A lysate and a kit and method for detecting nucleic acid in a biological sample

Abstract

The present invention provides a lysate and a kit and method for detecting nucleic acid in a biological sample. By adding an appropriate amount of Sr to the lysate, 2+ , which improves the detection sensitivity and detection rate of nucleic acids in nucleic acid samples containing polysaccharide components and viscous biological samples in LAMP amplification, and is beneficial to improving the efficiency of nucleic acid detection in nucleic acid samples containing polysaccharide components or viscous biological samples.

Description

Technical Field

[0001] The present disclosure relates to the technical field of nucleic acid detection, and in particular to a lysate and a kit and method for detecting nucleic acids in a biological sample. Background Art

[0002] Loop-mediated isothermal amplification (LAMP) is based on strand-displacing DNA polymerase and special primer design. It can perform multiple rounds of amplification at a constant temperature (usually 60-65°C) to produce a large amount of target DNA in a short period of time. Compared with conventional PCR, LAMP has higher sensitivity and amplification efficiency, and has higher detection accuracy for low-concentration samples. In addition, since the four primers in the LAMP system specifically target six regions in the pre-amplified DNA sequence, the amplification process is not affected by non-target DNA and has higher specificity. In addition, LAMP does not require template thermal denaturation, temperature cycling, electrophoresis and other processes, and does not rely on precision thermal cyclers and other complex instruments and equipment. It can greatly save cost and time, is easy to promote and apply at the grassroots level where resources are scarce, and is suitable for rapid on-site detection.

[0003] At present, LAMP technology, as a rapid, sensitive and highly specific nucleic acid amplification method, has been widely used in biomedicine, environment, water quality monitoring, food safety and other fields. In LAMP detection, there is no need to extract DNA specifically, and cell lysis solution can be directly used for amplification and detection. However, in the detection process of sticky biological samples (such as oral swabs), the presence of polysaccharide components will inhibit the LAMP amplification process, thereby reducing the sensitivity and detection rate of LAMP detection. Therefore, it is necessary to develop a method that can improve the efficiency of nucleic acid detection in sticky biological samples. Summary of the invention

[0004] To achieve the above objectives, the present disclosure provides the following technical solutions:

[0005] In one aspect, the present disclosure provides a method for detecting nucleic acids in biological samples, comprising: (1) using a lysis solution to release nucleic acids in a viscous biological sample or a polysaccharide sample to obtain a sample lysis solution; (2) taking the sample lysis solution to perform a LAMP amplification reaction; wherein the lysis solution contains Sr 2+In some embodiments, the biological sample is a biological sample comprising polysaccharides. In some embodiments, further, the sample is a viscous biological sample. In some embodiments, the sample is an oral swab biological sample. In some embodiments, the polysaccharide comprises dextran sulfate. In some embodiments, the concentration of the target nucleic acid in the sample lysate is selected from 0.02-2 pg / μL, preferably 0.05 pg / μL, 0.1 pg / μL, 0.2 pg / μL, 0.3 pg / μL, 0.4 pg / μL, 0.5 pg / μL, 0.6 pg / μL, 0.7 pg / μL, 0.8 pg / μL, 0.9 pg / μL, 1.0 pg / μL, 1.1 pg / μL, 1.2 pg / μL, 1.3 pg / μL, 1.4 pg / μL, 1.5 pg / μL, 1.6 pg / μL, 1.7 pg / μL, 1.8 pg / μL, 1.9 pg / μL.

[0006] In some embodiments, the lysate contains Sr 2+ The concentration of Sr can be selected from 0.5-100 mM, preferably 0.5-50 mM; more preferably 0.5-25 mM. 2+ The concentration of Sr in the lysate can be selected from 0.5 mM, 1 mM, 5 mM, 10 mM, 15 mM, 20 mM or 25 mM. 2+ To add SrCl 2 Produced later.

[0007] In some embodiments, the lysate further comprises a buffer component, a surfactant, a stabilizer, a chelating agent, and the like.

[0008] In some embodiments, the buffer component is Tris, and the concentration of Tris is 5-50 mM, preferably 10-20 mM, and more preferably 10 mM.

