A lettuce LsIQD16 gene and its application

Abstract

The invention belongs to the field of biotechnology and specifically relates to a lettuce LsIQD16 Gene and its application. LsIQD16 The CDS sequence of the gene is shown in SEQ ID NO: 1; LsIQD16 The gene was amplified from wild-type lettuce plants. LsIQD16 Gene construct overexpression LsIQD16 Transgenic lettuce lines, biomass test results show overexpression LsIQD16 The leaf area and biomass of lettuce with the genetic modification were significantly increased.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology and specifically relates to a lettuce LqCy Genes and their applications. Background Art

[0002] The information disclosed in this background section is intended to enhance understanding of the overall background of the invention and should not necessarily be regarded as an admission or any form of suggestion that the information constitutes the prior art already known to a person skilled in the art.

[0003] lettuce( Lactuca sativa L.) is one of the most important leafy vegetables in the world. At present, the cultivated area and yield of lettuce in my country are 607,980 hectares respectively, ranking first in the world, accounting for 50%. During the planting process, it is considered as pollution-free vegetables because it grows in a cool environment and rarely or less pesticides are sprayed, and is deeply loved by consumers. Lettuce is rich in folic acid, vitamin C, vitamin E and other vitamins, dietary minerals such as iron, and bioactive compounds such as carotenoids and phenolic compounds, and has rich nutritional value. In addition, lettuce also has high medicinal and health value. Its antioxidant compounds can protect the heart, inhibit inflammation, fight cancer, fight diabetes and antioxidants.

[0004] In recent years, the demand for lettuce in the Chinese market has increased dramatically, and the planting area has continued to expand. Problems such as low lettuce yield and insufficient market supply are very prominent. Therefore, it is very important to find the key gene to increase lettuce yield. Summary of the invention

[0005] In view of the shortcomings of the prior art, the first object of the present invention is to provide a lettuce LqCy Gene.

[0006] The second object of the present invention is to provide the above-mentioned lettuce LqCy Application of genes.

[0007] To achieve the above object, the present invention adopts the following technical solution:

[0008] A kind of lettuce LqCy Gene, the lettuce LqCy The CDS sequence of the gene is shown in SEQ ID NO:1.

[0009] Furthermore, the LqCy The gene was extracted and amplified from wild-type lettuce plants.

[0010] Furthermore, the LqCy The primers for gene amplification are:

[0011] LsIQD16-F-1:ACGCTCGAGCTCAAGCTTATGGGAAAGAAAGGAAGTGGTT; LsIQD16-F-1 is shown in SEQ ID NO: 2;

[0012] LsIQD16-R-1:CGCGGCCCCGGTGGATCCTCACCTAAGCCACCTTCTTAAATC.

[0013] LsIQD16-R-1 is shown in SEQ ID NO:3;

[0014] Above lettuce LqCy Gene application, the lettuce LqCy Genes are used to increase leaf area and biomass of lettuce.

[0015] Beneficial effect: Overexpression LqCy The transgenic lettuce lines significantly increased leaf area and biomass. The average fresh weight increased from 120.7 g / plant to 140 g / plant, with a yield increase of up to 16%, and the corresponding dry weight increased by about 18%. The leaf area increased from 250 cm 2 / tree, increased to 337-339 cm 2 / tree, an increase of about 34%. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] The accompanying drawings constituting a part of the present invention are used to provide a further understanding of the present invention, and the exemplary embodiments of the present invention and their description are used to explain the present invention, and do not constitute an improper limitation of the present invention.

[0017] Figure 1 for LqCy Amplified fragment map;

[0018] Figure 2 This is a diagram showing the screening results of some overexpression strains;

[0019] Figure 3 for LqCy Results of significant difference analysis of overexpression strains;

[0020] Figure 4 For wild type, LqCy Phenotype of the overexpression strain after 45 days of growth. Figure 4 The middle a is the phenotype of the wild type after 45 days of growth. Figure 4 Middle b is the phenotype of the overexpression strain OE1 after 45 days of growth. Figure 4 Middle c is the phenotype of the overexpression line OE4 grown for 45 days;

[0021] Figure 5 For wild type, LqCy Leaf phenotype of the overexpression strain after 45 days of growth;

[0022] Figure 6 For wild type, LqCy The leaf area, plant fresh weight and dry weight of the overexpression lines were measured. Figure 6 a in the middle is the wild type, LqCy Leaf area statistics of overexpression lines. Figure 6 b is the wild type, LqCy Statistical graph of fresh weight of overexpression lines. Figure 6 c in the middle is the wild type, LqCy Statistical graph of plant dry weight of overexpression lines. DETAILED DESCRIPTION

[0023] The present invention will be further described below in conjunction with specific examples. It should be understood that these examples are only used to illustrate the present invention and are not intended to limit the scope of the present invention. The experimental methods in the following examples without specifying specific conditions are usually carried out under conventional conditions or under conditions recommended by the manufacturer.

