGCCTCTGATCAGCAGCCACGAAGTGCTGTCACTCTCCATGTCACTTTGGCTAAAACTTGAATGTGTGAACATGCTCCAGAGATATTTTCTGATTTTCCTACCTACCCATCCAGCATCTTCATTTTATTTCATTTATTTAATTTTGGCTGTCCTAGTCCTTCACTGATGCATGTAGACTTTCTCTAGTAGCGGCAAGCAAGGCTACTTTCCAGCTGTGGTGCTTAGGCCTCTCACTGTGATTTCTCTGGCTGTGGAGCACGGACTCCAGGGTACATAGACTTCAGCAGCTGTGGTGCTTAGGCTCAGCAGTTGTGGCCCACGGGCTTAATTGCTCAGTGGCGTGGAAGTATCCCCTACATTGGCAGGTGCTTTCTTAACCACAGGACCACCAGGGAAGTACCACTATCCTCATTTAAAAGCAAGAAATCTGAGGCAGTTAATGTGATCAACAAAGAAATCAACGAAACTCAATGTAAAGACTCTCTTTGTCTGACTTTCATATCCTTCCACACAGATACTCACATTCAGAAATTAGCACGTGCAAGAGCATGTGCATGCATGCACGCTCATACACACACCAACAGCTCACAAATTCCACATCCTGTTAGAGAATCCACTTGGCGTTAAATATTTATTTACAGGTTGACCCCTTGCTACCACCTCCCTGCTTTAAGGCAATATAATCTCCACCTGGATGCTTACAGCAGATTCTTAACTAGTCTGTCTACCACTGCTCCTGACAGTGTTTTCCCAACATGGCAGTCAAAGC。

[0049] The nucleotide sequences of the amplification products of primers SEQ ID NO.9 to 10 are as follows:

[0050] Primer SEQ ID NO.2: TTTCTGCATCCAGACGCACTGGATCAGCCAATCA CAGATGAAGGGCACTGAGGAAGCACAGTGCATCTTACATCCCCCCAAACCAATGAACTTGTGTTATGCCCTGGGTTAATCTACTCTCAGAGGCAGAGAGGGCAGGAGGCTCATGGGGCTCACAAGGAAGACCAGGGCCCCTGCTGCTTACACCTGCTTTTGACACAACTTGCAGCTGGGTAAACACACATCATGGTGCATCTGACTCTAGAGGAGAAGGCTACTTGTCACTGCCCTGCGGAGCAAGATGAGGGTGGCTGAAGTTGGTGTTGAAACCCTAGGCAGGCAGGTATTCAGCTTACAAGGCAGGCTGAAGGAGAGTGAATGTCAGCTGGGTGTGTGGGGACAGAGCCATTGCCTGAGACTGAGGCACTGATCCCTCTGTTCTTATGCTGTTTTCACCCCCTAGGTTGTTGGTTGTCTACCCATGGACTCAGAGGTTCTTTGAGTCCTTTGGGAACTTGCCCTCTGCTGATGATATTATGGGCAACGCTAAGGTGAAGGCCCGTGACAATA。

[0051] The nucleotide sequences of the amplification products of primers SEQ ID NOs. 11 to 12 are as follows:

