A primer set and kit for detecting intraocular bacterial infection and its application

Abstract

The present application relates to a primer set, a kit and its application for detecting intraocular bacterial infection, and belongs to the field of biological detection technology. The primer set for detecting intraocular bacterial infection in the present application includes a detection primer pair, a detection probe, an exogenous internal standard primer pair and an exogenous internal standard probe. The present application also discloses a kit for detecting intraocular bacterial infection, including the above-mentioned primer set for detecting intraocular bacterial infection, a PCR reaction premix, a negative quality control product, a positive quality control product, a nucleic acid releaser, a PCR decontamination reagent and an exogenous internal standard. The present application can specifically detect whether the sample contains bacteria by performing qPCR on the eye (intraocular fluid) sample, and can still complete the detection of the sample when the sample amount is small or the bacterial content is low. The minimum detection limit can reach 34CFU / mL, which has the advantages of rapid and simple detection of whether bacteria exist in a single sample, and high sensitivity, strong specificity and a wide detection range.

Description

Technical Field

[0001] The present application relates to the field of molecular biological detection technology, and in particular to a primer set, a kit and applications thereof for detecting intraocular bacterial infection. Background Art

[0002] Bacterial infection is the main cause of infectious endophthalmitis. Bacterial infection often leads to varying degrees of damage to the eye tissue, most of which seriously affect vision and is one of the main factors causing blindness.

[0003] Bacterial eye infections are different from pathogens such as fungi, viruses, and parasites. Timely drug treatment (including systemic or local intraocular injection) is required to save the affected eye. Early use of antibacterial drugs is extremely important.

[0004] At present, the clinical diagnosis of ocular pathogens mainly relies on the traditional smear method and isolation culture method. The smear method has a low positive rate. Although the culture method is the gold standard for clinical pathogen diagnosis, it still has certain limitations, including: 1) a large number of bacterial pathogens are difficult to culture or cannot be cultured in vitro; 2) the positive rate is low, only about 20% are detected; 3) the detection is time-consuming: conventional detection takes 1-4 days, and some slow-growing bacteria require 3-4 weeks to obtain culture results; 4) the operation is cumbersome: high requirements for experimental personnel, and the results are not reproducible; 5) only live bacteria can be detected, and it is very likely that they cannot be cultured after antibiotic treatment. It can be seen that there is an urgent need to develop a method for detecting intraocular bacterial infection that is fast, simple, highly sensitive, and highly specific. Summary of the invention

[0005] The purpose of the present application is to overcome the shortcomings of the prior art and provide a primer set, a kit and its application that can detect intraocular infection bacteria in a simple and rapid manner. The primer set and kit described in the present application have the advantages of high sensitivity, strong specificity and simultaneous detection of pathogenic live bacteria and dead bacteria.

[0006] To achieve the above purpose, the technical solution adopted by this application is:

[0007] First, the present application provides a primer set for detecting intraocular bacterial infection, including a detection primer pair, a detection probe, an exogenous internal standard primer pair and an exogenous internal standard probe;

[0008] The primer pair sequences are shown in SEQ ID NO.1 and SEQ ID NO.2;

[0009] The detection probe sequence is shown in SEQ ID NO.3;

[0010] The sequences of the exogenous internal standard primer pair are shown in SEQ ID NO.4 and SEQ ID NO.5;

[0011] The exogenous internal standard probe sequence is shown as SEQ ID NO.6.

[0012] In the present application, multiple sequence alignment of the conserved regions of 16S rRNA of intraocular pathogenic bacteria was performed, and the conserved region sequences of 16S rRNA that had no overlap with other species were determined using BLAST. Two pairs of primers and their corresponding probes were designed according to the primer design principles, and qPCR amplification was performed. The detection primer pairs and probes with the best qPCR amplification effect were screened according to the amplification curve results. The obtained primer set has the advantages of high sensitivity and strong specificity.

[0013] Second, the present application provides an application of at least one of the above primer sets (a) to (b):

[0014] (a) Use in the preparation of a kit for detecting intraocular bacterial infection;

[0015] (b) Use in a test kit for detecting the presence of bacteria in sterile liquids or sterile articles.

[0016] Third, the present application provides a kit for detecting intraocular bacterial infection, including the above-mentioned primer set for detecting intraocular bacterial infection, PCR reaction premix, negative quality control product, positive quality control product, nucleic acid releaser, PCR decontamination reagent and exogenous internal standard.