[0024] Unless otherwise defined, all professional and scientific terms used herein have the same meanings as those familiar to those skilled in the art. The reagents or raw materials used in the present invention can be purchased through conventional channels. If not otherwise specified, the reagents or raw materials used in the present invention are used in a conventional manner in the art or in accordance with the product instructions. In addition, any method and material similar to or equivalent to the described content can be applied to the method of the present invention. The preferred implementation methods and materials described in the present invention are for demonstration purposes only. The present invention is further described according to the accompanying drawings and specific embodiments of the specification.

[0025] Example 1 Construction of vector and transgenic plant

[0026] (1) Cloning LqCy Gene, through LqCy A 15-20 bp homologous recombination fragment was introduced into the 5' and 3' ends of the gene. The cDNA of the wild-type lettuce variety "Latifolia Green Elegant" (L46) was used as a template and KOD-plus-Neo high-fidelity enzyme was used to obtain the full-length CDS sequence of the gene by PCR amplification. The primer sequences used for gene amplification were:

[0027] LsIQD16-F-1: ACGCTCGAGCTCAAGCTTATGGGAAAGAAAGGAAGTGGTT;

[0028] LsIQD16-R-1:CGCGGCCCCGGTGGATCCTCACCTAAGCCACCTTCTTAAATC;

[0029] The PCR reaction system is:

[0030]

[0031] The PCR reaction program was as follows: pre-denaturation at 94°C for 2 min; denaturation at 98°C for 10 sec; annealing at 55°C for 30 sec; extension at 68°C for 1 min; 40 cycles; and extension at 68°C for another 7 min.

[0032] LqCy The CDS sequence of the gene is shown in SEQ ID NO: 1;

[0033] Figure 1 for LqCy Amplified fragment map;

[0034] (2) The obtained value in step (1) LqCy The gene expression fragment was cloned into the pEZR(K)-LC expression vector by homologous recombination to obtain a recombinant vector;

[0035] Will LqCy The method for cloning a gene expression fragment into a pEZR(K)-LC expression vector comprises: double digesting the pEZR(K)-LC expression vector with HindIII and BamHII endonucleases to form sticky ends to obtain an expression vector; and then connecting the CDS of LsIQD16 with the expression vector using a Novozymes single fragment rapid cloning kit (C112-02) to obtain an overexpression vector. LqCy -pEZR(K)-LC, which is the recombinant vector;

[0036] The connection system is as follows:

[0037]

[0038] The procedure is: 37°C, react for 30 min, then cool to 4°C or immediately cool on ice;

[0039] (3) Introducing the recombinant vector obtained in step (2) into Escherichia coli, extracting the plasmid, and then transferring it into EHA105 Agrobacterium to obtain recombinant Agrobacterium;

[0040] (4) Disinfecting the seeds of wild-type lettuce with the loose-leaf lettuce variety "Lactuca Luya" (L46) as the background with alcohol and sodium hypochlorite, germinating them in MS culture medium, cutting off the cotyledons in a clean bench after the two cotyledons open, soaking them in the bacterial solution of the recombinant Agrobacterium obtained in step (3), and conducting a genetic transformation experiment using the leaf disc method; finally, dedifferentiation is performed to differentiate seedlings; the seedlings are transplanted into soil, and mature transgenic lettuce seeds are collected after flowering and fruiting; and then the seeds are propagated to screen positive pure line plants;

[0041] The specific steps are as follows:

[0042] ①Disinfection of lettuce seeds

[0043] The plump lettuce seeds were first soaked in 70% ethanol for 1 min; then soaked in 20% sodium hypochlorite for 15 min, and washed three times with sterile water; the treated seeds were inoculated on the surface of MS solid culture medium and cultured at 25°C with a photoperiod of 16 h until two cotyledons grew out. The preparation of MS solid culture medium: 4.43 g / L M519 (Phytotech), 30 g / L sucrose (Sigma), 3.0 g / L plant gel (Sigma);

[0044] ②Cotyledon infection

[0045] Cut off the cotyledons of the lettuce seedlings with sterile scissors, place them in the activated recombinant Agrobacterium 1 / 2MS suspension, infect for about 15 minutes, take out the infected cotyledons, absorb the excess bacterial liquid with sterile absorbent paper, place the leaves on the co-cultivation medium MS1, and culture them in the dark at 25℃ for 48 hours. Preparation of MS1 solid medium: add 0.5 mg / L 6-BA and 0.1 mg / L NAA to the MS medium;

[0046] ③ Cotyledon differentiation

[0047] The infected cotyledons were transferred to differentiation medium MS2 and subcultured at 25°C with a 16 h photoperiod until kana-resistant differentiated seedlings were obtained. Preparation of MS2 solid medium: 200 mg / L Timentin, 0.5 mg / L 6-BA, 0.1 mg / L NAA and 50 mg / L Kana antibiotics were added to the MS medium;