[0009] In some embodiments, the surfactant includes but is not limited to at least one of Tween 20, Triton X-100, sodium dodecyl sulfate (SDS), sodium dodecyl sulfonate, sodium dodecyl sarcosinate, and lithium dodecyl sulfate, preferably SDS, and the mass fraction of SDS is 0.5-10%, preferably 1-5%, and more preferably 1%.

[0010] In some embodiments, the stabilizer includes a nonionic surfactant and / or an amino acid, wherein the nonionic surfactant can be selected from PEG200, PEG2000, PEG400, PEG4000, PEG800, PEG8000, etc.; the amino acid can be selected from glycine, lysine, etc. In some embodiments, the chelating agent can be selected from at least one of EGTA, EDTA·2Na, EDTA·4Na, EDTA, sodium citrate, EGTA, and HEDTA. Preferably, the nonionic surfactant PEG200 is used, and the mass fraction of the PEG200 is 1-10%, preferably 1-5%, and more preferably 2%.

[0011] In some embodiments, the chelating agent is preferably EDTA, and the concentration of EDTA is 0.5-10 mM EDTA, preferably 1-5 mM, and more preferably 1 mM.

[0012] In some embodiments, the pH value of the lysate is 7.0-9.0; preferably, the pH value of the lysate is 7.0.

[0013] In some embodiments, the lysate has a pH value of 7.0-9.0 and contains 5-50 mM Tris, 0.5-10 mM EDTA, 0.5-10 w / v % SDS, 1-10 w / v % PEG200, and 0.5-100 mM Sr 2+ In some embodiments, the lysate has a pH of 7.0 and contains 10 mM Tris, 1 mM EDTA, 1 w / v % SDS, 2 w / v % PEG200, and 0.5-100 mM Sr 2+ In some embodiments, Sr in the lysate 2+ The concentration is preferably 0.5-50 mM; more preferably 0.5-25 mM. In some embodiments, the Sr 2+ The concentration of may be selected from 0.5 mM, 1 mM, 5 mM, 10 mM, 15 mM, 20 mM or 25 mM.

[0014] In some embodiments, the amplification system of the LAMP amplification reaction comprises a buffer, MgSO 4 , dNTP, BstDNA polymerase, primer set and fluorescent indicator. In some embodiments, in the amplification system, the MgSO 4The final concentration of the dNTP is 1-2 mM; the final concentration of the Bst DNA polymerase is 0.16-0.48 U / μL. In some embodiments, the amplification system further comprises sterile enzyme-free water. In some embodiments, the buffer comprises Tris-HCl, KCl, (NH 4 ) 2 SO 4 MgSO 4 and Triton X-100.

[0015] In some embodiments, the fluorescent indicator can be selected from hydroxynaphthol blue (HNB), calcein, SYBRGreen, EvaGreen, Syto, etc. In some embodiments, the fluorescent indicator is preferably Syto.

[0016] In some embodiments, the primer set is a specific LAMP primer set designed for the target nucleic acid sequence, comprising a pair of external primers F3 / B3, a pair of internal primers FIP / BIP, and optionally further comprising loop primers LoopF ​​and / or LoopB. In some embodiments, the concentration of the F3 / B3 primer pair in the amplification system is 0.1~0.4 μM, and the concentration of the FIP / BIP primer pair is 0.8~3.2 μM. In some embodiments, the concentration of the LoopF ​​and / or LoopB primer pair is 0.4~1.6 μM. Wherein "the concentration of the primer pair" refers to the concentration of each primer in the primer pair.

[0017] In some embodiments, the amplification system of the LAMP reaction comprises 1× buffer, 8 mM MgSO 4 , 1.6 μM FIP / BIP primer pair, 0.2 μM F3 / B3 primer pair, 0.8 μM LoopB primer, 1.4 mM dNTP, Syto dye and 0.32 U / μL Bst DNA polymerase. In some embodiments, the pH of the 1× buffer is 7.0-9.0, and comprises 10-30 mM Tris-HCl, 50-150 mM KCl, 5-20 mM (NH 4 ) 2 SO 4 , 1-5 mM MgSO 4 and 1-3 w / v % Triton X-100. In some embodiments, the 1× buffer has a pH of 8.8 and comprises 20 mM Tris-HCl, 100 mM KCl, 10 mM (NH 4 ) 2 SO 4 , 2 mM MgSO 4and 1 w / v % Triton X-100.