[0017] The present application can specifically detect whether the sample contains bacteria by performing qPCR on the sample. The sample can still be tested when the sample amount is small or the bacterial content in the sample is low, and the minimum detection limit can reach 34 CFU / mL. Compared with the existing technology, the kit of the present application can quickly and easily detect whether bacteria exist in trace eye samples, and the detection range is wide.

[0018] As a preferred embodiment of the kit described in the present application, it includes at least one of the following (I) to (IV):

[0019] (I) The negative quality control product is sterile ultrapure water; the positive quality control product is a water with a concentration of 1×10 7 ~1×10 8 CFU / ml inactivated Escherichia coli;

[0020] (II) the nucleic acid release agent comprises the following components: 0.01-10 v / v% Tween-20, 0.01-10 v / v% TritonX-100 and 0.01-5 wt% NaOH;

[0021] (III) the PCR decontamination reagent comprises a double-stranded specific DNA enzyme and dithiothreitol;

[0022] (IV) The exogenous internal standard is a pseudovirus particle containing the mouse internal reference gene β-actin sequence.

[0023] As a preferred embodiment of the kit described in the present application, the kit also includes a grinding tube containing grinding beads.

[0024] Fourth, the present application provides a method for detecting intraocular bacterial infection for the purpose of non-disease diagnosis and treatment, comprising the following steps:

[0025] S1. Add the nucleic acid releaser, the intraocular fluid sample to be tested and the exogenous internal standard into a grinding tube containing grinding beads, grind the intraocular fluid sample to be tested using a tissue grinder, retain the supernatant after centrifugation, and the obtained supernatant is the template DNA; the intraocular fluid sample to be tested can be replaced by a negative control product or a positive control product;

[0026] S2, mixing a PCR reaction premix solution and a primer set for detecting intraocular bacterial infection to obtain a mixed solution;

[0027] S3, mixing the mixed solution obtained in step S2 with a PCR decontamination reagent, adding the template DNA obtained in step S1 after incubation, mixing evenly and performing a fluorescent quantitative PCR reaction;

[0028] S4. Determine whether the sample to be tested has bacterial infection according to the Ct value detected in step S3; if the Ct value is ≤35, it is determined to be bacterial infection; if the Ct value is in the range of 35-38, repeat the test, if the Ct value is still in the range of 35-38, it is determined to be bacterial infection; if the Ct value is greater than 38, it is determined to be non-infected.

[0029] This application can accurately and quickly determine whether there are bacteria in the sample by performing nucleic acid lysis-qPCR reaction-result interpretation on the sample to be tested. This application is based on qPCR technology and combines lysis reagents for rapid sample lysis and PCR decontamination reagents to construct a rapid detection method for intraocular bacterial infection. It does not require multiple pairs of primers to achieve the advantages of high efficiency, good specificity, high sensitivity and a wide detection range, and omits purification and other steps to reduce pollution. In particular, it greatly shortens the detection time and obtains the test results in only 100 minutes, which can better meet the needs of clinical testing.

[0030] As a preferred embodiment of the method described in the present application, in step S1, the volume ratio of the nucleic acid releasing agent to the sample to be tested is nucleic acid releasing agent:sample to be tested=(8-9):(1-2).

[0031] As a preferred embodiment of the method described in the present application, in step S3, the volume ratio of the PCR decontamination reagent to the mixed solution obtained in step S2 is PCR decontamination reagent: mixed solution = 1: (15-20).

[0032] As a preferred embodiment of the method described in the present application, in step S3, the incubation reaction conditions are incubating at 35-37°C for 25-35 minutes, and then heating to 55-65°C for incubation for 20-25 minutes.

[0033] As a preferred implementation of the method described in the present application, in step S4, the number of repeated tests is 3-5 times.

[0034] As a preferred embodiment of the method described in the present application, the intraocular fluid sample includes at least one of aqueous humor, vitreous fluid, subretinal fluid or suprachoroidal effusion.

