An exo-acting alginate lyase Alg1982 gene and its application

Abstract

The present invention discloses an exo-type alginate lyase Alg1982 gene and its application. The alginate lyase Alg1982 gene of the present invention is constructed by engineering bacteria to obtain an engineering bacterium producing the exo-type alginate lyase Alg1982. The exo-type alginate lyase Alg1982 produced by the engineering bacteria has high specificity for the substrate PolyG, has low activity for PolyM and sodium alginate, and the main product of the degradation substrate is unsaturated monosaccharide, which can be used for the production of bioethanol. At the same time, the degradation product also has good antioxidant capacity and can be used for the preparation of natural antioxidants. In addition, the product prepared by the alginate lyase Alg1982 of the present invention has a significant effect on LPS-induced PC12 cell apoptosis, improves the cell viability decline or apoptosis induced by LPS alone, and has a large application prospect.

Description

Technical Field

[0001] The invention relates to the technical field of biotechnology, and in particular to an exo-alginate lyase Alg1982 gene and application thereof. Background Art

[0002] Alginate lyase is a polysaccharide lyase (PLs, EC4.2.2.-) that degrades the glycosidic 1-4-O-bond in alginate by β-elimination, forming a double bond between C4 and C5, and forming an oligomer with 4-deoxy-1-erythro-hex-4-enopyranosyluronate at the new non-reducing end. Alginate lyases can be divided into endo- and exo-enzymes according to the degradation mode. Most of the reported alginate lyases are endo-enzymes that degrade alginate from the inside into oligosaccharides, usually dimers, trimers, tetramers or pentamers. A few exo-enzymes can exo-cleave alginate or alginate oligosaccharides from the end to form unsaturated monosaccharides. Unsaturated monosaccharides are further converted into 4-deoxy-L-erythro-5-hexoseulose uronic acid (DEH) under non-enzymatic conversion and enter the ED pathway to produce bioethanol.

[0003] The substrate specificity of alginate lyase is defined based on whether it degrades M or G, and most alginate lyases prefer PolyM (sodium polymannouronate) for substrate degradation, and only a small number of them have substrate specificity of PolyG (sodium polyguluronate). Depending on the enzyme degradation mode and substrate preference, the degradation products produced also have different functional properties. Alginate oligosaccharides (AOS) have been reported to have biological effects as immunomodulators, nutritional supplements, antimicrobial agents, antioxidants, antidiabetic drugs, etc. At present, there are few studies on the preference of alginate lyase for substrate degradation of PolyG. It is of great significance to expand the research of alginate lyases with more substrate preference of PolyG and study and utilize them for the industrial development of alginate lyase. Summary of the invention

[0004] The invention overcomes the technical problem that the prior art alginate lyase has little research preference on degrading substrates of PolyG, and provides an exo-type alginate lyase Alg1982 gene with a substrate preference of PolyG and an application thereof.

[0005] To solve the above problems, the present invention adopts the following technical solutions:

[0006] An exo-acting alginate lyase Alg1982 gene, the nucleotide sequence of which is shown in SEQ ID NO:1.

[0007] An exo-alginate lyase Alg1982 encoded by the exo-alginate lyase Alg1982 gene has an amino acid sequence as shown in SEQ ID NO.2.

[0008] An engineered bacterium capable of producing exo-alginate lyase Alg1982 is provided. A recombinant plasmid containing the exo-alginate lyase Alg1982 gene and plasmid pET30a is constructed, and the recombinant plasmid is connected to Escherichia coli to obtain an engineered bacterium capable of producing exo-alginate lyase Alg1982.

[0009] The method for preparing alginate lyase using the above-mentioned engineered bacteria that produce exo-type alginate lyase Alg1982 comprises the following steps: the engineered bacteria are induced by IPTG to produce alginate lyase Alg1982 inclusion bodies, and the alginate lyase Alg1982 inclusion body protein is denatured and renatured, and then separated and purified to obtain the target protein exo-type alginate lyase Alg1982.

