Acremonium leucophyllae and its application

Abstract

The invention discloses a strain of Acremonium leucosporum ( Yellow-white acrostalagmus ), and its deposit number is: CCTCC NO: M 2024179. Acremonium leucophyllum was isolated from the corm of the banana wilt-immune variety Pahang introduced from abroad at the banana introduction test base in Manjinlong Village, Gasa Town, Jinghong City, Yunnan Province. The strain has the function of antagonizing banana wilt. It was identified as Acremonium leucophyllum by morphological and molecular methods, belonging to the Conchomycetes, Cupiomycetes, and is a brick-red verticillium-like fungus that produces a large number of spores. Through the biological characteristics of the strain and the endophytic colonization characteristics in banana plants, it has a biological control effect on banana wilt, providing a new strain source for the prevention and control of banana wilt, and has high research value.

Description

Technical Field

[0001] The invention relates to the field of biotechnology, in particular to a strain of Acremonium leucosporium and application thereof. Background Art

[0002] The pathogen of banana wilt was first isolated and identified by Smith in 1910 from Cuban banana tissue. Fusarium cubense In 1913, Ashby first F.cubense Described in detail, and subsequently confirmed for the first time by Brande in 1919 F.cubense In 1940, Snyder & Hansen named the pathogen causing banana wilt as Fusarium oxysporum Cuban special type [ Fusariumoxysporum f.sp.cubense (EF Smith) Snyder et Hasen, Foc]. The pathogen belongs to the subdivision Deuteromycotina, class Hyphomycetes, order Tuberculariales, family Tuberculariaceae, genus Fusarium. Fusarium Link), Beauty Group ( Elegans Wu.), Oxysporium Oxysporum Sch1.).

[0003] There are four physiological subspecies of Foc: Physiological subspecies 1 (R1) is distributed worldwide and once caused the extinction of the cultivated banana variety "Big Miha"; Physiological subspecies 2 (R2) is distributed in Central America and only infects hybrid triploid "Bluggoe" (ABB) and other cooking varieties; Physiological subspecies 3 (R3) only infects the ornamental plant Musa genus ( Heliconia spp.), currently, the pathogens that infect the genus Fusarium no longer belong to Foc (Ploetz, 2019); Physiological race 4 (R4) can infect all banana varieties and is the most serious. Mua According to the pathogenicity of AAA, R4 is divided into tropical race 4 (TR4) and subtropical race 4 (STR4). STR4 often occurs in subtropical areas, while TR4 can occur in both tropical and subtropical areas and is more toxic.

[0004] At present, the main control methods for TR4 include: application of chemical pesticides, crop rotation, breeding of disease-resistant varieties and biological control, etc. Among them, biological control is safe and ecologically sustainable, and is a research hotspot for the control of banana wilt disease. Summary of the invention

[0005] In view of the above technical problems, the present invention provides a strain of Acremonium leucophyllum, which can be used to prevent and treat banana wilt disease.

[0006] In order to achieve the above-mentioned object, the present invention provides a first aspect of a white yellow bamboo shoot Acremonium ( Acrostalagmus luteo-albus ), its deposit number is: CCTCC NO: M 2024179.

[0007] The second aspect of the present invention provides a bacterial agent, the active ingredient of the bacterial agent is the above-mentioned Acremonium leucophyllum.

[0008] The second aspect of the present invention provides the use of the above-mentioned Acremonium leucophyllum or bacterial agent in the prevention and treatment of banana wilt disease.