[0035] Compared with the prior art, the beneficial effects of this application are:

[0036] (1) The present application performs multiple sequence alignment on the conserved regions of 16S rRNA of intraocular pathogenic bacteria, uses BLAST to determine the conserved region sequences of 16S rRNA that have no overlap with other species, designs two pairs of primers and their corresponding probes according to the primer design principles, and performs qPCR amplification. The detection primer pairs and probes with the best qPCR amplification effect are screened according to the amplification curve results. The obtained primer set has the advantages of high sensitivity and strong specificity.

[0037] (2) The present application can specifically detect whether the sample contains bacteria by performing qPCR on the sample. The sample can still be tested when the sample amount is small or the bacterial content in the sample is low, and the minimum detection limit can reach 34 CFU / mL. Compared with the methods commonly used in clinical testing of eye samples, the kit and its detection method of the present application can quickly and easily detect whether bacteria exist in eye samples, and the detection range is wide.

[0038] (3) The present application can accurately and quickly determine whether bacteria exist in the sample by performing nucleic acid lysis-qPCR reaction-result interpretation on the sample to be tested. The present application is based on qPCR technology and combines lysis reagents for rapid sample lysis and PCR decontamination reagents to construct a rapid detection method for intraocular bacterial infection. It does not require multiple pairs of primers to achieve the advantages of high efficiency, good specificity, high sensitivity and a wide detection range, and omits purification steps to reduce pollution and greatly shorten the detection time. The test results can be obtained in only 100 minutes, which can better meet the needs of clinical testing. BRIEF DESCRIPTION OF THE DRAWINGS

[0039] Figure 1 The qPCR reaction results of different detection primer pairs and probes in Example 1 of the present application;

[0040] Figure 2The results of the detection of bacterial cell lysis by different nucleic acid releasers in Example 2 of the present application;

[0041] Figure 3 The qPCR reaction results of different nucleic acid release reagents in Example 2 of the present application;

[0042] Figure 4 This is the test result of the effect of the PCR decontamination reagent on PCR reagent 1 in Example 2 of the present application;

[0043] Figure 5 This is the test result of the effect of the PCR decontamination reagent on PCR reagent 2 in Example 2 of the present application;

[0044] Figure 6 The results of the test of the sensitivity of the PCR decontamination reagent to the PCR reaction in Example 2 of the present application;

[0045] Figure 7 This is the sensitivity test result of the detection method of the present application in Example 6 of the present application;

[0046] Figure 8 It is the specific detection result of the detection method of the present application in Example 6 of the present application;

[0047] Fig. 9 It is the specific detection result of the detection method of the present application in Example 6 of the present application;

[0048] Fig.10 This is the clinical application result of the detection method of the present application in Example 7 of the present application. DETAILED DESCRIPTION

[0049] In order to better illustrate the purpose, technical solutions and advantages of the present application, the present application will be further described below in conjunction with specific embodiments.

[0050] Unless otherwise specified, the materials, reagents, etc. used in the embodiments, comparative examples and experimental examples can be obtained from commercial sources.

[0051] Nucleic acid release reagent A is a nucleic acid extraction and purification reagent provided by Guangzhou Daan Gene Co., Ltd.

[0052] Nucleic acid release reagent B is an automatic total nucleic acid extraction reagent provided by Jiangsu Zhenshi Biotechnology Co., Ltd.

[0053] Grinding beads and grinding tubes are MagMAX TM Microbiome Bead Tubes, provided by Thermo Fisher Scientific.

[0054] PCR reagent 1 is Probe qPCR Mix, with UNG, provided by TAKARA, with the catalog number RR392S or RR392A.

[0055] PCR reagent 2 is TaqPath TM BactoPure TM Microbial detection premix, provided by Thermo Fisher, catalog number A52702.

[0056] The primers and probes used in the following examples were synthesized by Sangon Biotechnology (Shanghai) Co., Ltd.

[0057] The fluorescent quantitative PCR in the following examples was performed by ABI7500 (Thermo Fisher Scientific).

[0058] Escherichia coli ATCC8739 was provided by ATCC.

[0059] Example 1

[0060] In order to screen the best primer set for detecting intraocular bacterial infection, this application is designed and screened based on the conserved region sequence of 16S rRNA of common intraocular pathogenic bacteria. The specific scheme is as follows:

[0061] 1. Primer design

[0062] Multiple sequence alignment was performed on the conserved regions of 16S rRNA of pathogenic bacteria retrieved from NCBI-GenBank (https: / / www.ncbi.nlm.nih.gov / genome / ). After BLAST comparison, it was determined that there was no overlap between this region and other species. Two pairs of detection primers and their corresponding probes were designed using Primer Premier 5.0 (Premier Biosoft International, CA, USA). The primer and probe sequences are shown in Table 1.

