Recombinant Bacillus subtilis producing four antimicrobial peptides, construction method and application thereof

Abstract

The present invention discloses a recombinant Bacillus subtilis producing four antimicrobial peptides, a construction method and an application thereof, and belongs to the field of microbial engineering technology. The strain comprises a multi-tandem expression cassette as shown in SEQ ID NO.1, and can efficiently express cecropin A, cecropin B, honeybee peptide Ia and tachyplepeptidin I. The present invention constructs a Bacillus subtilis engineering bacterium that expresses multi-tandem antimicrobial peptides, which improves the expression amount of antimicrobial peptides while achieving stable inheritance, and provides technical support for the development of antimicrobial peptides as new alternative antibiotics.

Description

Technical Field

[0001] The invention relates to the technical field of microbial engineering, and in particular to a recombinant Bacillus subtilis producing four antimicrobial peptides, a construction method and application thereof. Background Art

[0002] Antibiotics are the first choice for humans to fight against various pathogens. In the early days, domestic farms used a large amount of antibiotics to prevent and control various bacterial diseases in intensive aquaculture, resulting in the continuous emergence of drug-resistant bacteria. Nowadays, problems such as drug residues, environmental pollution and microbial resistance caused by the abuse of antibiotics are becoming increasingly serious, posing a serious threat to human and animal health. Therefore, it is urgent to develop new antibiotic alternatives. Antimicrobial peptides are a class of small molecule proteins with broad-spectrum antibacterial activity and the ability to regulate immune function. They have inhibitory effects on Gram-negative bacteria, Gram-positive bacteria, fungi and viruses. Studies have confirmed that antimicrobial peptides are not easy to develop drug resistance due to their special antibacterial mechanism and are considered to be one of the most promising candidate drugs for combating bacterial infections.

[0003] There are three methods for obtaining antimicrobial peptides: direct extraction, chemical synthesis, and biosynthesis. The first two methods have low yields, high costs, and are difficult to produce on a large scale. The biosynthesis method has the advantages of low cost and high efficiency, so it is widely used. Common heterologous protein expression systems include Escherichia coli expression systems and Bacillus subtilis expression systems. Among them, Escherichia coli is a Gram-negative bacterium with simple operation and short passage time, but because it contains endotoxins, it requires expensive detoxification treatment. Summary of the invention

[0004] The purpose of the present invention is to provide a recombinant Bacillus subtilis producing four antimicrobial peptides, a construction method and application thereof, so as to solve the problems existing in the above-mentioned prior art.

[0005] To achieve the above object, the present invention provides the following solutions:

[0006] In one aspect, the present invention provides a recombinant Bacillus subtilis strain producing four antimicrobial peptides, wherein the strain comprises a multi-tandem expression cassette as shown in SEQ ID NO.1.

[0007] On the other hand, the present invention provides a method for preparing the recombinant Bacillus subtilis, which comprises concatenating the gene sequences of cecropin A, cecropin B, apidaecin Ia and tachyplectin I, adding a T7 promoter, a ribosome binding site and a signal peptide to promote secretory expression, obtaining a multi-tandem expression cassette, and then inserting the multi-tandem expression cassette into Bacillus subtilis to obtain the recombinant Bacillus subtilis.

[0008] In another aspect, the present invention provides a method for producing antimicrobial peptides, which uses the recombinant Bacillus subtilis to produce antimicrobial peptides.

[0009] Based on the above technical solution, the present invention has the following technical effects:

[0010] The present invention constructs a Bacillus subtilis engineered bacterium that expresses multiple antimicrobial peptides in tandem. The engineered strain can achieve efficient expression of antimicrobial peptides in the Bacillus subtilis system, and the product produced by fermentation can have a significant inhibitory effect on Gram-negative bacteria Escherichia coli, has certain application value, and provides technical support for the development of antimicrobial peptides as new alternative antibiotics. BRIEF DESCRIPTION OF THE DRAWINGS

[0011] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0012] Figure 1 is a schematic diagram of multiple tandem expression cassettes, where P T7 , T7 promoter; SD, ribosome binding site; CPA, cecropin A; CPB, cecropin B; SP, SacB, AP, dacB are all signal peptides;

[0013] Figure 2 For the construction of pWJX04 expression vector;

[0014] Figure 3 Colony PCR detection was constructed for pWJX04 plasmid, where M is the DL2000 standard molecular weight DNA marker;

[0015] Figure 4 The growth curves of the antimicrobial peptides expressed by free vectors, wherein pHT254 is the growth curve of E. coli added with the supernatant of BS168 fermentation broth carrying the pHT254 empty vector; pWJX04 is the growth curve of E. coli added with the supernatant of BS168 fermentation broth carrying the pWJX04 vector;

[0016] Figure 5 The construction of Bacillus subtilis engineered bacteria producing four antimicrobial peptides, where a is a schematic diagram of the knock-in vector of the antimicrobial peptide multi-tandem expression cassette, b is the electrophoresis identification of the recombinant strain, lane 1 is the amplification fragment of the upstream cassette internal and external primers, lane 2 is the amplification fragment of the downstream cassette internal and external primers, and M is the DL2000 standard molecular weight DNA marker;

[0017] Figure 6To verify the antibacterial effect of the fermentation supernatant, D10 in a is the antibacterial zone of the engineered bacteria fermentation supernatant, and sterile water and BS168 fermentation supernatant are set as controls, with a sample volume of 200 μL, and b is the growth curve of the engineered bacteria fermentation supernatant inhibiting the growth of Escherichia coli;

[0018] Figure 7 The secondary mass spectrometry identification of the target antimicrobial peptides, wherein (a) is the cecropin A peptide segment, (b) is the cecropin B peptide segment, and (c) is the apidaecin peptide segment. DETAILED DESCRIPTION

[0019] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but should be understood as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0020] It should be understood that the terms described in the present invention are only for describing special embodiments and are not intended to limit the present invention. In addition, for the numerical range in the present invention, it should be understood that each intermediate value between the upper and lower limits of the scope is also specifically disclosed. Each smaller range between the intermediate value in any stated value or stated range and any other stated value or intermediate value in the described range is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded in the scope.