[0009] In summary, the present invention has the following beneficial effects:

[0010] 1. The Acremonium luteum of the present invention is isolated from the bulb of the banana plant and is also an endophytic strain of banana. Compared with engineered bacteria, it can colonize better in the natural environment;

[0011] 2. Using Acremonium oxysporum to control banana wilt disease will not cause pollution to the environment and is more conducive to the sustainable development of the ecological environment than chemical control. BRIEF DESCRIPTION OF THE DRAWINGS

[0012] Figure 1 This is a characteristic diagram of the culture of Acremonium serrata YN12C on a PDA medium in the present invention, wherein the left figure is the front side of the medium and the right figure is the back side of the medium;

[0013] Figure 2 This is a morphological diagram of Acremonium luteum YN12C of the present invention under an optical microscope, wherein the left diagram shows hyphae and spores, the middle diagram shows hyphae and spores, and the right diagram shows spores;

[0014] Figure 3 is a phylogenetic tree of Acremonium luteum YN12C of the present invention;

[0015] Figure 4 This is a plate confrontation experiment diagram of Acremonium luteum YN12C and TRA in the present invention;

[0016] Figure 5 It is a longitudinal section of a banana corm in a cultivation experiment of Acremonium luteum YN12C in the present invention;

[0017] Figure 6 It is a bar graph of the incidence of wilt disease in the cultivation experiment of Acremonium fusiformis YN12C of the present invention;

[0018] Figure 7 It is a histogram of the Fusarium wilt disease epidemic index of the cultivation experiment of Acremonium luteum YN12C in the present invention;

[0019] Biological Deposit

[0020] The present invention provides acrosporium of white yellow bamboo shoots ( Acrostalagmus luteo-albus ), classified and named: Acrostalagmus luteo-albus YN12C, it was deposited in the China Center for Type Culture Collection on January 23, 2024, at 299 Bayi Road, Wuchang District, Wuhan City, Hubei Province, Wuhan University, with the deposit number: CCTCC NO: M2024179. DETAILED DESCRIPTION

[0021] The endpoints and any values ​​of the ranges disclosed in this article are not limited to the precise ranges or values, and these ranges or values ​​should be understood to include values ​​close to these ranges or values. For numerical ranges, the endpoint values ​​of each range, the endpoint values ​​of each range and the individual point values, and the individual point values ​​can be combined with each other to obtain one or more new numerical ranges, which should be considered as specifically disclosed in this article.

[0022] In the present invention, Acremonium leucophyllum YN12C and Acremonium leucophyllum CCTCC NO: M 2024179 are the same strain, have the same meaning, and their names (numbers) can be used interchangeably.

[0023] The inventors of the present invention isolated and obtained a strain of Acremonium leucophyllum during the research process, named: Acremonium leucophyllum YN12C, which was deposited in the China Center for Type Culture Collection on January 23, 2024, at No. 299, Bayi Road, Wuchang District, Wuhan City, Hubei Province, Wuhan University, with a collection number of CCTCC NO: M 2024179.

[0024] Based on this, the first aspect of the present invention provides a strain of Acremonium leucophyllum, whose deposit number is CCTCC NO: M2024179.

[0025] The second aspect of the present invention provides a bacterial agent, the active ingredient of the bacterial agent is Acremonium leucophyllotoxin YN12C.

[0026] Further research found that Acremonium wilt can be used to prevent and control banana wilt.

[0027] Based on this, the second aspect of the present invention provides the use of the above-mentioned Acremonium leucophyllum or fungal agent in the prevention and treatment of banana wilt disease.

[0028] There is no particular restriction on the specific dosage of Acremonium leucophyllum in the present invention, as long as it can prevent and treat banana wilt disease.

[0029] Experiment on endophytic colonization of YN12C: Through potted inoculation experiments, banana corm samples were taken 63 days after inoculation with YN12C, the surface was rinsed with tap water and dried, then soaked in 75% alcohol for 30 seconds on a clean bench, the corms were rinsed with sterile water and dried, the surface layer was removed with a scalpel, and the corms were cut into pieces about 1 cm in length and width and inoculated on PDA medium, and YN12C was isolated again. This proves that YN12C can colonize endophytically in banana plants.