[0063] Table 1 Detection primers

[0064]

[0065] 2. Primer screening

[0066] DNA of Escherichia coli ATCC8739 was extracted as a template and used with primer sets Bac-1-F / Bac-1-R / Bac-1-P and Bac-2-F / Bac-2-R / Bac-2-P for fluorescence quantitative PCR (qPCR). The PCR reaction premix used was PCR reagent 1. The qPCR reaction system is shown in Table 2. The qPCR reaction conditions are shown in Table 3. The obtained qPCR results are shown in Table Figure 1 .

[0067] Table 2 qPCR reaction system

[0068] Reagents Dosage PCR master mix 10μL 100ng / μL template DNA 2μL 10 μM Primer-F 0.4μL 10 μM Primer-R 0.4μL 10 μM probe 0.8μL <![CDATA[ddH2O]]> Make up to a total volume of 20 μL

[0069] Table 3 qPCR reaction conditions

[0070]

[0071] like Figure 1 As shown, the Bac-1-F / Bac-1-R / Bac-1-P primer set can perform qPCR reaction and obtain the corresponding amplification curve; the relative fluorescence intensity of the Bac-2-F / Bac-2-R / Bac-2-P primer set is 0, indicating that it can not undergo qPCR reaction, so Bac-1-F / Bac-1-R / Bac-1-P is selected as the primer set for detecting intraocular bacterial infection.

[0072] Example 2

[0073] In order to further optimize the detection efficiency of the primers, the method for detecting intraocular bacterial infection was optimized. The specific scheme is as follows:

[0074] 1. Optimization of bacterial nucleic acid release

[0075] Escherichia coli ATCC8739 was mixed with artificial simulated vitreous humor as a positive sample (PC, the final concentration of Escherichia coli was 3.4×10 4 CFU / mL), artificial simulated vitreous humor was used as negative sample (NC), and nucleic acid in the sample was released in the following ways:

[0076] Method A, extract nucleic acid according to the instructions of nucleic acid releasing reagent 1;

[0077] Method B, extracting nucleic acid according to the instructions of Nucleic Acid Release Reagent 2;

[0078] Method C, adding nucleic acid releasing reagent 2 to a grinding tube with grinding beads, and extracting nucleic acids according to the grinding tube instructions;

[0079] The above-mentioned lysed bacteria were subjected to Gram staining, and the results are shown in Figure 2 The nucleic acid extracted above was subjected to qPCR detection according to the method of Example 1, and the results are shown in Figure 3 .

[0080] like Figure 2 As shown, compared with methods A and B, method C can lyse bacteria more completely; Figure 3 As shown, the nucleic acid amplification curves extracted by methods A and B are similar, and the Ct values ​​are also similar. The nucleic acid amplification curve extracted by method C has a higher relative fluorescence intensity and a smaller Ct, indicating that the nucleic acid extracted by method C has a higher purity and releases more nucleic acid.

[0081] 2. Optimization of PCR contamination

[0082] The polymerase used in PCR is easily contaminated by Escherichia coli DNA. When targeting a small amount of bacterial DNA, the DNA carried in the contaminated polymerase may cause the sensitivity of the test to decrease, or even cause a false positive. At the same time, the dNTPs, buffer system, primers, and probes in the PCR reaction system are also susceptible to DNA contamination in the environment during the configuration of the system. Since the detection method of the present application targets the conserved region of the 16S rRNA of bacteria, the designed probe has a high broad spectrum and is very sensitive to bacterial DNA contamination in the environment. If it is contaminated, a false positive result may occur. On this basis, the inventor used a PCR decontamination reagent to treat the PCR reaction system and observed the effect of the PCR decontamination reagent on the PCR reaction. The specific scheme is as follows:

[0083] 1. Effect of PCR decontamination reagents on different PCR reagents

[0084] 0.5 μL of dsDNase and DTT in the PCR decontamination reagent was added to each 20 μL PCR reaction system (the corresponding proportions were adjusted for reaction systems with different volumes). In this scheme, the PCR decontamination reagents were added to PCR reagent 1 and PCR reagent 2, and the qPCR reaction system without template DNA was configured according to Tables 2 and 4, incubated at 37°C for 30 minutes, and then heated to 60°C for 20 minutes to obtain a decontaminated PCR reaction system;