[0021] Unless otherwise indicated, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art. Although the present invention describes only preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of a conflict with any incorporated document, the content of this specification shall prevail.

[0022] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments of the present invention description without departing from the scope or spirit of the present invention. Other embodiments derived from the present invention description will be apparent to those skilled in the art. The present application description and examples are exemplary only.

[0023] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0024] The technical solutions described in the present invention, unless otherwise specified, are all conventional solutions in the art, and the reagents or raw materials used, unless otherwise specified, are purchased from commercial channels or are publicly available.

[0025] On the one hand, an embodiment of the present invention provides a recombinant Bacillus subtilis strain producing four antimicrobial peptides, wherein the strain comprises a multi-tandem expression cassette as shown in SEQ ID NO.1, and can efficiently express cecropin A, cecropin B, honeybee peptide Ia and tachyplepeptidin I.

[0026] Cecropin A and cecropin B belong to the cecropins family and were isolated and identified from the hemolymph of Hyalophora cecropia. Apidaecin is a class of proline-rich small peptides consisting of 18-20 amino acid residues. Apidaecin Ia is naturally present in honeybees and achieves antibacterial effects by inhibiting DnaK protein activity and binding to bacterial lipopolysaccharide. The tachyplesin family belongs to arthropod antimicrobial peptides. Tachyplesin I was isolated from Tachypleus tridentatus and has 17 amino acid residues and 1 arginine amide at the carboxyl terminal.

[0027] On the other hand, an embodiment of the present invention provides a method for preparing the recombinant Bacillus subtilis, which comprises concatenating the gene sequences of cecropin A, cecropin B, honeybee peptide Ia and tachypleuropeptidin I, adding a T7 promoter, a ribosome binding site and a signal peptide to promote secretory expression, obtaining a multi-tandem expression cassette, and then inserting the multi-tandem expression cassette into Bacillus subtilis to obtain the recombinant Bacillus subtilis.

[0028] In some specific embodiments, the signal peptide includes SP, SacB, AP and dacB.

[0029] In some specific embodiments, the nucleotide sequence of the multiple tandem expression cassette is shown as SEQ ID NO.1.

[0030] In some specific embodiments, the homologous sequence of the amyE gene, the P43 promoter, the T7 RNA polymerase and the multi-tandem expression cassette are tandemly constructed to construct a gene knock-in vector, and the multi-tandem expression cassette knock-in vector is pRP1028-amyE-AMPs-spec r , and its knock-in box sequence is shown in SEQ ID NO.2.

[0031] In some specific embodiments, inserting the multiple tandem expression cassettes into Bacillus subtilis specifically comprises: inserting the multiple tandem expression cassettes knock-in vector into the α-amylase gene amyE of Bacillus subtilis.

[0032] The present invention utilizes the method of adding signal peptides and expressing in series to allow the antimicrobial peptides to accumulate in large quantities in the culture medium during the fermentation process, and the fermentation supernatant can preliminarily verify the biological antibacterial activity of the four selected antimicrobial peptides in the Bacillus subtilis expression system.

[0033] Another aspect of the embodiments of the present invention provides a method for producing antimicrobial peptides, which uses the recombinant Bacillus subtilis to produce antimicrobial peptides.

[0034] Bacillus subtilis is a Gram-positive bacterium that can produce spores and capsules. It is a typical aerobic bacterium. Its spores have strong stress resistance and can survive in a relatively mild and acidic environment. Bacillus subtilis 168 (BS168) strain is a model strain of the genus Bacillus. WB600 and WB800 commonly used in recombinant protein production are both transformed from strain 168. Compared with Escherichia coli, Bacillus subtilis does not contain endotoxins and has food-grade biosafety. It is a model strain of the Bacillaceae family. Its genetic operating system is perfect and easy to carry out corresponding genetic modification. The perfect protein secretion system of Bacillus subtilis facilitates the recovery and purification of the target protein. In addition, Bacillus subtilis can also synthesize and secrete probiotic factors such as protease, amylase and various lipopeptide antimicrobial peptides, which can improve the feed nutrient conversion rate in the aquaculture industry, effectively antagonize various bacteria and fungi in the feed, and inhibit the reproduction of pathogens. It is a good aquaculture probiotic. Using Bacillus subtilis as a host to express antimicrobial peptides does not require purification or detoxification, making it an ideal host for producing various protein and peptide drugs.

[0035] The present invention uses a three-parent conjugation method, uses the pRP1028 plasmid stored in the laboratory, and combines the T7 RNA polymerase gene in Escherichia coli BL21, the constitutive strong promoter P43 and the amyE homology arm in BS168, and the multi-tandem expression cassette in the present invention to construct an antimicrobial peptide multi-tandem expression cassette knock-in vector pRP1028-amyE-AMPs-spec r The knock-in vector can be found in the helper plasmid pSS1827-Amp r With the help of BS168, a conjugate with spectinomycin (spec) resistance was obtained, and then pRP1028-amyE-AMPs-spec was transformed into BS168 under temperature stress. r The peptides were integrated into the BS168 genome through homologous recombination, and the strain became a recombinant Bacillus subtilis strain that produces four antimicrobial peptides and can be stably inherited.