[0010] Furthermore, another object of the present invention is to protect the use of the exo-alginate lyase Alg1982 in the preparation of monosaccharides.

[0011] Furthermore, another object of the present invention is to protect the use of the exo-acting alginate lyase Alg1982 in the preparation of ethanol.

[0012] Furthermore, another object of the present invention is to protect the use of the exo-acting alginate lyase Alg1982 in the preparation of natural antioxidants.

[0013] Furthermore, another object of the present invention is to protect the role of the exo-alginate lyase Alg1982 in LPS-induced PC12 cell apoptosis.

[0014] Compared with the prior art, the present invention has the following beneficial effects:

[0015] The present invention obtains an engineered bacterium capable of producing exo-alginate lyase Alg1982 by constructing an engineering bacterium with an exo-alginate lyase Alg1982 gene, and obtains the exo-alginate lyase Alg1982 after culture, separation and purification. The exo-alginate lyase Alg1982 has high specificity for the substrate PolyG, and has low activity for PolyM and sodium alginate. The main product of the substrate degradation by the alginate lyase Alg1982 is unsaturated monosaccharide, which can be used for the production of bioethanol and has good application prospects in industry. The product prepared by the exo-alginate lyase Alg1982 of the present invention has good antioxidant ability, and the EC50 for scavenging DPPH free radicals is 3.58 mg / ml; the EC50 for scavenging ABTS is 0.17 mg / ml, and can be used to prepare natural antioxidants. In addition, the product prepared by the exo-alginate lyase Alg1982 of the present invention has a significant effect on LPS-induced PC12 cell apoptosis, improves the cell viability decline or apoptosis induced by LPS alone, and has great application prospects. The exo-alginate lyase Alg1982 of the present invention also has the characteristics of good alkali resistance. When the pH value is 12, 87% of the enzyme activity is retained. Compared with the alginate lyase reported in the prior art, it has good alkali resistance, and therefore has good prospects for industrial production. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 This is a diagram of the separation and purification of the exo-alginate lyase Alg1982 protein prepared in Example 3. Figure 1 In the table, M is a protein standard; 1 is the purified alginate lyase Alg1982;

[0017] Figure 2 This is a graph showing the optimum reaction pH of the exo-alginate lyase Alg1982 prepared in Example 3;

[0018] Figure 3 This is a graph showing the pH stability of the exo-alginate lyase Alg1982 prepared in Example 3;

[0019] Figure 4 This is a graph showing the optimum reaction temperature of the exo-alginate lyase Alg1982 prepared in Example 3.

[0020] Figure 5 This is a graph showing the temperature stability of the exo-alginate lyase Alg1982 prepared in Example 3;

[0021] Figure 6 Substrate preference analysis diagram of the exo-alginate lyase Alg1982 prepared in Example 3;

[0022] Figure 7 The degradation product spectrum of the alginate lyase Alg1982 prepared in Example 3 is detected by thin layer chromatography (TLC);

[0023] Figure 8 The degradation product spectrum of the alginate lyase Alg1982 prepared in Example 3 is detected by high performance liquid chromatography (HPLC);

[0024] Fig. 9 The degradation product spectrum of the alginate lyase Alg1982 prepared in Example 3 was detected by liquid chromatography-mass spectrometry (LC-MS);

[0025] Fig.10 This is a graph showing the scavenging effect of the degradation product of the exo-alginate lyase Alg1982 prepared in Example 3 on DPPH free radicals;

[0026] Fig.11 This is a graph showing the scavenging effect of the degradation product of the exo-alginate lyase Alg1982 prepared in Example 3 on ABTS free radicals;

[0027] Fig.12 This is a diagram showing the effect of the degradation product of the exo-alginate lyase Alg1982 prepared in Example 3 on LPS-induced apoptosis of PC12 cells.

