Application of epigallocatechin gallate in the fight against largemouth bass rhabdovirus

Abstract

The invention discloses the application of epigallocatechin gallate in resisting largemouth bass rhabdovirus. Epigallocatechin gallate exerts antiviral activity in the largemouth bass rhabdovirus adsorption stage and direct killing effect. Epigallocatechin gallate can significantly improve the survival rate of largemouth bass fry infected by largemouth bass rhabdovirus and has preventive and therapeutic effects on the infected virus. Therefore, epigallocatechin gallate has good development and application prospects in the preparation of drugs for resisting largemouth bass rhabdovirus infection.

Description

Technical Field

[0001] The invention belongs to the technical field of aquaculture, and relates to the application of epigallocatechin gallate in products for inhibiting / resisting largemouth bass rhabdovirus; in particular, it relates to the application of epigallocatechin gallate in the preparation of medicines or feed additives for preventing or treating largemouth bass rhabdovirus disease. Background Art

[0002] Largemouth bass rhabdovirus disease is caused by Micropterus salmoides rhabdovirus (MSRV), a viral disease that seriously endangers the healthy breeding of bass. MSRV belongs to the Rhabdoviridae family and is a single-stranded negative-sense RNA virus with a rod-shaped or bullet-shaped virus particle. MSRV mainly infects largemouth bass in the early growth and development stage. The virus is highly contagious and has a high mortality rate. Its infection rate is as high as 80%, and the mortality rate within a short period of time after infection exceeds 90%, resulting in a low survival rate of fry, causing huge economic losses to my country's largemouth bass breeding industry.

[0003] At present, the prevention and control of largemouth bass rhabdovirus disease is still in its infancy, and prevention is still the main measure. However, due to the rapid onset of MSRV, high mortality, and incubation period, there is no effective drug treatment and prevention once an outbreak occurs. Therefore, the exploration and discovery of anti-MSRV drugs is of great significance for the prevention and treatment of MSRV.

[0004] Epigallocatechin-3-gallate (EGCG) is a phenolic active substance extracted from green tea. Its structural formula is as follows:

[0005]

[0006] Epigallocatechin gallate (EGCG) is a catechin monomer extracted from green tea. It is a white powder or crystal at room temperature. It is unstable and easily oxidized to a light pink color. It has no special smell and is soluble in polar solvents such as water and methanol. Studies have found that EGCG has multiple biological activities such as antioxidant, antibacterial, antiviral, antiparasitic, and immune-enhancing. It has a strong antiviral effect on a variety of viruses including human defect virus, influenza virus, and hepatitis C virus. Studies have shown that EGCG can produce antiviral activity against different viruses through various pathways. However, there is no relevant report on the anti-MSRV effect of epigallocatechin gallate. Summary of the invention

[0007] Through creative labor and unremitting efforts, the inventors discovered and proved that epigallocatechin gallate (EGCG) has an anti-largemouth bass rhabdovirus effect; EGCG can significantly inhibit the proliferation of MSRV.

[0008] Based on this, the object of the present invention is to provide the use of epigallocatechin gallate in the preparation of a product for inhibiting / resisting largemouth bass rhabdovirus.

[0009] Furthermore, the inhibitory effect occurs at an early stage of largemouth bass rhabdovirus infection.

[0010] Furthermore, the products include inhibitors, medicines, feeds, and feed additives.

[0011] The present invention also aims to provide a product for preventing and treating largemouth bass rhabdovirus disease, wherein the active ingredient of the product comprises epigallocatechin gallate.

[0012] Preferably, the final concentration of epigallocatechin gallate in the product is 1-100 μM.

[0013] Preferably, the final concentration of epigallocatechin gallate in the product is 40 μM.

[0014] Furthermore, the product includes medicine, feed or feed additive.

[0015] The present invention also aims to provide the use of epigallocatechin gallate in the preparation of medicines for preventing or treating largemouth bass rhabdovirus disease and feed additives.

[0016] Furthermore, the largemouth bass rhabdovirus disease is caused by largemouth bass rhabdovirus.