[0085] Six groups were set for each PCR reagent, namely: Deco-NTC (blank control group treated with PCR decontamination reagent and without template), Deco-PC (positive control group treated with PCR decontamination reagent and with Escherichia coli template DNA), Deco-NC (negative control group treated with PCR decontamination reagent and with saline as template DNA), NTC (blank control group not treated with PCR decontamination reagent and without template), PC (positive control group not treated with PCR decontamination reagent and with Escherichia coli template DNA), NC (negative control group not treated with PCR decontamination reagent and with saline as template DNA);

[0086] The template DNA of Escherichia coli ATCC8739 was added to the decontaminated PCR reaction system and qPCR detection was performed. The results are shown in Figure 4-5 .

[0087] The relative fluorescence and Ct values ​​of the amplification curve of PCR reagent 1 were not affected after being treated with PCR decontamination reagent. The relative fluorescence and Ct values ​​of the amplification curves of the Deco-NC group and Deco-NTC group were not different from those of the NC group and NTC group, respectively. Figure 4), while after PCR reagent 2 was treated with PCR decontamination reagent, no detection signal was found in both Deco-NC group and Deco-NTC group ( Figure 5 ), indicating that the use of PCR decontamination reagents to pre-treat the PCR reaction system without template can remove the contaminated DNA in the PCR reaction system, but it is only effective for the PCR reagent 2 tested in this test.

[0088] 2. Effect of PCR decontamination reagents on PCR reaction sensitivity

[0089] The DNA of Escherichia coli ATCC8739 was diluted 1-fold, 10-fold and 100-fold for qPCR detection. A total of 10 groups were set up, namely Deco-NTC, Deco-NC, NTC, NC, Deco-Eco-1:1 (treated with PCR decontamination reagent and added with 1-fold diluted Escherichia coli template DNA positive control group), Deco-Eco-1:10 (treated with PCR decontamination reagent and added with 10-fold diluted Escherichia coli template DNA positive control group), Deco-Eco-1:100 (treated with PCR decontamination reagent and added with 100-fold diluted Escherichia coli template DNA positive control group), Eco-1:1 (not treated with PCR decontamination reagent and added with 1-fold diluted Escherichia coli template DNA positive control group), Eco-1:10 (not treated with PCR decontamination reagent and added with 10-fold diluted Escherichia coli template DNA positive control group), Eco-1:100 (not treated with PCR decontamination reagent and added with 100-fold diluted Escherichia coli template DNA positive control group). The results are shown in Figure 6 .

[0090] like Figure 6 As shown, the relative fluorescence of the amplification curves of E. coli DNA at different dilutions after being treated with the PCR decontamination reagent is good, indicating that the PCR decontamination reagent will not affect the sensitivity of the PCR reaction.

[0091] Example 3

[0092] This example provides a method for preparing a positive quality control product, an exogenous internal standard, and a detection primer and probe thereof in the kit for detecting intraocular bacterial infection described in the present application. The specific method is as follows:

[0093] 1. The positive quality control is Escherichia coli ATCC8739

[0094] Escherichia coli ATCC8739 was activated and cultured, and DNA was extracted according to the kit instructions after centrifugation as a positive quality control.

[0095] 2. Construction of exogenous internal standards

[0096] The β-actin gene sequence is 5'-CTTCGCGGGCGACGATGCTCCCCGGGCTGTATTCCCCTCCAT CGTGGGCCGCCCTAGGCACCAGGTAAGTGACCTGTTACTTTGGGAGTGGCAAGCCTGGGGT TTTCTTGGGGATCGATGCCGGTGCTAAGAAGGCTGTTCCCTTCCACAGGGTGTGATGGTGGGAATGGGTCAGAAGGACTCCTATGTGGGTGACGAGGCCCAGAGCAAGAGAGGTATC-3'. The preparation of the pseudovirus was entrusted to Sangon Biotech (Shanghai) Co., Ltd. for packaging and quality inspection.