[0052] Primer SEQ ID NO.3: AACCATGCTAGCAGCATCCATGTTTAAAAGAAAA TTGAATTGCTATGTACATCTGGAATCAACAAGTTAAAGAAAAGTTTCTCGTTTTTAAGTCAAAGGTTTTAGGGGGGATCAAATCAGAGATGAAATTGTGCTCTTCACTGTAGTGTGTGGACTTCTCATTGCAGTGTCTTCTCCTGGTGGAGCACATGCTCCTGGGTGCATGGGCTTAAGTAGTAACAGAGTGTGGGCTTCAGTAGTCTGGTGCAGCCTCAGTAGCCAGGGTGCTCAGGTTTAGTTGCTTTGCAGCATGTGGAATATTCCCAGACCAGGGTCAAACCCATGTTCCTTGCTTTCGCAGAAAATTCTTATCTACTATACACCAAGCAAGTCCTAGGTCTCACGATTTTAAGATTCCACATAGTGCACATCCTCTTTGCAGGGTTCTGTGGTTATGGACTGAGATATAAGGATGAAAGGGGGGGGGGCATGAAACAGGAACAGGAAAACATTGTTACCCATTTTAGGGTACCCACGGCATCTGCTGACAAAGGGCCTGTGACATGCTGGGCAGATCTGACTGGGGATGACACCAGGTAATGCTTGACTTAAGGAACCATCGCAGGCCCGTCTTGGCGCTGCTGCTCTCAGGGGAAAATGTCTTACCTTCTAGGCCTCTGATCAGCAGCCACAAAGTGCTGTCACTG。

[0053] The nucleotide sequence of the amplification product of primers SEQ ID NO.13 - 14 is as follows:

[0054] Primer SEQ ID NO.4: AGGAAAGCACTGGATCTGCCTACCTCTGTTAATT GAAAACCAAACAAAATAAAATAAATTGCCATCCCCAGCAAAGTCCCAGAAAACAAGTGAACACATAGAAGGAGAAGGAGATGGAGGAGGAGAATGAGACAGAAGAGAAGGAGAAGGAGAGGGGTAGAGGAGGAGAAAGAAGAAGGGGAAGAAGAAAAGGAAGGGAAAGAAAAACAAAACAAAACAAAAAAACAGAACAAGTGCAGGAAATAATCGGTGACATTAATGCCTGAAGGGAGCTGGAGTAGAGAGAAGGGCTATAGTAGCTTGTTGGTCTAGGAACCTAAGAAGTTTTCCTTTCCCTCAGAGACACCTCAGATTCAGTAAGATAGAAGTTGTGAAAATTTGGTTTCAGAAAGAGCCCTCTGGGGCTACAATTAGCAAAGGTTGCCAGGGGCTTGGGGCTTCCCATGTGGCACTAGAGGTAAAAGAACCTGCCTGCCAATGCAGGGGACTTAAGAGATATGGGTTCTATCTCTGGGTTGGGAAAATCCCCTGGAGAAGGGCATGGCAACTCACTCCATTATTCTTGCCTGGAGAATCCCACGGACAGCTGAGCCTGGCGGGCTACAGTCCAATGGGTCTCATAGAGTCACAGACAACTAAAGAGACAGCATGGCACGGCACAGTATGGAAAGGAACTTGGGAGAGGAGCAA。

[0055] The nucleotide sequences of the amplification products of primers SEQ ID NO.15 - 16 are as follows:

[0056]

[0057] The nucleotide sequence of the amplification product of primers SEQ ID NO. 17 - 18 is as follows:

[0058] Primer SEQ ID NO.6: GGGGACTTGTCCAATGCTGATGCTGTTATGAACA ACCCTAAGGTGAAGGCCCATGGCAAGAAGGTGCTAGACTCCTTCACTAAAGGCCTGAAGCATCTCCACCGTCTCAAGCGTTTCTTTGCTGCACTGAGTGAGCTGCACTGTGAGAAGCTGCATGTGAACCCTGAGAATTTCAAGGTGAGTCTATAGGACCCTTAAAGTTTTCCTGTTTTTGGTGGTCAAACTCCCATCATGGGAGAGGGCTGAGCAGCAGGACGCAGTTCAGAATGGAGAAGAGGTATTCTGATTATATCACCATGAACTCCTCAGGACCATTTAGCTTCTTTTACCTTCTTTGTTCTCAGCCATCATTTCTTCTTATTCATTCTTGTTTTTCTCTGTTTGTTCTCTGCAGTATCTTTTTTATATTTAAGCATTTTGAGGGTTTGAGTGTTAAGACTTTCTTCTTTTAAGTCACTTAAAAATTTTGTCTCATGTTTTTCCCGTATCTCTTCCTTTCAAAGCAAGGAAGACAAAATGATGTATTGCTTCTTGAAATAGTTCAAAAGAATAAAAAATGATAAGTTATGAATTAAGACAGAAAGAAACATTTCTCAGTACAAATTCAGGCTGATATGGATGGCTTCACATCAGTAGTAACAACTACACTTCAGCCATCTTTCTCCTTATATTCTAGGAGCACAGCTTGGGATGAGACTGAAATACTCTAAGTACAAATTGGGTGCTTCTGCTAATTGTGTTCTTGTTTTTTTATCTCTACCACACAGCTCCTGGGCAACATACTGGTGATTACACTGGCTCGACACTTTGGCAAGGAATTCACCCCAGAGTTGCAAGCTGCCTGTCAGAAGGTGGTGGCTGTTGTGGTTAATGCCCTCACCGA.