[0036] The antimicrobial peptide multiple tandem expression cassette is shown in SEQ ID NO.1.

[0037] SEQ ID NO.1:

[0038] TAATACGACTCACTATAGGCATATAAAGGAGGAAGGATCCATGATTCAAAAACGAAAGCGGACAGTTTCGTTCAGACTTGTGCTTATGTGCACGCTGTTATTTGTCAGTTTGCCGATTACAAAAACATCAGCCATGAAATGGAAACTGTTCAAGAAGATTGAAAAAGTGGGTCAGAACATTCGCGATGGCATTATCAAAGCGGGCCCGGCCGTGGCGGTTGTTGGCCAGGCAACCCAGATTGCGAAAGGTTAGAAAAATTTGTAATTAAGAAGGAGTGATTACATGAACATCAAAAAGTTTGCAAAACAAGCAACAGTATTAACCTTTACTACCGCACTGCTGGCAGGAGGCGCAACTCAAGCGTTTGCGATGGGCAACAACCGCCCGGTGTATATTCCGCAGCCGCGCCCGCCGCATCCGCGCATTTAAAAAAATTTGTAATTAAGAAGGAGTGATTACATGAGATCAAAAAAACTGTGGATTTCACTGCTGTTTGCACTGACACTGATTTTTACAATGGCAATGAAATGGAAAGTGTTTAAAAAAATTGAAAAAATGGGTCGCAACATTCGCAACGGTATTGTGAAAGCGGGCCCGGCGATTGCGGTTCTGGGCGAAGCGAAAGCGCTGGGCTAAAAAAATTTGTAATTAAGAAGGAGTGATTACATGCGCATTTTCAAAAAAGCAGTATTCGTGATCATGATTTCTTTTCTTATTGCAACCGTAAATGTGAATACAGCACATGCTATGAAATGGTGCTTCCGCGTGTGCTATCGCGGCATTTGTTATCGCCGCTGTCGCTAA。

[0039] The knock-in cassette sequence is shown in SEQ ID NO.2.

[0040] SEQ ID NO.2:

[0041] ATGTTTGCAAAACGATTCAAAACCTCTTTACTGCCGTTATTCGCTGGATTTTTATTGCTGTTTCATTTGGTTCTGGCAGGACCGGCGGCTGCGAGTGCTGAAACGGCGAACAAATCGAATGAGCTTACAGCACCGTCGATCAAAAGCGGAACCATTCTTCATGCATGGAATTGGTCGTTCAATACGTTAAAACACAATATGAAGGATATTCATGATGCAGGATATACAGCCATTCAGACATCTCCGATTAACCAAGTAAAGGAAGGGAATCAAGGAGATAAAAGCATGTCGAACTGGTACTGGCTGTATCAGCCGACATCGTATCAAATTGGCAACCGTTACTTAGGTACTGAACAAGAATTTAAAGAAATGTGTGCAGCCGCTGAAGAATATGGCATAAAGGTCATTGTTGACGCGGTCATCAATCATACCACCAGTGATTATGCCGCGATTTCCAATGAGGTTAAGAGTATTCCAAACTGGACACATGGAAACACACATTTGATAGGTGGTATGTTTTCGCTTGAACTTTTAAATACAG