[0028] Fig.13 The figure shows the effect of AlgX degradation products on LPS-induced apoptosis of PC12 cells.

[0029] Figure 6-Figure 8 Among them, DP1 is a saturated monosaccharide; DP2 is a saturated disaccharide; DP3 is a saturated trisaccharide; ΔDP1 is an unsaturated monosaccharide; ΔDP2 is an unsaturated disaccharide; ΔDP3 is an unsaturated trisaccharide. DETAILED DESCRIPTION

[0030] The present invention will be further described below in conjunction with examples and tests.

[0031] Example 1

[0032] An exo-acting alginate lyase Alg1982 gene, the nucleotide sequence of which is shown in SEQ ID NO:1.

[0033] Example 2

[0034] An exo-alginate lyase Alg1982 encoded by the exo-alginate lyase Alg1982 gene has an amino acid sequence as shown in SEQ ID NO.2.

[0035] Example 3

[0036] An engineered bacterium capable of producing exo-alginate lyase Alg1982 is disclosed. A recombinant plasmid containing the exo-alginate lyase Alg1982 gene of Example 1 and plasmid pET30a is constructed, and the recombinant plasmid is connected to Escherichia coli to obtain an engineered bacterium capable of producing exo-alginate lyase Alg1982.

[0037] The method for preparing alginate lyase using the above-mentioned engineered bacteria that produce exo-type alginate lyase Alg1982 comprises the following steps: the engineered bacteria are induced by IPTG to produce alginate lyase Alg1982 inclusion bodies, and the alginate lyase Alg1982 inclusion body protein is denatured and renatured, and then separated and purified to obtain the target protein exo-type alginate lyase Alg1982.

[0038] The specific operations are as follows:

[0039] S1 Recombination and expression of alginate lyase Alg1982 gene to obtain an engineered bacterium producing exo-type alginate lyase Alg1982:

[0040] According to the predicted sequence of the alginate lyase gene sequence after removing the signal peptide in the whole genome annotation results of Vibrio sp.X511 strain, and the multiple cloning site sequence on the plasmid pET30a, the restriction sites NdeI and XhoI were introduced to design PCR primers. The primer sequences are as follows, and the restriction sites are underlined.

[0041] Alg1982-F:GGAATTC CATATG TCTGATGTAAATAATGGTATCG (underlined NdeI site), Alg1982-R: GCC CTCGAG CTTGCCGTTTAGCTTAAGCT (Xho I site is underlined).

[0042] PCR program: 98°C pre-denaturation for 3 minutes; 98°C denaturation for 15 seconds, 60°C annealing for 15 seconds, 72°C extension for 25 seconds, a total of 36 cycles; 72°C extension for 10 minutes. The DNA polymerase used in the PCR reaction was Primerstar Max purchased from Takara Biotechnology (Dalian) Co., Ltd. The PCR product was recovered by agarose gel electrophoresis.

[0043] The PCR product and pET30a(+) plasmid DNA were double-digested with restriction endonucleases NdeI and Xho I, and purified and recovered after digestion with a common DNA product purification kit (refer to the kit instructions for steps). The PCR product and pET30a(+) plasmid after double digestion were connected with T4 ligase, and the connection product was transformed into Escherichia coli DH5ɑ strain, and a single clone was picked and transferred to LB liquid culture medium containing 50umol / L kanamycin for overnight culture, and the plasmid was extracted for sequencing verification, and the positive clone with completely correct sequence was selected and transferred to Rosetta (DE3) strain, and the engineered bacteria producing exo-type alginate lyase Alg1982 were obtained.