[0018] The viscous biological sample described in the present disclosure refers to a sample derived from an organism and containing a large amount of polysaccharide components. In some embodiments, the viscous biological sample is sputum, cervical mucus, nasopharyngeal swab, oral swab, genital swab, lavage fluid, etc., preferably an oral swab biological sample.

[0019] In some embodiments, the method disclosed herein can be used for the detection of trace nucleic acid component samples. In some embodiments, the concentration of the target nucleic acid added to the amplification system is 0.004-0.4 pg / μL. In some embodiments, the concentration of the target nucleic acid added to the amplification system is 0.004-0.4 pg / μL.

[0020] On the other hand, the present disclosure also provides a lysate comprising Sr 2+ In some embodiments, Sr 2+ The concentration of Sr can be selected from 0.5-100 mM; preferably 0.5-50 mM; more preferably 0.5-25 mM. 2+ The concentration of Sr in the lysate can be selected from 0.5 mM, 1 mM, 5 mM, 10 mM, 15 mM, 20 mM or 25 mM. 2+ To add SrCl 2 Produced later.

[0021] In some embodiments, the lysate is suitable for biological samples containing polysaccharide components. In some embodiments, the polysaccharide includes dextran sulfate. In some embodiments, the lysate is suitable for viscous biological samples, and the biological samples are preferably biological samples such as sputum, cervical mucus, nasopharyngeal swabs, oral swabs, genital swabs, lavage fluids, etc., and more preferably oral swab biological samples.

[0022] In some embodiments, the lysate further comprises a buffer component, a surfactant, a stabilizer, a chelating agent, and the like.

[0023] In some embodiments, the lysate has a pH of 7.0-9.0 and contains 0.5-50 mM Tris, 0.5-10 mM EDTA, 0.5-10 w / v % SDS, 1-10 w / v % PEG200, and 0.5-100 mM Sr. 2+ In some embodiments, the lysate has a pH of 7.0 and contains 10 mM Tris, 1 mM EDTA, 1 w / v % SDS, 2 w / v % PEG200, and 0.5-100 mM Sr2+ In some embodiments, the Sr 2+ The concentration of Sr is preferably 0.5-50 mM; more preferably 0.5-25 mM. 2+ The concentration of Sr can be selected from 0.5 mM, 1 mM, 5 mM, 10 mM, 15 mM, 20 mM or 25 mM. 2+ To add SrCl 2 Produced later.

[0024] On the other hand, the present disclosure also provides a kit for detecting nucleic acids in biological samples, comprising: 1) a sample lysis solution as described in the present disclosure; and 2) a LAMP amplification system. In some embodiments, the LAMP amplification system comprises one or more buffers, wherein the LAMP amplification system comprises 1× buffer (pH 7.0-9.0, comprising 10-30 mM Tris-HCl, 50-150 mM KCl, 5-20 mM (NH 4 ) 2 SO 4 , 1-5 mM MgSO 4 and 1-3 w / v % Triton X-100), 8 mM MgSO 4 , 1.6 μM FIP / BIP primer pair, 0.2 μM F3 / B3 primer pair, 0.8 μM LoopB primer, 1.4 mM dNTP, Syto dye and 0.32 U / μL Bst DNA polymerase. The method, lysate or amplification composition of the present invention is used to improve the detection sensitivity and detection rate of nucleic acids in viscous biological samples during LAMP amplification, realize the detection of low-load nucleic acid samples, and improve the efficiency of nucleic acid detection in viscous biological samples. Beneficial Effects

[0025] The present invention provides a method and application thereof for improving the efficiency of nucleic acid detection in viscous biological samples by adding an appropriate amount of SrCl 2 , reduce the inhibition of the polysaccharide components in the sample on the amplification reaction, improve the detection sensitivity and detection rate of nucleic acids in viscous biological samples during LAMP amplification, and realize the detection of low-load nucleic acid samples. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1A-1B SrCl 2 Effects on Bst enzyme activity;

[0027] Figure 2 SrCl 2 Effects on LAMP amplification reaction;

[0028] Figure 3A-3C SrCl 2 Effects on LAMP amplification of nucleic acid samples containing polysaccharides;

[0029] Figure 4A-4C This is the LAMP amplification reaction of oral swab samples. DETAILED DESCRIPTION

[0030] The technical solution of the present disclosure is further described below in conjunction with specific embodiments. However, the following embodiments are merely examples of the present disclosure and do not represent or limit the scope of protection of the present disclosure. The scope of protection of the present disclosure shall be subject to the claims. In the following embodiments, unless otherwise specified, the reagents and consumables used are purchased from ordinary suppliers in the field, and the experimental methods and technical means used are conventional methods and means in the field.