[0042] CCATTGAACATACGGTTGATTTAATAACTGACAAACATCACCCTCTTGCTAAAGC

[0043] GGCCAAGGACGCTGCCGCCGGGGCTGTTTGCGTTTTTGCCGTGATTTCGTGTATC

[0044] ATTGGTTTACTTATTTTTTTGCCAAAGCTGTAATGGCTGAAAATTCTTACATTTAT

[0045] TTTACATTTTTAGAAATGGGCGTGAAAAAAAGCGCGCGATTATGTAAAATATAA

[0046] AGTGATAGCGGTACCATTATAGGTAAGAGAGGAACGTCATATGAACACGATTAA

[0047] CATCGCTAAGAACGACTTCTCTGACATCGAACTGGCTGCTATCCCGTTCAACACT

[0048] CTGGCTGACCATTACGGTGAGCGTTTAGCTCGCGAACAGTTGGCCCTTGAGCAT

[0049] GAGTCTTACGAGATGGGTGAAGCACGCTTCCGCAAGATGTTTGAGCGTCAACTT

[0050] AAAGCTGGTGAGGTTGCGGATAACGCTGCCGCCAAGCCTCTCATCACTACCCTA

[0051] CTCCCTAAGATGATTGCACGCATCAACGACTGGTTTGAGGAAGTGAAAGCTAAG

[0052] CGCGGCAAGCGCCCGACAGCCTTCCAGTTCCTGCAAGAAATCAAGCCGGAAGCC

[0053] GTAGCGTACATCACCATTAAGACCACTCTGGCTTGCCTAACCAGTGCTGACAAT

[0054] ACAACCGTTCAGGCTGTAGCAAGCGCAATCGGTCGGGCCATTGAGGACGAGGCT

[0055] CGCTTCGGTCGTATCCGTGACCTTGAAGCTAAGCACTTCAAGAAAAACGTTGAG

[0056] GAACAACTCAACAAGCGCGTAGGGCACGTCTACAAGAAAGCATTTATGCAAGTT

[0057] GTCGAGGCTGACATGCTCTCTAAGGGTCTACTCGGTGGCGAGGCGTGGTCTTCGT

[0058] GGCATAAGGAAGACTCTATTCATGTAGGAGTACGCTGCATCGAGATGCTCATTG

[0059] AGTCAACCGGAATGGTTAGCTTACACCGCCAAAATGCTGGCGTAGTAGGTCAAG

[0060] ACTCTGAGACTATCGAACTCGCACCTGAATACGCTGAGGCTATCGCAACCCGTG

[0061] CAGGTGCGCTGGCTGGCATCTCTCCGATGTTCCAACCTTGCGTAGTTCCTCCTAA

[0062] GCCGTGGACTGGCATTACTGGTGGTGGCTATTGGGCTAACGGTCGTCGTCCTCTG

[0063] GCGCTGGTGCGTACTCACAGTAAGAAAGCACTGATGCGCTACGAAGACGTTTAC

[0064] ATGCCTGAGGTGTACAAAGCGATTAACATTGCGCAAAACACCGCATGGAAAATC

[0065] AACAAGAAAGTCCTAGCGGTCGCCAACGTAATCACCAAGTGGAAGCATTGTCCG

[0066] GTCGAGGACATCCCTGCGATTGAGCGTGAAGAACTCCCGATGAAACCGGAAGAC

[0067] ATCGACATGAATCCTGAGGCTCTCACCGCGTGGAAACGTGCTGCCGCTGCTGTG

[0068] TACCGCAAGGACAAGGCTCGCAAGTCTCGCCGTATCAGCCTTGAGTTCATGCTT

[0069] GAGCAAGCCAATAAGTTTGCTAACCATAAGGCCATCTGGTTCCCTTACAACATG

[0070] GACTGGCGCGGTCGTGTTTACGCTGTGTCAATGTTCAACCCGCAAGGTAACGAT

[0071] ATGACCAAAGGACTGCTTACGCTGGCGAAAGGTAAACCAATCGGTAAGGAAGG

[0072] TTACTACTGGCTGAAAATCCACGGTGCAAACTGTGCGGGTGTCGATAAGGTTCC

[0073] GTTCCCTGAGCGCATCAAGTTCATTGAGGAAAACCACGAGAACATCATGGCTTG

[0074] CGCTAAGTCTCCACTGGAGAACACTTGGTGGGCTGAGCAAGATTCTCCGTTCTGC

[0075] TTCCTTGCGTTCTGCTTTGAGTACGCTGGGGTACAGCACCACGGCCTGAGCTATA

[0076] ACTGCTCCCTTCCGCTGGCGTTTGACGGGTCTTGCTCTGGCATCCAGCACTTCTC

[0077] CGCGATGCTCCGAGATGAGGTAGGTGGTCGCGCGGTTAACTTGCTTCCTAGTGA

[0078] AACCGTTCAGGACATCTACGGGATTGTTGCTAAGAAAGTCAACGAGATTCTACA

[0079] AGCAGACGCAATCAATGGGACCGATAACGAAGTAGTTACCGTGACCGATGAGA

[0080] ACACTGGTGAAATCTCTGAGAAAGTCAAGCTGGGCACTAAGGCACTGGCTGGTC

[0081] AATGGCTGGCTTACGGTGTTACTCGCAGTGTGACTAAGCGTTCAGTCATGACGCT

[0082] GGCTTACGGGTCCAAAGAGTTCGGCTTCCGTCAACAAGTGCTGGAAGATACCAT

[0083] TCAGCCAGCTATTGATTCCGGCAAGGGTCTGATGTTCACTCAGCCGAATCAGGCT

[0084] GCTGGATACATGGCTAAGCTGATTTGGGAATCTGTGAGCGTGACGGTGGTAGCT

[0085] GCGGTTGAAGCAATGAACTGGCTTAAGTCTGCTGCTAAGCTGCTGGCTGCTGAG

[0086] GTCAAAGATAAGAAGACTGGAGAGATTCTTCGCAAGCGTTGCGCTGTGCATTGG

[0087] GTAACTCCTGATGGTTTCCCTGTGTGGCAGGAATACAAGAAGCCTATTCAGACG

[0088] CGCTTGAACCTGATGTTCCTCGGTCAGTTCCGCTTACAGCCTACCATTAACACCA

[0089] ACAAAGATAGCGAGATTGATGCACACAAACAGGAGTCTGGTATCGCTCCTAACT

[0090] TTGTACACAGCCAAGACGGTAGCCACCTTCGTAAGACTGTAGTGTGGGCACACG

[0091] AGAAGTACGGAATCGAATCTTTTGCACTGATTCACGACTCCTTCGGTACCATTCC

[0092] GGCTGACGCTGCGAACCTGTTCAAAGCAGTGCGCGAAACTATGGTTGACACATA

[0093] CGAGTCTTGTGATGTACTGGCTGATTTCTACGACCAGTTCGCTGACCAGTTGCAC

[0094] GAGTCTCAATTGGACAAAATGCCAGCACTTCCGGCTAAAGGTAACTTGAACCTC

[0095] CGTGACATCTTAGAGTCGGACTTCGCGTTCGCGTAATAATACGACTCACTATAGG

[0096] CATATAAAGGAGGAAGGATCCATGATTCAAAAAACGAAAGCGGACAGTTTCGTTC

[0097] AGACTTGTGCTTATGTGCACGCTGTTATTTGTCAGTTTGCCGATTACAAAAACAT

[0098] CAGCCATGAAATGGAAACTGTTCAAGAAGATTGAAAAAGTGGGTCAGAACATTC

[0099] GCGATGGCATTATCAAAGCGGGCCCGGCCGTGGCGGTTGTTGGCCAGGCAACCC

[0100] AGATTGCGAAAGGTTAGAAAAATTTGTAATTAAGAAGGAGTGATTACATGAACA

[0101] TCAAAAAGTTTGCAAAACAAGCAACAGTATTAACCTTTACTACCGCACTGCTGG

[0102] CAGGAGGCGCAACTCAAGCGTTTGCGATGGGCAACAACCGCCCGGTGTATATTC

[0103] CGCAGCCGCGCCCGCCGCATCCGCGCATTTAAAAAAATTTGTAATTAAGAAGGA

[0104] GTGATTACATGAGATCAAAAAAACTGTGGATTTCACTGCTGTTTGCACTGACACT

[0105] GATTTTTACAATGGCAATGAAATGGAAAGTGTTTAAAAAAATTGAAAAAATGGG