[0017] In order to achieve the above object, the present invention adopts the following technical solutions:

[0018] The present invention preliminarily finds that EGCG can significantly inhibit the proliferation of MSRV by incubating EPC cells with EGCG for MSRV infection experiments. First, cells are incubated with EGCG at different concentrations to determine the safe use dose of EGCG. The antiviral activity of EGCG on MSRV is analyzed by EGCG pretreatment, co-treatment, post-treatment and direct killing methods, and the stage of MSRV replication is further determined according to the virus infection experiment, and multiple methods such as qRT-PCR, Western-Blot, and cell supernatant virus plaque test are used for research. Finally, the antiviral activity of EGCG is verified by conducting an MSRV challenge experiment on juvenile largemouth bass. The test results show that for EPC cells, the safe use dose of EGCG is 1-100 μM; at the EPC cell level, EGCG significantly inhibits the replication of MSRV in a dose-dependent manner, and EGCG has a more significant antiviral effect on MSRV virus in co-treatment, post-treatment and direct killing; secondly, it is clear that EGCG exerts antiviral activity by affecting the adsorption of the virus; finally, EGCG can significantly improve the survival rate of largemouth bass after MSRV infection.

[0019] The benefit of the present application lies in that: the present invention discovers and proves for the first time that epigallocatechin gallate (EGCG) has anti-largemouth bass rhabdovirus activity. Cell experiments show that epigallocatechin gallate exerts an antiviral effect by inhibiting the adsorption of largemouth bass rhabdovirus. Fish protection experiments confirm that epigallocatechin gallate significantly increases the survival rate of largemouth bass infected with largemouth bass rhabdovirus, and has a significant antiviral protective effect; therefore, the epigallocatechin gallate of the present invention has broad application prospects in the preparation of anti-largemouth bass rhabdovirus drugs and feed or feed additives. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 This is the result diagram of the effect of different concentrations of EGCG on the activity of EPC cells;

[0021] Figure 2 The results of the effects of different concentrations of EGCG on the proliferation of MSRV are shown in Figure 1; A is the observation of the pathological changes of EPC cells after MSRV infection under a microscope; B is the result of RT-qPCR detection of the relative expression of MSRV G protein mRNA; C is the result of Western blot detection of the expression of MSRV G protein;

[0022] Figure 3 After adding EGCG at different time points, the pathological changes of EPC cells after MSRV infection were observed under a microscope;

[0023] Figure 4The relative expression of MSRV G protein mRNA was detected by RT-qPCR after adding EGCG at different time points;

[0024] Figure 5 Results of Western blot detection of MSRV G protein expression after adding EGCG at different time points;

[0025] Figure 6 The results of the Plaque assay for progeny virus titer after adding EGCG at different time points, where A is the plaque diagram of progeny virus titer; B is the statistical analysis result of A;

[0026] Figure 7 The results of detecting whether EGCG has an effect on the adhesion stage of MSRV; A is the observation of EPC cell pathological changes after MSRV infection under a microscope; B is the result of RT-qPCR detection of MSRV G protein mRNA relative expression; C is the result of Western blot detection of MSRV G protein expression; D is the empty plaque diagram of Plaque assay detection of progeny virus titer; E is the statistical analysis result of D;

[0027] Figure 8 The results of detecting whether EGCG has an effect on the internalization stage of MSRV; A is the observation of EPC cell pathological changes after MSRV infection under a microscope; B is the result of RT-qPCR detection of MSRV G protein mRNA relative expression; C is the result of Western blot detection of MSRV G protein expression; D is the empty plaque diagram of Plaque assay detection of progeny virus titer; E is the statistical analysis result of D;

[0028] Fig. 9 This is the result of the plaque reduction experiment to explore whether EGCG has a direct killing effect on MSRV;

[0029] Fig.10 This is a result diagram of the antiviral effect of EGCG on MSRV detected by the virus challenge experiment; DETAILED DESCRIPTION

[0030] The technical solutions in the embodiments of the present invention will be described clearly and completely below in conjunction with the drawings in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, rather than all the embodiments.

