Preparation method and application of yeast-expressed triple-helical type III recombinant human collagen

Abstract

The present invention discloses a preparation method and application of a yeast-expressed triple helical type III recombinant human collagen protein, and relates to the field of biotechnology. The preparation method comprises the steps of obtaining the triple helical type III recombinant human collagen protein by fermentation and purification using engineering bacteria; the construction method of the engineering bacteria comprises using the modified plasmid to construct a collagen expression vector, firstly screening the collagen expression amount to obtain a high-expression strain, then introducing a P4H enzyme expression plasmid into the high-expression strain to obtain a co-expression strain, and obtaining a mature triple helical type III recombinant human collagen protein by fermentation and purification. The triple helical type III recombinant human collagen protein obtained by the preparation method of the present invention contains hydroxyproline, and hydroxyproline accounts for more than 40% of the total proline, and can be widely used in the fields of cosmetics, medical cosmetology, medical devices, biomedical materials, etc.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to a preparation method and application of yeast-expressed triple-helix structure type III recombinant human collagen. Background Art

[0002] Collagen is the earliest discovered and most abundant type of extracellular matrix protein. It is widely found in the skin, muscles, bones and internal organs of humans and animals. It plays an important role in maintaining the normal physiological functions of cells, tissues and organs, as well as repairing damage. Collagen is widely used in food, cosmetics, nutrition and health care due to its excellent physical and chemical properties, biological efficacy, biocompatibility and biodegradability.

[0003] According to the source, collagen can be roughly divided into animal collagen and recombinant collagen. Animal collagen mainly comes from terrestrial animals and marine animals, while recombinant collagen refers to the protein obtained by cloning human collagen genes into selected expression vectors and transforming them into expression cells, and finally through purification technology. Due to the rapid development of molecular biology methods and the potential pathogenic risks and immunogenicity of animal collagen, research and market are mainly focused on recombinant collagen.

[0004] According to the "Guidelines for the Naming of Recombinant Collagen Biomaterials" issued by the National Medical Products Administration on March 15, 2021, recombinant collagen can be divided into three categories: ① Recombinant human collagen, the full-length amino acid sequence encoded by the specific type of human collagen gene prepared by DNA recombinant technology, has a triple helix structure; ② Recombinant human collagen, the full-length or partial amino acid sequence fragments encoded by the specific type of human collagen gene prepared by DNA recombinant technology, or a combination of functional fragments of human collagen; ③ Recombinant collagen-like protein, the amino acid sequence or fragments encoded by a specific gene designed and modified by DNA recombinant technology, or a combination of such functional amino acid sequence fragments. This gene coding sequence or amino acid sequence has low homology with the gene coding sequence or amino acid sequence of human collagen.

[0005] At present, the mainstream products on the market are recombinant human collagen or recombinant collagen-like proteins. Because this type of collagen has no post-translational modification and triple helix structure, it can be expressed in large quantities in microorganisms at a low cost. However, these two types of collagen do not have a helical structure, and the internal enzyme cleavage sites are very accessible, so they are prone to enzymatic hydrolysis. In addition, the flexible single chain lacks steric hindrance, and more amino acid side chains are also prone to chemical reactions, resulting in non-enzymatic hydrolysis; the mechanical properties of single-chain collagen are far inferior to those of triple helix collagen, and it is difficult to be competent in application scenarios that require higher mechanical strength. The expression level of recombinant human collagen is much lower than that of the other two collagens. Escherichia coli, yeast, plants, baculovirus, and mammalian cell expression systems are all used to express recombinant human collagen. Although many expression systems are described in the literature, the current expression systems for large-scale production of human collagen rely on yeast and plants. For example, FibroGen, Inc. (San Francisco, California, USA) produces recombinant collagen in yeast cells, while CollPlant Ltd. (Rehovot, Israel) uses tobacco as a collagen production plant. Based on published literature, these companies are primarily focused on collagen type I and collagen type III for use in the manufacture of biopharmaceutical products, including artificial corneas, implants, and wound dressings.

[0006] There are now a large number of literature reports on cases of recombinantly expressed collagen. In commercial applications, single chains such as recombinant humanized collagen are the mainstream. Such collagen lacks key collagen features, including triple helical conformation, modification of proline and lysine residues, and resistance to enzymatic degradation.

[0007] Since triple helical collagen (recombinant human collagen) requires specific α-chain assembly and appropriate post-translational modification, it cannot be simply expressed using conventional industrial production systems (E. coli, yeast). Existing technologies mostly co-express P4H in these expression systems to obtain hydroxylated collagen and triple helical collagen. Olsen et al. reported that the expression level of human collagen types I to III in Pichia pastoris can reach 1-1.5 g / L, and mentioned genetic optimization and process optimization, but there is no full disclosure. Olsen's laboratory used Pichia pastoris to co-express collagen and human P4H (P4HA1) to obtain recombinant collagen with a hydroxylation degree close to that of natural protein. Rutschmann et al. co-expressed collagen and human P4H (P4HA1) in E. coli, and most other hosts such as tobacco and insect cells also co-expressed human P4H (P4HA1).