[0106] TCGCAACATTCGCAACGGTATTGTGAAAGCGGGCCCGGCGATTGCGGTTCTGGG

[0107] CGAAGCGAAAGCGCTGGGCTAAAAAAATTTGTAATTAAGAAGGAGTGATTACAT

[0108] GCGCATTTTCAAAAAAGCAGTATTCGTGATCATGATTTCTTTTTCTTATTGCAACC

[0109] GTAAATGTGAATACAGCACATGCTATGAAATGGTGCTTCCGCGTGTGCTATCGCGGCATTTGTTATCGCCGCTGTCGCTAA.

[0110] In the present embodiment, Bacillus subtilis 168 (BS168) and Escherichia coli DH5α are deposited by this unit; plasmids pHT254, pSS4332-Km r 、pSS1827-Amp r Deposited by this institution; plasmid pWJX04-Amp / Cm r 、pRP1028-amyE-AMPs-spec r The invention was constructed; plasmid extraction kit and DNA gel recovery kit were purchased from Sangon Biotech (Shanghai) Co., Ltd.; T4 ligase and ligase buffer were purchased from Takara Biotech (Dalian) Co., Ltd.; 1.1×S4 Fidelity PCR Mix and 2×GS Taq PCR Mix were purchased from Guangzhou Xinkailai Biotechnology Co., Ltd.; ready-to-use seamless cloning kit and restriction endonucleases were purchased from BBI Life Sciences Co., Ltd.; PCR primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd. Guangzhou Branch.

[0111] In the present embodiment, the preparation method of competent Escherichia coli is as follows: inoculate 5 mL of seed solution and shake overnight, transfer to 100 mL of culture medium at a 1% inoculation volume; shake culture for about 3 h until OD 600 When the concentration reaches 0.35-0.4, centrifuge at 4100 rpm for 10 min at 4°C to collect the cells; remove the supernatant and add 0.05 times the volume of pre-cooled 0.1 M MgCl 2 Gently resuspend, ice bath for 10 min, centrifuge at 4100 rpm for 10 min at 4°C; remove the supernatant, add 0.05 times the volume of pre-cooled 0.1 M CaCl 2 Gently resuspend, place on ice for 30 min, centrifuge at 4100 rpm for 10 min at 4°C; remove the supernatant and add 0.03 times the volume of pre-cooled 0.1 M glycerol CaCl 2, suspend the precipitate; dispense into sterile 1.5mL centrifuge tubes at 100μL / tube and store at -80℃ for future use. All reagents are sterilized by high temperature and wet heat.

[0112] The heat shock transformation method for E. coli is to add the ligation system (10-20μL) or plasmid (8-10μL) to 100μL competent cells and mix gently; mix, ice bath for 30min, heat shock at 42℃ for 90s, and then recover in an ice bath for 5min; add 800-1000μL LB medium and culture with gentle shaking for 45min; centrifuge at 4100rpm for 5min, remove 800μL supernatant, keep about 100μL culture solution, evenly spread on the plate, dry and invert and culture overnight.

[0113] Preparation of heat shock competent Bacillus subtilis 168 was carried out as follows: First, prepare the stock solution, 100 mL of 10× minimum salt solution (14 g K 2 HPO 4 6g KH 2 PO 4 , 2g(NH 4 ) 2 SO 4 , 1g Na 3 C 6 H 5 O 7 ·2H 2 O, 0.2 g MgSO 4 7H 2 O), 50 mL of 50% glucose, 20 mL of 5% hydrolyzed casein, 50 mL of 10% yeast juice, 0.5 M MgCl 2 , 0.1M CaCl 2 , sterilized at 115℃ for 30min, mixed before use; mixed culture medium GMⅠ (9.5mL of 10× minimum salt solution, 1mL of 50% glucose, 0.4mL of 5% hydrolyzed casein, 1mL of 10% yeast juice, 85.5mL of sterile water), GMⅡ (10mL of 10× minimum salt solution, 1mL of 50% glucose, 0.08mL of 5% hydrolyzed casein, 0.04mL of 10% yeast juice, 0.5M MgCl 2 0.5 mL, 0.1 M CaCl 20.5mL, sterile water 88mL); pick a single colony of BS168 and inoculate 5mL GMⅠ seed solution at 30℃ and shake overnight, transfer 2mL of seed solution to 18mL GMⅠ, and culture at 37℃, 200rpm and shaking for 3.5h; transfer 10mL of the above GMⅠ bacterial solution to 90mL GMⅡ, and culture at 37℃, 200rpm and shaking for 70min; take aliquots into pre-cooled 50mL centrifuge tubes, ice bath for 10min, and centrifuge at 4℃, 6000rpm for 5min to collect bacteria; pour out the supernatant, and the remaining about 2mL of supernatant is used to suspend the bacteria in 3 centrifuge tubes (total volume is about 2.5mL), add 700μL 50% glycerol to make the final concentration about 11%, mix gently and dispense into sterile 1.5mL centrifuge tubes at 500μL / tube, and store at -80℃ for later use.