[0097] 3. Design of exogenous internal standard primer pairs and probes

[0098] The oligo software was used to design primers and probes for the β-actin gene sequence. The primer sequences are shown in SEQ ID NO.4-5, and the probe sequence is shown in SEQ ID NO.6. The above primers and probes were commissioned to Sangon Biotechnology (Shanghai) Co., Ltd. for synthesis.

[0099] Example 4

[0100] This Example 4 provides a kit for detecting intraocular bacterial infection, which includes the following components: a primer set for detecting intraocular bacterial infection, a PCR reaction premix, a negative quality control product, a positive quality control product, a nucleic acid release agent, a PCR decontamination reagent, an exogenous internal standard, and a grinding tube containing grinding beads;

[0101] The primer set for detecting intraocular bacterial infection comprises the detection primer pair and detection probe obtained in Example 1, and the exogenous internal standard primer and exogenous internal standard probe obtained in Example 3;

[0102] The PCR reaction premix can be any qPCR reaction premix obtained from commercial sources, and the reaction system can be prepared according to the corresponding instructions;

[0103] The negative quality control product is sterile ultrapure water, and the positive quality control product is the pseudovirus particles containing the amplified sequence of Pseudomonas aeruginosa 16S rRNA obtained in Example 3;

[0104] The nucleic acid release agent comprises the following components: 0.01-10 v / v% Tween-20, 0.01-10 v / v% TritonX-100 and 0.01-5 wt% NaOH. The nucleic acid release agent containing the above components can be obtained from commercial sources (such as the nucleic acid release agent 2 used in Example 2);

[0105] The PCR decontamination reagents are dsDNase and DTT;

[0106] The exogenous internal standard is the pseudovirion containing the mouse internal reference gene β-actin sequence obtained in Example 3;

[0107] The grinding tubes filled with grinding beads are commercially available.

[0108] Example 5

[0109] This embodiment provides a method for detecting intraocular bacterial infection for the purpose of non-disease diagnosis and treatment, comprising the following steps:

[0110] A1. Add 1 μL of exogenous internal standard and nucleic acid release agent to the sample to be tested in a volume ratio of 9:1 into a grinding tube containing grinding beads, grind the sample to be tested using a tissue grinder, centrifuge at 12000 rpm for 10 seconds, and retain the supernatant, which is the template DNA;

[0111] A2. Mix the PCR reaction premix and the primer set for detecting intraocular bacterial infection according to Table 4 to obtain a mixed solution;

[0112] A3, the mixed solution obtained in step A2 was mixed with a PCR decontamination reagent, incubated at 37°C for 30 min, then heated to 60°C for 20 min, the template DNA obtained in step A1 was added, mixed evenly, and fluorescent quantitative PCR reaction was performed according to the reaction conditions in Table 3; the volume ratio of the PCR decontamination reagent to the PCR reaction system was PCR decontamination reagent: PCR reaction system = 1:20;

[0113] A4. Determine whether the sample to be tested has bacterial infection according to the Ct value detected in step A3; if the Ct value is ≤35, it is determined to be bacterial infection; if the Ct value is in the range of 35-38, repeat the test. If the Ct value is still in the range of 35-38, it is determined to be bacterial infection; if the Ct value is greater than 38, it is determined to be non-infected.

[0114] Table 4 Response system for detecting intraocular bacterial infection

[0115] Reagents Dosage PCR master mix 10μL DNA template of the sample to be tested or the positive control or negative control 5μL 10 μM Primer-F 0.3μL 10 μM Primer-R 0.3μL 10 μM probe 0.1μL 10 μM exogenous internal standard primer-F 0.3μL 10 μM exogenous internal standard primer-R 0.1μL 10 μM exogenous internal standard probe 0.1μL <![CDATA[ddH2O]]> Make up to a total volume of 20 μL

[0116] Example 6

[0117] In order to evaluate the sensitivity and specificity of the method for detecting intraocular bacterial infection in Example 5, the sensitivity and specificity of the detection method in Example 5 were tested. The specific scheme is as follows:

[0118] 1. Sensitivity

[0119] The positive control product obtained in Example 3 was used as the standard product, and the standard product was increased from 3.4×107 CFU / mL was diluted to 3.4 CFU / mL, and qPCR amplification reaction was performed according to the method of Experimental Example 5. The results are shown in Figure 7 .

[0120] like Figure 7 As shown, the minimum detection limit of the detection method of the present application can reach 34 CFU / mL.