[0031] Example 1 SrCl 2 Effects on LAMP amplification reaction

[0032] 1.1 SrCl 2 Effect on Bst enzyme activity:

[0033] (1) Primer design and screening: Design sequences modified with fluorescent groups and quenching groups to test Bst enzyme activity:

[0034] 5' FAM-Template sequence (SEQ ID NO: 1): CGACGTGTCTGCGGCTCTACCATATCTCCTATGAGCAACGTGTTAGCAGAGCCAAGCCACAACTC

[0035] 3' BHQ1-Reporter sequence (SEQ ID NO: 2): TGCTCATAGGAGATATGGTAGAGCCGCAGACACGTCG

[0036] Cold primer DNA sequence (SEQ ID NO: 3):

[0037] GAGTTGTGGCTTGGCTCTGCTAACACG.

[0038] (2) Prepare the Bst enzyme activity test reaction system according to Table 2:

[0039] Table 1

[0040]

[0041] (3) After mixing, amplify at 65°C for 60 min in a qPCR instrument and collect fluorescence signals every 1 min.

[0042] Test results see Figure 1A The slope of the fluorescence curve is positively correlated with the Bst enzyme activity, and the Bst enzyme activity increases with the SrCl 2 (1 mM-5 mM) increased and decreased.

[0043] 1.2 SrCl in viscous biological sample lysate 2 Effects on Bst enzyme activity

[0044] (1) Primer design and screening: refer to step (1) in 1.1.

[0045] (2) Preparation of oral swab samples: Oral samples were scraped with swabs and placed in 400 μL lysis buffer (pH 7.0, 10 mM Tris, 1 mM EDTA, SrCl2, 1 w / v% SDS, and 2 w / v% PEG200). The concentrations of SrCl2 in the lysis buffer were 0 mM, 0.5 mM, 5 mM, 50 mM, and 100 mM, respectively. 2 The samples were lysed at room temperature for 5 min to prepare oral swab lysate samples. The control samples were lysate or Nuclease-free ddH 2 O.

[0046] (3) Prepare the Bst enzyme activity test reaction system according to Table 2:

[0047] Table 2

[0048]

[0049] (4) After mixing, amplify the reaction at 65°C for 60 min in a qPCR instrument, and collect the fluorescence signal once every 1 min.

[0050] Test results see Figure 1B , the slope of the fluorescence curve is positively correlated with the Bst enzyme activity.

[0051] 1.3 SrCl 2 Effects on LAMP amplification reaction

[0052] (1) Primer design and screening: Design and synthesize LAMP primers based on the SA-GAPA1 gene sequence.

[0053] FIP (SEQ ID NO: 4):

[0054] GTGAAACGACCTTGCATAGTGTCGTAAACGACTTAACAGATGACG

[0055] BIP (SEQ ID NO: 5):

[0056] GGTGAAGTAGAGGTAGTTGATGGTATTTGCTTGCATCTGGTTC

[0057] F3 (SEQ ID NO: 6):

[0058] GAAGGTCTTGAAGTTGTAGC

[0059] B3 (SEQ ID NO: 7):

[0060] CATCGATATTTAAGTCTTTCCAAG

[0061] LoopB (SEQ ID NO: 8):

[0062] GTTTCCGCGTAAATGGTAAAGAAGT

[0063] (2) Prepare the LAMP reaction system according to Table 3:

[0064] Table 3

[0065]

[0066] (3) After mixing, amplify at 65°C for 60 min in a qPCR instrument and collect fluorescence signals every 1 min.