[0114] The steps of heat shock transformation of Bacillus subtilis are as follows: take out 500 μL competent cells from -80°C and melt them in a 45°C water bath; add 10 μL plasmid, heat shock at 45°C for 90 seconds, recover in an ice bath for 1 minute, and culture with gentle shaking for 1.5-2 hours; centrifuge at 6000rpm for 5 minutes, keep 200 μL supernatant to suspend the bacteria and evenly spread them on a plate added with carrier-resistant antibiotics, and culture them inverted in a 30°C incubator overnight.

[0115] The names and sequences of the primers used in the examples of the present invention are shown in Table 1:

[0116] Table 1 Primer sequences

[0117]

[0118]

[0119] Example 1 Feasibility Demonstration of Antimicrobial Peptide Expression by Bacillus subtilis

[0120] First construct pWJX04-Amp / Cm r Recombinant plasmid vector. Based on pHT254 plasmid, the corresponding primers were used to amplify the signal peptide-antimicrobial peptide fragment SPamyQ-cecropin A (50 μL amplification system: 1 μL template DNA, 1.5 μL primers each, 50 μL 1.1×S4 Fidelity PCR Mix. Amplification conditions: 98℃ pre-denaturation for 2 min, 98℃ denaturation for 10 s, Tm±5℃ annealing for 20 s, 72℃ extension for 15 s / kb, 72℃ extension for 5 min; program cycle number: 30 cycles.).

[0121] When designing primers, the invention reserves a downstream XbaⅠ restriction site and upstream and downstream homology arms in the primers, and the pHT254 plasmid is double-digested with restriction endonucleases BamHI and XbaⅠ (digestion conditions are: 20 μL of fragment, 10 μL of 10×digestion buffer, 2.5 μL of BamHI, 2.5 μL of XbaⅠ, double-distilled water to 100 μL, incubated at 37°C for 4 hours), and after double-digestion, the vector and the SPamyQ-cecropin A recovered fragment are connected by seamless cloning (connection conditions are: 5 μL of 2×SeamLess cloning MasterMix, 2 μL of vector, 3 μL of fragment. Reaction at 50°C for 20 minutes, ice bath for 2 minutes), and then heat shock transformation is performed, and PCR screening is performed on the colonies on the plate (20 μL amplification system: 1 μL of positive recombinant bacterial solution, 0.5 μL of each special primer, 2×GS Taq PCR Mix 10 μL, double distilled water to 20 μL. Amplification conditions: 95℃ pre-denaturation for 3 min, 94℃ denaturation for 25 s, Tm±5℃ annealing for 25 s, 72℃ extension for 15 s / kb, 72℃ extension for 2 min. Program cycle number: 30 cycles).

[0122] The results of pWJX04 plasmid construction and colony PCR detection are as follows Figure 2-3 shown.

[0123] After screening and sequencing, the positive recombinant was named pWJX01-Amp / Cm r According to the instructions of the plasmid extraction kit, the recombinant plasmid was extracted, digested with restriction endonuclease XbaⅠ, purified and recovered for use, and the SacB-apidaecin fragment was amplified and recovered with specific primers. Then, the SacB-apidaecin fragment was connected to the linearized plasmid pWJX01-Amp / Cm by the same seamless cloning method as above. r The positive transformant was sequenced and named pWJX02-Amp / Cm r In the same way, the recombinant plasmids pWJX01, pWJX02, pWJX03, and pWJX04 containing 1 to 4 antimicrobial peptides were obtained.

[0124] According to the preparation of heat shock competent cells and heat shock method described above, the sequenced pWJX04-Cm r The plasmid was introduced into BS168 by heat shock transformation and screened on a plate containing chloramphenicol Cm (5 μg / mL). After colony PCR identification, it was confirmed that pWJX04-Cm r The plasmid can be transferred into BS168 and stably replicated and propagated. The single colony obtained by culture is the one containing pWJX04-Cm r The recombinant plasmid was named BS168 / pWJX04-Cmr .

[0125] In order to detect the expression of antimicrobial peptides in the recombinant plasmid in BS168, 100 mL was fermented and the supernatant was collected for antibacterial effect verification. The inoculation volume was transferred to 100 mL of antibiotic-free LB medium at 1% and shaken at 37°C for 3 h until the OD 600 When the pH reaches 0.8-1.0, IPTG (200 μg / mL) is added for induction for 24 h. The supernatant is collected by centrifugation at 4100 rpm for 10 min, and after freeze-drying and concentration, it is resuspended in double distilled water at 0.25 g / mL. After centrifugation at 12000 rpm for 10 min, the supernatant is filtered and sterilized, and stored at -20°C for later use.

[0126] In order to preliminarily explore the inhibitory effect of antimicrobial peptides expressed by Bacillus subtilis on Escherichia coli, the OD of Escherichia coli was measured for 24 hours. 600 Changes, and draw a growth curve to show the inhibitory effect of the fermentation product on its growth. The E. coli seed solution was shaken overnight, and transferred to 10mL of culture medium at a 1% inoculation volume; the growth curve culture system was 100μL of bacterial solution, 50μL of concentrated product, and 50μL of LB. Cultured at 37℃ for 24h, and OD was measured every 1h 600 The data obtained are used to draw a growth curve as shown in Figure 4 shown.