[0059] 3. Analysis of structural variation types of target loci in sheep to be tested

[0060] The PCR amplification product in 2 was detected by 1% agarose gel electrophoresis. Figure 2 As shown by Figure 2 It can be seen that the PCR product bands amplified by each pair of primers are uniformly bright and consistent with the expected band size, which can clearly determine the type of structural variation of the individual sheep to be tested.

[0061] When the DNA fragments shown by SEQ ID NOs. 1 to 3 are all present and the DNA fragments shown by SEQ ID NOs. 4 to 6 are all absent, it is determined that the structural variation carried by the sheep to be tested is haplotype A, and has the characteristics of high altitude adaptation; if the DNA fragments shown by SEQ ID NOs. 1 to 3 are all absent and the DNA fragments shown by SEQ ID NOs. 4 to 6 are all present, it is determined that the structural variation carried by the sheep to be tested is haplotype B, and does not have the characteristics of high altitude adaptation.

[0062] 4. Statistical analysis of structural variation types of β-globin locus in 69 sheep

[0063] According to the determination method described in 3, a statistical analysis was performed on the structural variation types carried by 69 sheep individuals living at different altitudes. The results are shown in Table 3. The frequency of haplotype A in high-altitude sheep populations is 1, and the frequency in low-altitude sheep populations is 0.4. The frequency of haplotype B in high-altitude sheep populations is 0.28, and the frequency in low-altitude sheep populations is 0.9.

[0064] Table 3 Haplotype number of β-globin gene locus structural variation in sheep from two different living environments

[0065]

[0066] Example 3: Analysis of functional differences between different haplotypes of sheep β-globin

[0067] 1. Collection of Sheep Blood and Preparation of Hemoglobin Lysate

[0068] Blood was collected from the common jugular vein of sheep and collected into a sodium heparin anticoagulant tube. The β-globin haplotype in the sheep blood was identified according to the method of Example 2. 200 μL of each of the two haplotype bloods that had been identified was placed in a 2 mL centrifuge tube, 1 mL of ddH2O was added, incubated on ice for 30 min, mixed on a vortex mixer, 133.4 μL of 1 M Tris-HCl solution was added, and centrifuged at 8000 rpm for 15 min at 4 ° C to remove cell membranes and cell debris. The obtained Hb lysate was placed in a dialysis bag, and 0.01 M Tris-HCl solution was added at a ratio of Hb lysate: dialysate = 1:100 for overnight dialysis, and the dialysate was replaced every 4 h. The next day, Hb solution was collected, NaCl was removed using a PD-10 desalting column (GE Healthcare, 17-0851-01), and Hb concentration was measured using the ferric cyanide Hb assay, with the calculation formula being hemoglobin (mmol / L) = absorbance of the assay tube × 5.7.