[0067] Test results see Figure 2 , 1-5 mM SrCl 2 There was no significant effect on the LAMP amplification reaction of nucleic acid with a higher concentration (10 pg / rxn), but during the amplification of nucleic acid with a low concentration (1 or 0.1 pg / rxn), 5 mM SrCl 2 It has a significant inhibitory effect on LAMP amplification reaction.

[0068] Example 2 SrCl 2 Promote LAMP amplification reactions of polysaccharide-containing samples

[0069] (1) Primer design and screening: Design and synthesize LAMP primers based on the SA-GAPA1 gene sequence, referring to step (1) of 1.3 in Example 1.

[0070] (2) Prepare the LAMP reaction system according to Table 4:

[0071] Table 4

[0072]

[0073] (3) After mixing, amplify at 65°C for 60 min in a qPCR instrument and collect fluorescence signals every 1 min.

[0074] Test results see Figures 3A-3C In samples containing polysaccharide (0.1% dextrose sulfate), 1 and 5 mM SrCl 2 Both can effectively improve the amplification efficiency of LAMP reaction and the detection rate of target nucleic acid.

[0075] Example 3 LAMP amplification reaction of viscous biological samples (oral swabs)

[0076] (1) Primer design and screening: Design and synthesize LAMP primers based on the SA-GAPA1 gene sequence, referring to step (1) of 1.3 in Example 1.

[0077] (2) Preparation of oral swab samples: Take an oral swab and scrape the sample, then place it in 400 μL of lysis buffer (pH 7.0, 10 mM Tris, 1 mM EDTA, SrCl2, 1 w / v % SDS, and 2 w / v % PEG200). 2 The concentrations of SrCl were 0 mM, 5 mM, and 25 mM, respectively, and the samples were lysed at room temperature for 5 min to prepare oral swab lysate samples. 2 ) was used as the control group, namely the lysate control.

[0078] (3) Prepare the LAMP reaction system according to Table 5:

[0079] Table 5

[0080]

[0081] (4) After mixing, amplify at 65°C for 60 min in a qPCR instrument and collect fluorescence signals every 1 min.

[0082] Test results see Figures 4A-4C , with 5 mM or 25 mM SrCl 2 After the oral swab sample is lysed with the lysis solution, the amplification efficiency and target nucleic acid detection rate of the lysed sample in the LAMP detection reaction can be effectively improved.

[0083] The above description is only a preferred embodiment of the present invention and does not limit the technical solution of the present invention in any form. Any modification, equivalent substitution or improvement made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

Claims

1. A method for detecting nucleic acid in a biological sample, comprising: (1) using a lysis solution to release nucleic acids in a viscous biological sample to obtain a sample lysis solution; (2) taking the sample lysis solution to perform a LAMP amplification reaction; characterized in that the lysis solution contains Sr 2+ ; The lysate contains Sr 2+ The concentration is 0.5-25mM; The Sr in the lysate 2+ Produced after adding SrCl2; The lysate also contains a buffer component, a surfactant, a stabilizer and a chelating agent; the buffer component is 5-50mM Tris; the surfactant is 0.5-10w / v% SDS; the stabilizer is 1-10w / v% PEG200; the chelating agent is 0.5-10mM EDTA, and the pH of the lysate is 7.0-9.

0.

2. The method of claim 1, wherein the viscous biological sample is selected from sputum, cervical mucus, nasopharyngeal swab, oral swab, genital swab or lavage fluid.

3. A lysate, characterized in that: Contains Sr 2+ , the Sr 2+ The concentration of Sr in the lysate is selected from 0.5-25 mM. 2+ Produced after adding SrCl2; The lysate also contains a buffer component, a surfactant, a stabilizer and a chelating agent; The buffer component is 5-50 mM Tris; the surfactant is 0.5-10 w / v% SDS; the stabilizer is 1-10 w / v% PEG200; the chelating agent is 0.5-10 mM EDTA, and the pH of the lysate is 7.0-9.

0.

4. A kit for detecting nucleic acid in a biological sample, characterized in that: Contains the lysate as claimed in claim 3.

5. The kit according to claim 4, characterized in that It also includes the LAMP amplification system.

6. The kit according to claim 5, characterized in that The LAMP amplification reaction system comprises 1× buffer, MgSO4, dNTP, Bst DNA polymerase, a primer set and a fluorescent indicator.

Images