[0031] Unless otherwise defined, all professional terms used hereinafter have the same meanings as those generally understood by those skilled in the art. The professional terms used herein are only for the purpose of describing specific embodiments and are not intended to limit the scope of protection of the present invention; unless otherwise specifically stated, various raw materials, reagents, instruments and equipment used in the present invention can be purchased from the market or prepared by existing methods.

[0032] The invention aims at the existing problems and provides application of epigallocatechin gallate in resisting rhabdovirus disease of largemouth bass.

[0033] The sources of the biological materials used in the examples of the present invention are as follows:

[0034] EPC cells were donated by Professor Sheng Xiuzhen of the College of Fisheries of Ocean University of China; MSRV virus was isolated and preserved by the inventor; EGCG was purchased from Shanghai Yuanye Biotechnology Co., Ltd.; MSRV G protein monoclonal antibody was prepared by our laboratory; goat anti-mouse IgG, goat anti-rabbit IgG, and fluorescent quantitative reagent 2×Universal SYBR Green Fast qPCR Mix were all purchased from Wuhan Aibotek Biotechnology Co., Ltd.; MSRV-N primers were synthesized by Zhengzhou Qingke Biological Co., Ltd.; M199 culture medium was purchased from Beijing Lanjieke Technology Co., Ltd.; fetal bovine serum (FBS) was purchased from Beijing Jackson Biological Co., Ltd.; 12-well plates, 24-well plates, bovine serum albumin (BSA), acrylamide / methylenebisacrylamide 30% solution (29:1), 10% SDS solution, ECL chemiluminescent substrate kit (ultra-sensitive) and CCK8 kit were purchased from Biosharp; PVDF membrane was purchased from Millipore (Shanghai) Trading Co., Ltd.

[0035] The present invention found that EGCG can inhibit the proliferation of MSRV during antiviral drug screening. First, EPC cells were incubated with EGCG at different concentrations to determine the safe dosage of EGCG. The anti-MSRV activity of EGCG was further determined by performing a virus infection experiment on EPC cells, and it was clarified at which stage EGCG inhibited the proliferation of MSRV. And through an in vivo MSRV challenge experiment on young largemouth black bass, the antiviral effect of EGCG on MSRV in vitro was determined. The test results showed that for EPC cells, the safe dosage of EGCG was 1-100 μM; EGCG significantly inhibited the proliferation of MSRV in a dose-dependent manner, and 40 μM EGCG could completely inhibit viral proliferation; EGCG exerted antiviral activity in the adsorption stage and direct killing effect; finally, EGCG could significantly improve the survival rate of largemouth black bass in vivo. The specific implementation methods are as follows:

[0036] Example 1

[0037] Effects of EGCG on cell activity

[0038] EPC cells in good growth condition were plated in a 96-well cell plate and cultured in a 37°C, 5% CO2 incubator. After the cell confluence reached 90%, EGCG dissolved in M199 was prepared with 10% FBS M199 to prepare EGCG dilutions of different concentrations (0, 1, 2, 4, 8, 10, 20, 40, 60, 80, 100 μM) and added to the wells for continued culture. Six replicates were set for each concentration gradient, and a group of cells without cells and only containing 10% FBS M199 culture medium was set up as a blank control. After 36 hours of drug treatment, 10 μL of CCK8 reagent was added to each well and incubated at 37°C for 1-4 hours. After 2 and 4 hours, the OD450 absorbance was detected with an enzyme reader, and the cell survival rate was calculated. The results are shown in Figure 1 shown.

[0039] Depend on Figure 1 It can be seen that EGCG has no cytotoxicity to EPC cells at concentrations of 0-100 μM.

[0040] Example 2

[0041] Effects of adding different concentrations of EGCG on the proliferation of MSRV

[0042] (1) EGCG was diluted with M199 to different concentrations (0, 1, 2, 4, 8, 10, 20, 40 μM) (the dilution method was the same as in Example 1), and then the diluted EGCG and MSRV with a concentration of 0.05 MOI were thoroughly mixed to a total volume of 1 mL and incubated at 28° C. for 2 h.