[0127] Example 2 Construction of Bacillus subtilis engineered bacteria producing four antimicrobial peptides

[0128] Using BS168 total DNA as a template, primers amyEUP-F and amyEUP-R were used to PCR amplify the upstream fragment of the target gene amyE (homologous arm of about 500 bp, excluding the target gene sequence); in order to further increase the expression of antimicrobial peptides, the P43-T7 RNA Polymerase expression element was introduced to cooperate with the T7 promoter to start transcription of the expression cassette; using BS168 total DNA as a template, primers P43-F and P43-R1, P43-R2 were used to PCR amplify the P43 promoter, and E. coli BL21 total DNA was used as a template, and primers P43-T7-F and RNAP-Sal1-R were used to PCR amplify T7RNA Polymerase; since the T7RNA Polymerase sequence is relatively large with a total length of 2652bp, the vector was constructed using the enzyme ligation method. Restriction sites were introduced in advance when designing primers, and the pRP1028 plasmid was digested with restriction endonucleases BamHⅠ and SalⅠ, and the T7RNA Polymerase fragment was recovered and ligated with T4 ligase (ligation conditions were: 6μL of linear vector, 10μL of fragment, 2μL of 10× ligase buffer, and 2μL of T4 DNA ligase. Ligation was performed at 16℃ for 3h), followed by heat shock transformation, and PCR screening of the colonies on the plate; after screening and sequencing of the positive recombinants, they were named pRP1028-RNAP.

[0129] Since primers P43-F and amyEUP-R have homologous sequences, the upstream homology arm of amyE and the P43 fragment were recovered and used as templates together. The primers amyEUP-F and P43-R2 were used for amplification by overlapping PCR, so that the upstream homology arm of amyE and the P43 promoter overlapped and extended to form the knockout box homology arm UP; since the knockout box homology arm UP and the pRP1028-RNAP vector backbone have homologous sequences, pRP1028-RNAP was digested with BamHⅠ and connected by seamless cloning, followed by heat shock transformation, and the colonies on the plate were screened by PCR; after screening to obtain positive recombinants and sequencing them correctly, they were named pRP1028-UP-RNAP.

[0130] Using the pWJX04 recombinant plasmid as a template, PCR amplification was performed using primers SD-AMPs-F, PT7-SD-F, RNAP-T7-F, and AMPs-1028-R to obtain P T7-Signal peptide-antimicrobial peptide fragment. Since the primers RNAP-T7-F and RNAP-Sal1-R have homologous sequences, and the primer AMPs-1028-R has homologous sequences with the pRP1028-UP-RNAP vector backbone, pRP1028-UP-RNAP was digested with SalⅠ and recovered to seamlessly clone and connect with the signal peptide-antimicrobial peptide fragment, followed by heat shock transformation, and PCR screening of the colonies on the plate; after screening and sequencing of positive recombinants, the antimicrobial peptide multi-tandem expression cassette knock-in vector pRP1028-amyE-AMPs-spec was obtained. r Specific steps are as follows: Figure 5 shown.

[0131] The present invention uses a triparental conjugation method to obtain a BS168 engineering strain capable of stably inheriting multiple tandem expression cassettes of antimicrobial peptides after a gene recombination. r as the donor strain, BS168 as the recipient strain, and DH5α / pSS1827-Amp r As auxiliary strains, three strains of bacteria were shaken overnight in 5 mL of seed solution according to the corresponding resistance, and then transferred to 5 mL of culture medium at a 1% inoculum volume, and the three strains were cultured to OD 600 The concentration of each bacterial solution is about 0.8; 1 mL of each bacterial solution was taken, centrifuged at 4100 rpm for 8 min to collect the bacteria, washed 3 times with 1 mL of antibiotic-free LB to ensure that the antibiotics were washed away, and resuspended with 500 μL of antibiotic-free LB respectively; 50 μL of the three strains were taken in the same sterile centrifuge tube, mixed thoroughly, and the 150 μL mixed solution was spotted on the antibiotic-free plate, dried naturally, and transferred to 28°C for incubation for about 24 hours; all the plaques were transferred to a clean centrifuge tube with a pipette tip, resuspended with 200 μL of antibiotic-free LB, and evenly spread on a resistance plate containing 300 μg / mL spectinomycin and 60 active units of polymyxin, and incubated at 28°C for about 12 hours; a single colony was picked and placed in 5 mL The cells were shaken overnight at 28°C in 300 μg / mL spectinomycin liquid LB; the cells were transferred to 5 mL of resistance culture medium at a 1% inoculation volume, shaken at 37°C for about 8 hours, and subcultured three times to eliminate the unintegrated knock-in vector in BS168; the target colony was cultured on a streak plate at 37°C, a single red colony was picked and shaken overnight at 28°C in 300 μg / mL spectinomycin-resistant LB, and total DNA was extracted and PCR verified using upstream inside and outside primers UP-F and T7 in R, and downstream inside and outside primers CPB in F and DN-R. If the verification was correct, it was a BS168 single exchange strain with 300 μg / mL spectinomycin resistance, which was a recombinant Bacillus subtilis strain that produced four antimicrobial peptides and could be stably inherited.

[0132] Example 3 Verification of the effect of engineering bacteria expressing antimicrobial peptides

[0133] The present invention constructs a BS168 engineering bacterium that efficiently expresses multiple antimicrobial peptides and can be stably inherited. The strain can be activated by P43 to secrete and express 4 antimicrobial peptides. The fermentation supernatant is frozen and concentrated to obtain a crude antimicrobial peptide extract. The specific operation is as follows. Pick a single colony to shake seed liquid without antibiotics overnight in LB, transfer it to 100mL of LB medium without antibiotics at a 1% inoculation amount, ferment at 28°C for 48h, centrifuge at 4100rpm for 11min to collect the supernatant, freeze-dry and concentrate, resuspend with double distilled water at 0.25g / mL, centrifuge at 12000rpm for 10min, filter and sterilize the supernatant, and store at -20°C for standby use.