[0044] S2 culture and purification to obtain exo-alginate lyase Alg1982:

[0045] The positive clones transformed successfully by S1, i.e. the engineered bacteria producing the exo-alginate lyase Alg1982, were cultured overnight in LB liquid medium containing kanamycin at a final concentration of 50 μmol / L at 37°C and 200 r / min, and then inoculated into 1 L LB liquid medium containing kanamycin at a final concentration of 50 μmol / L at a ratio of 1%, and cultured in a shaking incubator at 37°C and 200 r / min until the OD 600 When the pH reached 0.5-0.8, IPTG was added at a final concentration of 0.5 mmol / L for induction and cultured overnight at 16°C. Protein separation and purification experiments were all carried out at 4°C.

[0046] Collect the bacteria by centrifugation, wash them with 50mmol / L Tris-HCl buffer (pH 7.5), and suspend them in 50mmol / LTris-HCl buffer (pH 7.5) and ultrasonically disrupt them. After the lysate was centrifuged at 12000r / min for 30min, the precipitate was collected, and it was resuspended and washed with 2mol / L urea and 50mmol / L Tris-HCl buffer in sequence, and then the precipitate was collected. Add 10ml 6M urea to 1g of precipitate and mix thoroughly to denature the protein. The denatured protein was placed in a dialysis bag and the renatured protein was obtained after overnight in 50mmol / L Tris-HCl buffer. The renatured protein was then separated and purified using a hydrophobic column, mono Q and a molecular sieve column SuperdexTM7510 / 300GL, and the protein was concentrated using an ultrafiltration centrifuge tube with a molecular weight cutoff of 30kDa. The protein purity was detected by 12% SDS-PAGE, and an obvious protein characteristic band appeared at about 38kD. For details, see Figure 1 As shown, the protein molecular weight is consistent with the theoretical molecular weight deduced from the 1982 gene sequence, and the protein purity is over 99%.

[0047] The alginate lyase Alg1982 obtained above was subjected to the following assay studies:

[0048] 1. Enzyme activity determination:

[0049] The alginate lyase Alg1982 obtained above was tested for enzyme activity. 490uL of 0.1% (W / V) PolyG solution (0.1gPolyG dissolved in 100mL, pH7.0, 50mmol / L Na2HPO4-NaH2PO4 buffer) was taken, 10uL of 0.2mg / mL enzyme solution was added, and the reaction was carried out in a water bath at the optimum reaction temperature for 20min, and then the reaction was terminated in a boiling water bath for 10min. After cooling to room temperature, the light absorption value of the reaction system at 235nm was measured. Under this condition, an increase of 0.1 in light absorption value per minute was defined as one enzyme activity unit (U). The enzyme activity of the enzyme was 114.81U / mg.

[0050] 2. Effects of pH and temperature on alginate lyase Alg1982:

[0051] Study on the optimal reaction pH: Prepare a series of buffer solutions with a pH of 5.5-9.0, wherein Na2HPO4-NaH2PO4 buffer solution (50mmol / L) is used for pH 5.5-8.0, and Tris-HCl buffer solution (50mmol / L) is used for pH 8.5-9.0. The optimal pH of alginate lyase Alg1982 was determined using 0.1% PolyG as substrate. The reaction temperature was 25°C, the reaction time was 20min, and the enzyme activity at the optimal pH was set as 100%, and the relative enzyme activity was calculated. The optimal pH of the enzyme is 7.0. For details, see Figure 2 shown.

[0052] pH stability study: Alginate lyase Alg1982 was placed in different pH buffers, acetic acid-sodium acetate buffer (50mmol / L) was used when pH was 4.0-5.5, Na2HPO4-NaH2PO4 buffer (50mmol / L) was used when pH was 5.5-8.0, Tris-HCl buffer (50mmol / L) was used when pH was 8.0-8.5, and Gly-NaOH buffer (50mmol / L) was used when pH was 8.5-12. After being incubated at 4°C for 24 hours, the residual activity of the recombinant enzyme was determined. After being incubated in pH7-10.6 buffer for 24 hours, the enzyme still had 90% residual enzyme activity, and at pH 12, it still had 87% residual enzyme activity, indicating that the enzyme has strong alkaline resistance. For details, please refer to Figure 3 shown.