[0043] (2) When the EPC cells reach 90%, add the diluted EGCG and MSRV side walls to the corresponding cell wells, incubate at 28°C for 2 hours, then discard the virus solution, add M199 to the side walls and wash twice to remove the residual MSRV and EGCG from the pretreatment, and add 2% FBS M199 containing the corresponding concentration of EGCG. After 24 hours of infection, observe the cell lesions under a microscope and collect the cells and supernatant for Western blot, RT-qPCR and virus plaque assay to detect the effect of EGCG on the virus. The experimental results are shown in the figure. Figure 2 shown.

[0044] Among them, the specific steps of virus plaque assay, Western blot and RT-qPCR are as follows:

[0045] Virus plaque assay: EPC cells with good growth status were plated in 24-well plates and cultured at 37°C 5% CO2 for 24 hours until the cell confluence reached 80%. The collected cell culture supernatant was diluted 10-fold from 10 -1 to 10 -5 , take 10-3 Up to 10 -5 Three replicate wells were made for each of the three dilutions, and the cells were added and cultured at 37°C with 5% CO2 for 2 h. Then, the medium was replaced with 2% FBS CMC M199 medium and cultured for 24 h-48 h. The cytopathic effect was observed under a microscope. When a moderate number of obvious plaques were formed, 2% FBS CMC M199 medium (0.5 mL / well) was added. After culture at 37°C for 24 h, 10% formaldehyde 1 mL / well was added for fixation for 4 h, the formaldehyde was discarded, and crystal violet 1 mL / well was added for staining overnight. The stain was slowly rinsed with distilled water, and the virus titer was calculated.

[0046] Western blot: (1) Sample processing: Place the cell sample collected with PBS in a high-speed centrifuge, centrifuge at 3000g for 7 minutes, discard the supernatant, resuspend the precipitate with PBS, add 5× Loading Buffer, and cook the sample at 100℃ for 15 minutes; (2) SDS-PAGE: Install the protein gel plate, add 9μL of the treated sample to each well, run electrophoresis at 90V constant voltage, and switch to 120V constant voltage for 1.5 hours after the protein sample runs to the separation gel; (3) Transfer: Install according to filter paper-protein gel-PVDF membrane-filter paper, transfer at 100V for 50 minutes; (4) Blocking: After the transfer is completed, place the membrane in 5% skimmed milk powder prepared in advance and block it on a shaker at room temperature for 2 hours; (5) Incubate with primary antibody: MSRV monoclonal antibody diluted 1:5000, Actin Diluted at 1:5000, incubated at room temperature on a shaker for 2 h; (6) Incubated with secondary antibody: goat anti-mouse secondary antibody diluted at 1:5000, goat anti-rabbit secondary antibody diluted at 1:5000, incubated at room temperature for 1 h; (7) Color development: ECL luminescence color development.

[0047] RT-qPCR: (1) Extraction of total RNA from cells: Add 1 mL of Trizol to the cells to be collected, repeatedly pipette until the liquid is completely transparent, and place at room temperature for 5 min. Add chloroform at a rate of 200 μl chloroform / mL Trizol, shake vigorously for 15 s, and place at room temperature for 5 min. Centrifuge at 4°C, 12,000 rpm, for 15 min. Transfer the upper aqueous phase to another RNase-free EP tube, add an equal volume of isopropanol and mix well (about 500 μL), and place at room temperature for 10 min. Centrifuge at 4°C, 12,000 rpm, for 10 min, carefully aspirate the liquid with a pipette tip, and the RNA will settle at the bottom of the tube. Wash the RNA precipitate with 1 mL of 75% ethanol, and slowly shake the centrifuge tube to suspend the precipitate. Centrifuge at 4°C, 8,000 rpm, for 5 min. After discarding the ethanol, dry the RNA precipitate at room temperature for 5 min. Dissolve the RNA sample with 20 μL of H2O, place on ice to dissolve for 20 min, and use a visible spectrophotometer to measure the concentration of the extracted total RNA. (2) Reverse transcription to cDNA: Use reverse transcription reagent to reverse transcribe RNA into cDNA. Reaction system: 1 ng total RNA, 4 μL 5×ABS ScriptⅢRT Mix, 1 μL 20×gDNARemoverMix, add DEPC water to 20 μL, reverse transcription conditions: 37℃2min, 55℃15min, 85℃5min; (3) Real-time fluorescence quantitative RT-PCR detection (RT-qPCR): Add 180 μL ddH2O to 20 μL cDNA, flick to mix thoroughly, and place on ice for later use; RT-qPCR reaction system: 10 μL 2×Universal SYBR Green Fast qPCR Mix, 0.4 μL each of upstream and downstream primers, 2 μL cDNA, ddH2O 7.8 μL, MSRV-N upstream primer: TTCGCTATGGAAGAAGGGCAG, downstream primer: TGCTGTACTGCCTCCATGACG, internal reference gene 40S upstream primer: CCGTGGGTGACATCGTTACA, internal reference gene 40S downstream primer: TCAGGACGTTGAACCTCACTGTCT; reaction conditions: 95°C 3 min for denaturation; 95°C 5 sec, 60°C 30 sec, 40 cycles of reaction.