[0030] According to a preferred embodiment of the present invention, when the white yellow shoot top spore or its fungal agent is used to control banana wilt, the amount of white yellow shoot top spore is not less than 1×10 6 cfu / strain.

[0031] In order to make the objectives, technical solutions and beneficial effects of the present invention clearer, the preferred embodiments of the present invention will be described in detail below to facilitate understanding by technicians.

[0032] Example 1 Isolation and identification of strains

[0033] 1. Isolation of strains

[0034] At the banana introduction test base in Manjinlong Village, Gasa Town, Jinghong City, Yunnan Province, a fungus antagonistic to banana Fusarium wilt was isolated from the corm of Pahang, an immune banana Fusarium wilt variety introduced from abroad. It was identified as Acremonium leucophyllum through morphological and molecular methods and named: Acremonium leucophyllum YN12C.

[0035] 2. Identification of strains

[0036] 2.1 Inoculate the strain on PDA medium. Figure 1 As shown, the colony is brick red, the hyphae at the edge of the colony is white, and there are ring patterns of different shades due to the large amount of spore production. As the culture time increases, the color of the colony gradually deepens and darkens, becoming rust red.

[0037] As attached Figure 2 As shown, the spore stalks on the original natural matrix are light reddish brown, the main stalk is dark in color, and the stalklets are slightly lighter in color; the conidia are reddish brown, and the diameter of the top conidia is 14.94-39.84μm; the main stalk is upright, with 3-8 layers of side branches in a whorl, and the side branches can regenerate 1-2 times; each layer of whorls can have 3-6 stalklets or side branches in a whorl; the main stalk is 118.8-396.0μm×2.99-4.98μm; the main stalk has 5-9 septates; the bottle-shaped stalklets are 12.45-26.15μm×1.99-2.99μm; the conidia are colorless, oval to elliptical, and 4.48-7.47μm×2.49-3.74μm in size.

[0038] 2.3 Molecular identification

[0039] Fungal DNA was extracted, and the genomic DNA of the strain was used as a template. The universal primers for fungi ITS1 (5'-TCCGTAGGTGAACCTGCGG-3') and ITS4 (5'-TCCTCCGCTTATTGATATGC-3') were used to amplify the rDNA-ITS sequence of the strain by PCR. The PCR amplification product was detected by 1% agarose gel electrophoresis and sent to Beijing Qingke Biotechnology Co., Ltd. for sequencing. The sequence result is shown in SEQ ID NO.1. The ITS sequence result of the target strain was submitted to the NCBI website (https:llblast.ncbi.nlm.nih.gov / Blast.cgi). After BLAST comparison, the sequences with high homology to the target strain were screened and downloaded. Then, MEGA7.0 software was used to run 1000 bootstrap verifications through the neighbor-joining method (NJ) to construct a phylogenetic tree, as shown in the attached figure. Figure 3 shown.

[0040] ITS sequence results of Acremonium leucoderma YN12C strain:

[0041] CGGAGTCTTACACTCTAACCCTTTGTGAACCATTATACCTAGTTGCTTCGGCGGCGCGCCTCCGGGCGTGCCCGCCGGCCAATTATAGTCTCTTAGTTGTGAATCGACGTTACATCTGAGTGTTCTAAGCGAACTG TTAAAACTTTCAACAACGGATCTCTTGGCTCCAGCATCGATGAAGAACGCAGCGAAACGCGATATGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCTTCCAGTATCCTGGGA GGCATGCCTGTCCGAGCGTCGTTTCAACCCTCGAGCCCCCGTGGCCCGGTGTTGGGGACGCTGCCCAGCTACCTGGGCAGCCCCCCTAAATGCAGTGGCGGTCCCGCAAGTCCCAGCCCTTTGCGTAGTAATATCA TTCTCGCTCTGGACGGCTCGCGGGCTTACCAGCCTCGAAACCCCCTACAAAGACCGCCCCGGCGGCAACGGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAAGCATTCATAAGGGGGGAAGGAAACCCCT

[0042] YN12C strain and reference standard strain Acrostalagmus luteo-albus The similarity to CLE7 was 98.36%. Combined with the morphological characteristics, the YN12C strain was identified as Acremonium leucophyllum Acrostalagmus luteo-albus .