[0053] Study on the optimal reaction temperature: Using 0.1% PolyG as substrate, the enzyme activity of alginate lyase Alg1982 was measured in the temperature range of 10-40°C. The enzyme activity at the optimal temperature was set as 100% and the relative enzyme activity was calculated. The optimal temperature of the enzyme is 25°C. For details, see Figure 4 shown.

[0054] Temperature stability study: After the alginate lyase Alg1982 was placed in a water bath at different temperatures in the range of 15-80°C for 30 minutes, the residual activity of the recombinant enzyme was measured, and the relative enzyme activity was calculated with the untreated enzyme activity as 100%. After the enzyme was kept at 20-35°C for 30 minutes, the residual enzyme activity of the recombinant enzyme Alg1982 was above 90%. The results are shown in Figure 5 shown.

[0055] 3. Analysis of substrate preference of alginate lyase Alg1982

[0056] In the optimal pH buffer system, sodium alginate (SA), PolyG and PolyM were used as substrates, respectively, and the reaction was carried out at the optimal reaction temperature for 20 minutes to determine the activity of Alg1982. The results are shown in Figure 6 .Depend on Figure 6 It can be seen that the substrate preference of this enzyme is PolyG.

[0057] 4. Analysis of degradation products of alginate lyase Alg1982

[0058] Product sample preparation: 200ul PolyG was added with 10ul 1.44mg / mL Alg1982 and placed in a 20℃ metal bath for reaction for 0h, 0.5h, 2h, 4h, 8h, 12h, 24h, 48h, and 72h. The sample was immediately frozen in liquid nitrogen and stored at -20℃ for later use.

[0059] Thin layer chromatography (TLC) detection: pre-dry the TLC plate in a 50℃ oven for 10 minutes, spot the samples with different reaction times on the plate, place it in a developing tank with a developing agent (n-butanol: formic acid: water = 3:2:1) for 5 hours, blow dry the plate, spray it evenly with a color developer (10 mg 1,3-naphthalene diol, 1% sulfuric acid, 40% ethanol, add ddH2O to 10 ml), take it out and blow dry, and bake it at 100℃ for 10 minutes. See the results. Figure 7 As shown. From the TLC chart ( Figure 7 ) shows that monosaccharides are the main products.

[0060] High performance liquid chromatography (HPLC) detection: High performance liquid chromatography waters2696 was used to separate the products of different reaction times. The product separation conditions were: column Superdex peptide 10 / 300GE Colum (GE Health), column temperature 25°C, detection wavelength 235nm, sample 50ul, mobile phase 0.1M NH4HCO3, flow rate 0.3ml / min. The HPLC analysis confirmed the results of TLC. The results are as follows Figure 8 As shown. Figure 8 It can be seen that the initial products are monosaccharides and trisaccharides, with monosaccharides being the main product. As the reaction time increases, disaccharides appear after 24 hours of degradation, and the content of disaccharides exceeds that of trisaccharides after 48 hours of degradation.

[0061] Liquid chromatography-mass spectrometry (LC-MS) detection: Liquid chromatography-triple quadrupole mass spectrometer was used to identify and analyze the degradation products after 48 hours. Mass spectrometry conditions: mobile phase is 75% acetonitrile (containing 0.1% formic acid), sample volume is 2uL, flow rate is 0.2mL / min, negative ion mode, voltage is 3.50kv, sheath gas is N2. Results can be found in Fig. 9 As shown. Fig. 9 It can be seen that the molecular weight of the main product and the product are unsaturated monosaccharides.

[0062] From the above analysis, it can be seen that the exo-acting alginate lyase Alg1982 can be used to prepare monosaccharides. Therefore, the alginate lyase Alg1982 of the present invention can be used for the production of bioethanol.