[0069] 2. Determination of hemoglobin oxygen dissociation curve under different conditions

[0070] The oxygen dissociation curve of Hb was determined by the "modified diffusion chamber method". All oxygen dissociation curves were determined at 37°C, pH = 7.4, in the absence (stripped) and presence of the allosteric effector Cl - The results are shown in Figure 2. Figure 3 As shown in Figure 2, the P50 value of haplotype A was significantly lower than that of haplotype B (P<1.50×10 -4 ), indicating that haplotype A has a higher inherent oxygen affinity. This further verifies that sheep carrying haplotype A structural variation can better adapt to high altitude environments by enhancing the oxygen binding capacity of blood hemoglobin.

[0071] It should be noted that when the claims of the present invention involve numerical ranges, it should be understood that the two endpoints of each numerical range and any numerical value between the two endpoints can be selected. In order to avoid redundancy, the present invention describes a preferred embodiment.

[0072] Although the preferred embodiments of the present invention have been described, those skilled in the art may make other changes and modifications to these embodiments once they have learned the basic creative concept. Therefore, the appended claims are intended to be interpreted as including the preferred embodiments and all changes and modifications that fall within the scope of the present invention.

[0073] Obviously, those skilled in the art can make various changes and modifications to the present invention without departing from the spirit and scope of the present invention. Thus, if these modifications and variations of the present invention fall within the scope of the claims of the present invention and their equivalents, the present invention is also intended to include these modifications and variations.

Claims

1. Molecular marker, characterized in that The molecular markers are a combination of DNA fragments shown in SEQ ID NOs. 1 to 3 and a combination of DNA fragments shown in SEQ ID NOs. 4 to 6. The combination of DNA fragments shown in SEQ ID NOs. 1 to 3 corresponds to the sheep β-globin gene locus A haplotype, and the sheep with this haplotype has high altitude adaptability; the combination of DNA fragments shown in SEQ ID NOs. 4 to 6 corresponds to the sheep β-globin gene locus B haplotype, and the sheep with this haplotype does not have high altitude adaptability.

2. A primer for detecting the molecular marker according to claim 1, characterized in that: The primers for detecting the combination of DNA fragments shown in SEQ ID NOs. 1 to 3 are shown in SEQ ID NOs. 7 to 12, and the primers for detecting the combination of DNA fragments shown in SEQ ID NOs. 4 to 6 are shown in SEQ ID NOs. 13 to 18.

3. A kit for detecting the molecular marker according to claim 1, characterized in that: The kit comprises the primers according to claim 2 and reagents for PCR amplification.

4. Use of the molecular marker according to claim 1, the primer according to claim 2 or the kit according to claim 3 in identifying the high altitude adaptability of sheep.

5. Use of the molecular marker according to claim 1, the primer according to claim 2 or the kit according to claim 3 in breeding sheep breeds with high altitude adaptability.

6. A method for identifying sheep's high altitude adaptability, characterized in that: The following steps are involved: Using the primers described in claim 2, performing PCR amplification on sheep genomic DNA to obtain an amplified product; Identify the amplified product; If the DNA fragments shown by SEQ ID NOs. 1 to 3 are all present, and the DNA fragments shown by SEQ ID NOs. 4 to 6 are all absent, it is determined that the sheep to be tested has high altitude adaptation characteristics; If the DNA fragments shown by SEQ ID NOs. 1 to 3 are all absent, and the DNA fragments shown by SEQ ID NOs. 4 to 6 are all present, it is determined that the sheep to be tested does not have the high altitude adaptation characteristics.

7. The method according to claim 6, characterized in that In the PCR amplification reaction, the amplification system is 10 μL, which includes 1 μL of 50-100 ng / μL sheep blood genomic DNA template to be tested, 0.2 μL of 10 μM forward primer and reverse primer, 5 μL of 2×Rapid Taq Master Mix, and 3.6 μL of ddH2O.

8. The method according to claim 7, characterized in that In the PCR amplification reaction, the amplification reaction program is: 94°C pre-denaturation for 3 minutes; 94°C denaturation for 10 seconds, 58°C annealing for 20 seconds, 72°C extension for 1 minute, 36 cycles; 72°C extension for 5 minutes, and 4°C storage.

Images