[0048] Depend on Figure 2 It can be seen that EGCG reduces the expression of MSRV G protein, progeny virus titer and virus copy number in a dose-dependent manner; among them, 40μM EGCG has the most significant anti-MSRV effect.

[0049] Example 3

[0050] Effects of adding EGCG at different time points on the proliferation of MSRV

[0051] In order to clarify the stage of action of EGCG in inhibiting the proliferation of MSRV and to more significantly observe the phenomenon of EGCG inhibiting the proliferation of MSRV, subsequent experiments were conducted using 40 μM EGCG.

[0052] EPC cells in good growth state were propagated to 12-well plates and cultured at 37℃5%CO2 for 24h until the cell confluence reached 80%; the cells were infected with M199 containing 0.05MOI MSRV, and the old culture medium was discarded 2h later and washed twice with serum-free M199. At 0h / 2h / 4h / 8h after infection, 2% FBS M199 containing 0μM and 40μM EGCG was added and cultured continuously. After 12h of infection, the cell lesions were observed under a microscope and photographed ( Figure 3 As shown), cells were collected and Western blot was performed (results are shown in Figure 4 ), RT-qPCR (results see Figure 5 ) and virus plaque assay (results see Figure 6 ). The specific operation steps of Western blot, RT-qPCR and virus plaque assay refer to Example 2.

[0053] Depend on Figure 3-6 It can be seen that the addition of EGCG at 0h significantly inhibited the protein expression, gene transcription and progeny virus titer of MSRV, while the addition of EGCG at 2h, 4h and 8h had no significant effect on the proliferation of MSRV, indicating that EGCG acts in the early stage of MSRV infection.

[0054] Example 4

[0055] Detection of the effects of EGCG on the adsorption and internalization stages of MSRV

[0056] (1) Effect of EGCG on the adsorption stage of MSRV

[0057] The EPC cells with good growth status were transferred to a 12-well plate and cultured at 37℃5% CO2 for 24h until the cell confluence reached 80%; pre-cooled at 4℃ for 1h, EGCG was diluted to 0μM and 40μM with M199, then mixed evenly with 0.02MOI of MSRV and infected with cells, and cultured at 4℃. After 2h, the old culture medium was discarded and washed twice with cold M199. Cells from several wells were immediately collected for RT-qPCR, and 2% FBS M199 was added to the cells in the remaining wells. After continuing to culture at 28℃ for 12h, the cell pathological changes were observed under a microscope and photographed, and the cells and cell supernatants were collected for Western blot, RT-qPCR, and virus plaque test (refer to Example 2 for specific methods). The experimental results are as follows Figure 7 shown.

[0058] (2) Effect of EGCG on the internalization stage of MSRV

[0059] The EPC cells with good growth status were transferred to a 12-well plate and cultured at 37°C and 5% CO2 for 24 hours until the cell confluence reached 80%; pre-cooled at 4°C for 1 hour, the cells were infected with M199 containing 0.05MOI MSRV, cultured at 4°C for 2 hours, and the old culture medium was discarded. The cells were washed twice with cold M199, and then EGCG was diluted to 0°C and 40°C with 2% FBS M199 and added to the wells. After culturing at 28°C for 2 hours, the cells were quickly washed twice with a pH=3 PBS solution, and washed once with M199 at room temperature. Cells from several wells were immediately collected for RT-qPCR, and the cells in the remaining wells were added with 2% FBS M199. After continuing to culture at 28°C for 12 hours, the cell pathological changes were observed under a microscope and photographed. The cells and cell supernatants were collected for Western blot, RT-qPCR, and virus plaque assays (refer to Example 2 for specific methods). The experimental results are as follows Figure 8 shown.