[0063] 5. Antioxidant activity of products of alginate lyase Alg1982

[0064] Product sample preparation: 200ul PolyG was added with 10ul 1.44mg / mL Alg1982, placed in a 20℃ metal bath for reaction for 72h, boiled in boiling water for 10 minutes to terminate the reaction, and then the following tests were performed after cooling.

[0065] 5.1DPPH method

[0066] Prepare 0.16mg / ml DPPH solution (prepared in anhydrous ethanol), the concentration of alginate lyase Alg1982 enzymatic hydrolysis product is 38.46mg / ml. Different volumes of enzymatic hydrolysis product 5ul, 10ul, 15ul, 20ul, 25ul, 30ul, 35ul were added to 220ul DPPH solution respectively, incubated in the dark for 30min, taken out after the time, centrifuged and the supernatant was measured at a wavelength of 517nm. The same volume of PBS buffer was used as a blank control, and VC was used as a positive control. DPPH scavenging ability (%) = (A0-As) / A0*100%. A0 and As are the absorbance values ​​of the blank control and the sample measured at a wavelength of 517nm respectively. Fig.10 As shown, when the product concentration is 5 mg / ml, the scavenging rate of DPPH free radicals is 80%, and the EC50 value is 3.58 mg / ml.

[0067] 5.2 ABTS method

[0068] Equal amounts of ABTS (7mM) and K2S204 (2.45mM) were mixed, incubated in the dark for 16h, diluted with PBS7.0, and the absorbance at A734nm was 0.7±0.0200. 20ul of the enzymatic hydrolysate was added to 200ul of ABTS solution, incubated at 37°C for 15min, with PBS buffer as the blank control and VC as the positive control, and the absorbance of the mixture was measured at 734nm. ABTS scavenging ability (%) = (A0-As) / A0*100%. A0 and As are the absorbance values ​​of the blank control and the sample measured at a wavelength of 734nm, respectively. Fig.11 As shown, when the product concentration is 0.67 mg / ml, the scavenging rate of ABTS free radical is 91%, which is equivalent to the scavenging ability of vitamin C for ABTS, and the EC50 value is 0.17 mg / ml.

[0069] The above test results indicate that exo-alginate lyase Alg1982 can be used to prepare natural antioxidants.

[0070] 6. Role of alginate lyase Alg1982 in LPS-induced apoptosis of PC12 cells

[0071] 6.1 Product sample preparation:

[0072] Alg1982 product: polyG is used as substrate, and Alg1982 reacts at the optimal temperature and optimal pH for 72 hours.

[0073] AlgX product: AlgX and Alg1982 belong to the PL7 family and can degrade PolyM, PolyG and sodium alginate at the same time (in this experiment, AlgX is the alginate lyase AlgX1989 disclosed in the invention titled "An alginate lyase AlgX1989 and its application", and the patent application number is "202210876781.5"). In this experiment, PolyG was used as the substrate for the experiment, and AlgX reacted with the substrate at its optimal temperature and optimal pH for 72 hours, and the main product was trisaccharide.

[0074] 6.2 Experimental grouping (cell volume 1*10 4 cells / well)

[0075] ①: PC12 cells

[0076] ②: PC12 cells + LPS (1ug / ml)

[0077] ③: PC12 cells + LPS + Alg1982 product (200ng / ml)

[0078] ④: PC12 cells + LPS + Alg1982 product (400ng / ml)

[0079] ⑤: PC12 cells + LPS + Alg1982 product (600ng / ml)

[0080] ⑥: PC12 cells + LPS + AlgX product (200ng / ml)

[0081] ⑦: PC12 cells + LPS + AlgX product (400ng / ml)

[0082] ⑧: PC12 cells + LPS + AlgX product (600ng / ml)

[0083] 6.3 Cell culture and treatment

[0084] 1) PC12 cells were revived, thawed quickly at 37°C, centrifuged at 1200 rpm for 3 min, and the supernatant was discarded;

[0085] 2) Then add 3 mL of the corresponding complete culture medium to resuspend the seeds in a 6 cm cell culture dish and culture in a cell culture incubator at 37°C and 5% CO2;

[0086] 3) After 24 hours of thawing, observe the growth of the cells. When the cell density reaches more than 80%, they can be passaged.