[0121] Specificity

[0122] Clinically isolated intraocular pathogen samples were tested, including pathogenic bacteria: Staphylococcus epidermidis (Sep), Pseudomonas aeruginosa (Pae), Staphylococcus aureus (Sau), Bacillus cereus (Bce), Klebsiella pneumoniae (Kpn), Streptococcus pneumoniae (Spn), Stenotrophomonas maltophilia (Smal), Micrococcus luteus (Mlu), Serratia marcescens (Smar), Enterococcus faecalis (Efa), Escherichia coli (Escherichia) and Enterococcus faecalis (Efa). coli, Eco); other pathogenic microorganisms include: Candida albicans, Fusarium, Aspergillus flavus, Aspergillus fumigatus, Chlamydia trachomatis, hepatitis B virus, hepatitis C virus, Acanthamoeba, herpes simplex virus type I, varicella-zoster virus, Epstein-Barr virus, cytomegalovirus, Escherichia coli ATCC8739 as a positive control (PC), and normal saline as a negative control (NC). The above samples and positive samples were tested according to the method of Example 5, and the results are shown in FIG. Figure 8 and Fig. 9 .

[0123] like Figure 8-9 As shown, common eye pathogens isolated from clinical sites can be detected, while other pathogenic microorganisms cannot be detected, indicating that the detection method of the present application has good specificity and other pathogenic microorganisms will not cause false positive results in the detection method of the present application.

[0124] Example 7

[0125] This experimental example provides a method for detecting intraocular bacterial infection in clinical application, the specific scheme is as follows:

[0126] A sample of aqueous humor and vitreous humor from a patient diagnosed with intraocular bacterial infection was collected in a hospital, and qPCR was performed to detect whether the sample contained bacteria according to the method of Experimental Example 5. The test results are shown in Fig.10 .

[0127] like Fig.10 As shown, the Ct value of the aqueous humor sample detected by the detection method of the present application is 28.76, which is judged to be positive, that is, there is bacterial infection; the Ct value of the vitreous humor sample is 0, which is judged to be negative, that is, there is no bacterial infection, indicating that the detection method of the present application can quickly and accurately determine whether the patient has a bacterial infection and the site of infection.

[0128] Finally, it should be noted that the above embodiments are only used to illustrate the technical solution of the present application rather than to limit the scope of protection of the present application. Although the present application has been described in detail with reference to the preferred embodiments, ordinary technicians in this field should understand that the technical solution of the present application can be modified or replaced by equivalents without departing from the essence and scope of the technical solution of the present application.

Claims

1. A primer set for detecting intraocular bacterial infection, characterized in that: It includes a detection primer pair, a detection probe, an exogenous internal standard primer pair and an exogenous internal standard probe; The primer pair sequences are shown in SEQ ID NO.1 and SEQ ID NO.2; The detection probe sequence is shown in SEQ ID NO.3; The sequences of the exogenous internal standard primer pair are shown in SEQ ID NO.4 and SEQ ID NO.5; The exogenous internal standard probe sequence is shown as SEQ ID NO.

6.

2. Use of the primer set according to claim 1 in at least one of the following (a) to (b): (a) Use in the preparation of a kit for detecting intraocular bacterial infection; (b) Use in a test kit for detecting the presence of bacteria in sterile liquids or sterile articles.

3. A kit for detecting intraocular bacterial infection, characterized in that: The kit comprises the primer set for detecting intraocular bacterial infection as described in claim 1, a PCR reaction premix, a negative quality control product, a positive quality control product, a nucleic acid releaser, a PCR decontamination reagent and an exogenous internal standard; the kit also comprises a grinding tube containing grinding beads.

4. The kit according to claim 3, characterized in that Including at least one of the following (I) to (IV): (I) The negative quality control product is sterile ultrapure water; the positive quality control product is a water with a concentration of 1×10 7 ~1×10 8 CFU / ml inactivated Escherichia coli; (II) the nucleic acid release agent comprises the following components: 0.01-10 v / v% Tween-20, 0.01-10 v / v% TritonX-100 and 0.01-5 wt% NaOH; (III) the PCR decontamination reagent comprises a double-stranded specific DNA enzyme and dithiothreitol; (IV) The exogenous internal standard is a pseudovirus particle containing the mouse internal reference gene β-actin sequence.

Images