[0060] The effects of EGCG on the adsorption and internalization stages of MSRV were analyzed from the perspectives of EGCG on the expression of MSRV protein, progeny virus titer, and virus copy number. Figure 7-8 The results showed that EGCG significantly inhibited the adsorption stage of MSRV, but had no significant effect on the internalization stage of MSRV.

[0061] Example 5

[0062] EGCG directly reduces the infectious activity of MSRV

[0063] EPCs with good growth status were plated on 24-well cell plates and cultured at 28℃5%CO2 until the cell confluence reached 100%. EGCG was diluted to 0μM and 40μM with M199, mixed evenly with 0.02MOI of MSRV and incubated at room temperature for 2h, 4h and 6h, then the mixture was diluted to 500PFU / well, 100PFU / well, and 50PFU / well to infect cells, infected at 28℃5%CO2 for 2h, the virus solution was discarded, and 500μL of semi-solid culture medium containing methylcellulose was added. Cultured at 28℃5%CO2 for 24-48h. After the formation of visible plaques, it was fixed with 10% formaldehyde for 12h, rinsed with tap water, stained with 1mL 0.5% crystal violet staining solution for 4h, rinsed with tap water and dried, the number of virus plaques was counted, and the plaque inhibition rate was calculated. Calculation formula:

[0064]

[0065] The experimental results are as follows Fig. 9 As shown, EGCG can directly kill MSRV and reduce the infectious activity of MSRV.

[0066] Example 6

[0067] Detection of the anti-MSRV effect of EGCG by in vivo challenge experiment

[0068] The healthy largemouth bass juveniles were randomly divided into four groups of 20 fish each, namely the negative control group, EGCG treatment group, positive control group and experimental group. The negative control group was intraperitoneally injected with 20 μL of M199 medium, the EGCG treatment group was intraperitoneally injected with 20 μL of M199 medium with a final concentration of 1 mM EGCG, and each fish in the positive control group was intraperitoneally injected with 20 μL of 10 3 Each tail of the experimental group was intraperitoneally injected with 20 μL of M199 medium containing 10 PFU MSRV. 3 PFU MSRV and M199 medium with a final concentration of 1 mM ECG. After the challenge, the mortality of the experimental fish was recorded every day for 14 days. The results were recorded as follows Fig.10 shown.

[0069] Depend on Fig.10 It can be seen that EGCG reduced the mortality rate of MSRV, with a relative protection rate of 21%.

[0070] It will be apparent to those skilled in the art that the invention is not limited to the details of the exemplary embodiments described above and that the invention can be implemented in other specific forms without departing from the spirit or essential features of the invention. Therefore, the embodiments should be considered exemplary and non-limiting in all respects, and the scope of the invention is defined by the appended claims rather than the foregoing description, and it is intended that all variations falling within the meaning and scope of the equivalent elements of the claims be included in the invention. Any reference numeral in a claim should not be considered as limiting the claim to which it relates.

Claims

1. Application of epigallocatechin gallate in the preparation of products for inhibiting / resisting largemouth bass rhabdovirus, the products comprising medicines, feeds, and feed additives.

2. The use according to claim 1, characterized in that The inhibitory effect occurs at an early stage of Rhabdovirus infection in largemouth bass.

3. Application of epigallocatechin gallate in the preparation of drugs for preventing or treating largemouth bass rhabdovirus disease.

4. Application of epigallocatechin gallate in the preparation of feed additives for preventing or treating rhabdovirus disease in largemouth bass.

5. The use according to claim 3 or 4, characterized in that: The largemouth bass rhabdovirus disease is caused by largemouth bass rhabdovirus.

Images