[0043] Embodiment 2

[0044] 1. Flat plate confrontation experiment

[0045] Through the PDA plate confrontation experiment, it was found that Acremonium leucophyllotoxin YN12C had a good inhibitory effect on banana wilt tropical race 4 (TR4). Figure 4 As shown, the inhibition rate was 52.28%.

[0046] Inhibition rate (%) = (control colony diameter - treated colony diameter) / (control colony diameter - bacterial cake diameter) × 100%.

[0047] 3. Potted plant verification experiment

[0048] The banana pot experiment was carried out in the solar greenhouse of the Songming Experimental Base of the Institute of Agricultural Environment and Resources, Yunnan Academy of Agricultural Sciences.

[0049] After taking out the cultured Brazilian banana seedlings, wash the culture medium at the roots of the tissue culture seedlings and plant them in a 32-hole seedling tray containing a mixture of Brazilian banana and substrate. When the seedlings grow to 3-4 leaves, transplant them into plastic pots for planting (the pots contain a mixture of garden soil and substrate in a ratio of 1:1). When the banana seedlings grow to 5-6 leaves, start the inoculation experiment.

[0050] The inoculation concentration of YN12C was 1×10 6 CFU / mL, 1 ml for each strain; TR4 inoculation concentration was 1×10 8 CFU / mL, 1 ml was inoculated per plant. In order to make the bacterial solution more evenly mixed with the inoculated soil, it was diluted to 200 ml with sterile water before root inoculation.

[0051] In the inoculation experiment, the CK group was a water control; the TR4 group was inoculated with banana wilt pathogen TR4 alone; the TR4+YN12C group was inoculated with YN12C 7 days in advance and then inoculated with banana wilt pathogen TR4.

[0052] After 8 weeks, the banana plants were removed, rinsed and brought back to the laboratory for root dissection. In the laboratory, the roots of the washed banana plants were removed and the pseudostem was cut at about 10 cm from the bulb end. The cut bulbs were then cut longitudinally along the center line and photographed for disease grade evaluation. The bulb incidence rate and epidemic index were calculated. The calculation formula and wilt disease grading table are as follows:

[0053] Incidence rate (%) = (number of diseased plants / total number of plants surveyed) × 100%

[0054] Disease index = 100 × ∑ (number of diseased plants at each level × representative value at each level) / (total number of leaves surveyed × highest representative value)

[0055] Table 1 Grading table of banana seedling wilt

[0056]

[0057] The longitudinal section of the banana corm used in the cultivation experiment is shown in the attached figure. Figure 5 As shown, by comparing the TR4 group and the TR4+YN12C group, it can be seen that inoculation with Acremonium wilt YN12C can significantly prevent and control banana wilt caused by TR4.

[0058] The incidence bar graph is attached. Figure 6 The epidemic index bar chart is shown in the attached Figure 7 As shown in the figure, YN12C+T represents YN12C+TR4. Figure 6 and Figure 7 It can be seen that the incidence and epidemic index of banana wilt disease can be significantly reduced after inoculation with Acremonium wilt YN12C.

Claims

1. A strain of Acremonium leucoderma Acrostalagmus luteo-albus ), its deposit number is: CCTCC NO: M2024179.

2. A bacterial agent, characterized in that: The active ingredient of the fungicide is the Acremonium leucophyllum described in claim 1.

3. The fungus used in the control of the pathogenic bacteria of claim 1 or claim 2 is: Fusarium oxysporum Cuban special type [ Fusarium oxysporum f.sp.cubense (EF Smith) Snyder et Hasen, Foc] Application of tropical race 4 to banana wilt.

Images