[0087] 4) Pour out the original culture medium in the culture dish, rinse twice with PBS, add 500ul 0.25% trypsin to digest the cells, observe the cell digestion, aspirate the trypsin after the cells become round, add an equal volume of complete culture medium to blow the cells into a single cell suspension, mix the cells; centrifuge at 1200rpm for 3min, discard the supernatant; add complete culture medium to resuspend, and count the cells.

[0088] 5) Adjust the cell concentration to 1×10 5 cells / mL, inoculated into 96-well culture plates, 100 μl per well, set up in triplicate, and cultured in a 37°C, 5% CO2 incubator for 24 h;

[0089] 6) According to the above experimental groups, the drugs were diluted with complete culture medium to make the final concentrations 200ng / ml, 400ng / ml, and 600ng / ml respectively. The final concentration of LPS was 1ug / ml.

[0090] 7) The cells were cultured in a 37°C, 5% CO2 incubator, and CCK8 assay was performed after 24 hours of culture;

[0091] 8) Add 10 μl of CCK-8 to each well and incubate in a 37°C, 5% CO2 incubator in the dark for 1 to 4 hours;

[0092] 9) Measure the OD value at the same time point using an enzyme marker at a wavelength of 450 nm, and use the measured OD value to analyze the cell proliferation ability.

[0093] Ordinary one-way ANOVA was used as the statistical method.

[0094] 6.4 Experimental Results

[0095] The results of CCK8 experiments showed that Fig.12 and 13 As shown:

[0096] Depend on Fig.12 and 13 It can be seen that when PC12 cells were treated with LPS (1 μg / mL) for 24 hours, the cell viability was significantly reduced compared with the blank group. When LPS was co-incubated with different concentrations of Alg1982 products and AlgX products, the cell viability was significantly enhanced compared with the model group. The cell viability decline or apoptosis induced by LPS alone was improved. When the 1982 product was added to 600 ug / ml, it was 11% higher than the AlgX product. Therefore, the enzymatic hydrolysis product of the exo-type alginate lyase Alg1982 of the present invention has the effect of improving the cell viability decline or apoptosis induced by LPS in PC12 cells, and has a great application prospect.

[0097] The above description is a detailed description of the preferred feasible embodiments of the present invention, but the embodiments are not intended to limit the scope of the patent application of the present invention. All equivalent changes or modified changes completed under the technical spirit suggested by the present invention should fall within the patent scope covered by the present invention.

Claims

1. Application of exo-alginate lyase Alg1982 in the preparation of unsaturated monosaccharides, characterized in that: The amino acid sequence of the exo-alginate lyase Alg1982 is shown in SEQ ID NO.2; the substrate of the exo-alginate lyase Alg1982 in preparing unsaturated monosaccharides is sodium polyguluronate.

2. The use according to claim 1, characterized in that: The preparation method of the exo-acting alginate lyase Alg1982 is as follows: (1) The gene containing the exo-alginate lyase Alg1982 was combined with the plasmid pET30a to construct a recombinant plasmid, and the recombinant plasmid was connected to Escherichia coli to obtain an engineered bacterium capable of producing the exo-alginate lyase Alg1982; (2) Inducing the engineered bacteria in step (1) with IPTG to produce inclusion bodies of alginate lyase Alg1982, and separating and purifying the inclusion body protein of alginate lyase Alg1982 after denaturation and renaturation to obtain the target protein exo-type alginate lyase Alg1982; The nucleic acid sequence of the exo-alginate lyase Alg1982 gene is shown in SEQ ID NO.1.

Images