[0134] Since the selected antimicrobial peptides are specific antagonists of Gram-negative bacteria, only Gram-negative model bacteria Escherichia coli are considered when verifying the antibacterial effect. The antibacterial zone experiment mainly judges the antibacterial effect of the drug by the diameter of the transparent lysis zone produced by the drug on the test bacteria; the Escherichia coli seed liquid is shaken overnight, and 1 mL is diluted to 10 -3 The bacterial solution was evenly spread on the antibiotic-free plate, and holes were made on the agar using a blue pipette tip. Sterile water and wild-type BS168 fermentation freeze-dried resuspension were set as controls. 150 μL of each sample was loaded, and three parallel plates were set up. After natural drying, the plates were transferred to 37°C for culture for 8 hours. The growth curve was determined according to the method in Example 1.

[0135] The results are as follows Figure 6 As shown, (a) D10 is the inhibition zone of the fermentation supernatant of the recombinant Bacillus subtilis strain producing four antimicrobial peptides, and sterile water and BS168 fermentation supernatant were set as controls, and the sample volume was 200 μL; (b) is the growth curve of the engineered bacteria fermentation supernatant inhibiting the growth of Escherichia coli, CK is the growth curve of Escherichia coli added with sterile water; 168 is the growth curve of Escherichia coli added with the wild-type BS168 fermentation supernatant; D10 is the growth curve of Escherichia coli added with the fermentation supernatant of the recombinant Bacillus subtilis strain producing four antimicrobial peptides; It can be seen from (a) that only the D10 experimental group has a transparent inhibition zone, indicating that the engineered bacteria fermentation supernatant has a good inhibitory effect on Escherichia coli. The growth status of E. coli in group 168 in (b) was consistent with that in the blank control group, indicating that the fermentation supernatant of wild-type Bacillus subtilis had no inhibitory effect on E. coli; while the E. coli in the D10 experimental group hardly grew over time, indicating that the fermentation supernatant of the recombinant Bacillus subtilis strain had a significant inhibitory effect on E. coli, further proving that the antimicrobial peptide expressed by the recombinant engineered bacteria had good antibacterial activity.

[0136] Example 4 Molecular identification of the target antimicrobial peptide

[0137] 3 mL of the concentrated fermentation supernatant of the engineered bacteria was taken for mass spectrometry experiments, the protein was extracted by SDT cleavage method, the protein was hydrolyzed by trypsin, and HPLC was used for separation. The samples after chromatographic separation were analyzed by mass spectrometry using a high-resolution mass spectrometer, and Maxquant software was used for library identification and quantitative analysis.

[0138] The identification results are as follows Figure 7 As shown, (a) is the cecropin A peptide; (b) is the cecropin B peptide; (c) is the honey bee peptide Ia peptide. This proves that the recombinant Bacillus subtilis strain has achieved the expression of multiple antimicrobial peptides.

[0139] Obviously, the above embodiments of the present invention are merely examples for clearly explaining the present invention, and are not intended to limit the implementation methods of the present invention. For ordinary technical users in the relevant field, other different forms of changes or modifications can be made on the basis of the above description. It is not necessary and impossible to list all the implementation methods here. Any modifications, equivalent substitutions and improvements made within the spirit and principles of the present invention should be included in the protection scope of the claims of the present invention.

Claims

1. A recombinant Bacillus subtilis strain producing four antimicrobial peptides, characterized in that: The strain comprises a multi-tandem expression cassette as shown in SEQ ID NO.1; The multi-tandem expression cassette uses T7 as a promoter, and downstream of the promoter, a ribosome binding site SD, a signal peptide SP gene, a cecropin A gene, a ribosome binding site SD, a signal peptide SacB gene, a honey bee peptide Ia gene, a ribosome binding site SD, a signal peptide AP gene, a cecropin B gene, a ribosome binding site SD, a signal peptide dacB gene and a tachyplepeptidin I gene are sequentially connected in series.

2. The method for preparing the recombinant Bacillus subtilis according to claim 1, characterized in that: The gene sequences of cecropin A, cecropin B, honeybee peptide Ia and tachyplepeptidin I are connected in series, and a T7 promoter, a ribosome binding site and a signal peptide are added to promote secretory expression to obtain a multi-tandem expression cassette, which is then inserted into Bacillus subtilis to obtain the recombinant Bacillus subtilis.

3. The preparation method according to claim 2, characterized in that: The signal peptides include SP, SacB, AP and dacB.

4. The preparation method according to claim 2, characterized in that: The nucleotide sequence of the multi-tandem expression cassette is shown in SEQ ID NO.

1.

5. The preparation method according to claim 2, characterized in that: The homologous sequence of the gene amyE, the P43 promoter, the T7 RNA polymerase and the multi-tandem expression cassette are tandemly connected to construct a gene knock-in vector, wherein the multi-tandem expression cassette knock-in vector is pRP1028-amyE-AMPs-spec r , and its knock-in box sequence is shown in SEQ ID NO.

2.

6. The preparation method according to claim 5, characterized in that: The inserting of the multiple tandem expression cassette into Bacillus subtilis specifically comprises: inserting the multiple tandem expression cassette knock-in vector into the α-amylase gene amyE of Bacillus subtilis.

7. A method for producing an antimicrobial peptide, characterized in that: The recombinant Bacillus subtilis according to claim 1 is used to produce antimicrobial peptides.

Images