[0048] ④ Rooting

[0049] Cut the buds and transfer them to rooting medium MS4, so that plants with kanamycin resistance can be obtained. After the root system is well developed, transfer them to soil. Preparation of MS4 solid medium: Add 200 mg / L Timentin and 0.05 mg / L NAA to MS medium;

[0050] ⑤ The lettuce seedlings obtained in step ④ were subjected to PCR identification to screen out positive transgenic plants, and the lettuce seedlings with independent transformation events were obtained and then propagated again; the specific method was to use the total DNA of its leaves as a template, use the 35S primers on the vector and LqCy The gene's own reverse primer was used to screen positive transgenic lines, and 8 positive plants were obtained;

[0051] The primers for identification are:

[0052] 35S-F:ATTGCCCAGCTATCTGTCACTT;

[0053] LsIQD16-R: TGCTGAGTTTCTGCATCTTG;

[0054] Screening PCR reaction system (2×Taq PCR MasterMix from Beijing Adele Biotechnology Co., Ltd.):

[0055]

[0056] The PCR reaction program for screening is:

[0057] Pre-denaturation at 94℃ for 3 min; denaturation at 94℃ for 30 sec; annealing at 55℃ for 30 sec; extension at 72℃ for 1 min; 31 cycles; extension at 72℃ for another 5 min.

[0058] The positive lines were analyzed by qRT-PCR. LqCy The expression level was measured, and two strains with higher expression levels were selected and named according to the expression level. 35S:LsIQD16 -1 (OE1), 35S:LsIQD16 -4 (OE4), propagated for two generations to the T2 generation, for subsequent experiments.

[0059] Figure 2 This is a diagram showing the results of screening some overexpression strains; the results show that the PCR identification results of the 8 seedlings obtained were all positive.

[0060] Figure 3 for LqCy Results of the significant difference analysis of overexpression lines; the results showed that the expression levels of the two transgenic lines, OE1 and OE4, were relatively high, 37X and 28X respectively.

[0061] Biomass detection

[0062] Wild-type and overexpressed LqCy The lettuce seeds were placed on moist filter paper for 3-4 days. After germination and rooting, they were planted in 7*7 cm seedling holes. About 20 days later, 25 WT, 25 OE1 and 25 OE4 plants were planted in 26*26 cm large pots. After growing to the 45th day, 20 plants with good growth were selected for leaf area and biomass determination. The leaf area was measured on the 4th fully expanded leaf; the fresh weight was the weight of all the above-ground parts, and then the above-ground parts were placed in a 45℃ oven and thoroughly dried and weighed after one week. Figure 4 For wild type, LqCy Phenotype of the overexpression strain after 45 days of growth. Figure 4 The phenotype of the wild type (WT) after 45 days of growth is shown in Figure a. Figure 4 Middle b is the phenotype of the overexpression strain OE1 after 45 days of growth. Figure 4 Middle c is the phenotype of the overexpression line OE4 after 45 days of growth. Figure 5 For wild type, LqCy Leaf phenotypes of the overexpression lines after 45 days of growth. Figure 6 For wild type, LqCy The leaf area, plant fresh weight and dry weight of the overexpression lines were measured. Figure 6 a in the middle is the wild type, LqCy Leaf area statistics of overexpression lines. Figure 6 b is the wild type, LqCy Statistical graph of fresh weight of overexpression lines. Figure 6 c in the middle is the wild type, LqCy Statistical chart of plant dry weight of overexpression lines; the results showed that overexpression LqCy The transgenic lettuce lines increased leaf area and biomass. The average fresh weight increased from 120.7 g / plant to 140 g / plant, with a yield increase of up to 16%, and the corresponding dry weight increased by about 18%. The leaf area increased from 250 cm 2 / tree, increased to 337-339 cm 2 / tree, an increase of about 34%.

[0063] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Although the present invention is described in detail with reference to the aforementioned embodiments, those skilled in the art can still modify the technical solutions described in the aforementioned embodiments or replace some of the technical features therein by equivalents. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. A kind of lettuce LsIQD16 A gene characterized by The lettuce LsIQD16 The CDS sequence of the gene is shown in SEQ ID NO:

1.

2. The lettuce according to claim 1 LsIQD16 A gene characterized by Said LsIQD16 The gene was extracted and amplified from wild-type lettuce plants.

3. The lettuce according to claim 2 LsIQD16 A gene characterized by Said LsIQD16 The primers for gene amplification are: LsIQD16-F-1:ACGCTCGAGCTCAAGCTTATGGGAAAGAAAGGAAGTGGTT; LsIQD16-R-1:CGCGGCCCCGGTGGATCCTCACCTAAGCCACCTTCTTAAATC。 4. The lettuce according to claim 1 LsIQD16 The application of genes is characterized in that Romaine lettuce LsIQD16 Genes are used to increase leaf area and biomass of lettuce.

Images