[0008] CN114853881B uses proline hydroxylase from Bacillus anthracis to hydroxylate collagen in Escherichia coli, but non-human P4H has different substrate specificity, and the obtained recombinant collagen may cause immune risks. CN112626074B co-expresses collagen and P4H (P4HA2) in Pichia pastoris to obtain hydroxylated recombinant collagen that can be secreted, but the hydroxylation ratio is low and a triple helical conformation cannot be formed. The present invention intends to develop a yeast-expressed triple helical structure type III recombinant human collagen and a preparation method thereof, so as to achieve efficient expression of triple helical structure type III recombinant human collagen and meet the market demand for triple helical structure type III recombinant human collagen. Summary of the invention

[0009] The purpose of the present invention is to provide a preparation method and application of yeast-expressed triple-helical type III recombinant human collagen to solve the problems of the prior art. The recombinant human collagen prepared by the preparation method of the present invention has a triple-helical structure, and the hydroxyproline content therein can reach more than 40% of the total proline.

[0010] To achieve the above object, the present invention provides the following solutions:

[0011] The present invention provides an engineering bacterium KM71 / 3A1FL-1#-Z for expressing triple helical structure type III recombinant human collagen S -P4H construction method, comprising transforming the pMChZ-3A1FL plasmid and the pPIC9K-P4H(DP)-1 plasmid into a host bacterium to construct the engineered bacterium KM71 / 3A1FL-1#-Z S - Steps of P4H;

[0012] The pMChZ-3A1FL plasmid is constructed by connecting the type III collagen α1 chain DNA sequence into the pMChZ-AOX plasmid;

[0013] The pMChZ-AOX plasmid is obtained by modifying the pPIC9K plasmid as follows: replacing 4647-9266 bp of the pPIC9K plasmid with a DNA molecule with a nucleotide sequence as shown in SEQ ID NO.1; deleting BamHI located before αMF in the pPIC9K plasmid and the αMF by point mutation; introducing a BamHI recognition site between 1583-1584 bp of the pPIC9K plasmid by point mutation;

[0014] The construction method of the pPIC9K-P4H(DP)-1 plasmid comprises: replacing KanR in the P4H 9K DP plasmid with a DNA molecule having a nucleotide sequence as shown in SEQ ID NO.5 to obtain the pPIC9K-P4H(DP)-1 plasmid.

[0015] Furthermore, the host bacteria is Pichia pastoris.

[0016] Furthermore, the Pichia pastoris is X33, GS115, KM71 or KM71H.

[0017] The present invention also provides a method for constructing an engineered bacterium KM71 / 3A1NproΔ-2#-P4H expressing triple helical type III recombinant human collagen, comprising the steps of transforming a pMChZ-3A1NproΔ plasmid, a pMCrZ-3A1NproΔ plasmid and a pPIC9K-P4H(DP)-1 plasmid into a host bacterium to construct the engineered bacterium KM71 / 3A1NproΔ-2#-P4H;

[0018] The pMChZ-3A1NproΔ plasmid is constructed by connecting 3A1NproΔ into the pMChZ-AOX plasmid;

[0019] The pMCrZ-3A1NproΔ plasmid is constructed by connecting the 3A1NproΔ plasmid into the pMCrZ-AOX plasmid;

[0020] The nucleotide sequence of 3A1NproΔ is shown in SEQ ID NO.7;

[0021] The pMChZ-AOX plasmid is obtained by modifying the pPIC9K plasmid as follows: replacing 4647-9266 bp of the pPIC9K plasmid with a DNA molecule with a nucleotide sequence as shown in SEQ ID NO.1; deleting BamHI located before αMF in the pPIC9K plasmid and the αMF by point mutation; introducing a BamHI recognition site between 1583-1584 bp of the pPIC9K plasmid by point mutation;

[0022] The pMCrZ-AOX plasmid is constructed by replacing PpHIS4 on the pMChZ-AOX plasmid with a DNA sequence as shown in SEQ ID NO.2;

[0023] The construction method of the pPIC9K-P4H(DP)-1 plasmid comprises: replacing KanR in the P4H 9K DP plasmid with a DNA molecule having a nucleotide sequence as shown in SEQ ID NO.5 to obtain the pPIC9K-P4H(DP)-1 plasmid.

[0024] Furthermore, the host bacteria is Pichia pastoris.

[0025] The Pichia pastoris is X33, GS115, KM71 or KM71H.

[0026] The present invention also provides a method for constructing an engineering bacterium KM71H / 3A1THR-TEV-2#-P4H expressing triple helical type III recombinant human collagen, comprising the steps of transforming a pMChZ-3A1THR-TEV plasmid, a pMCrZ-3A1THR-TEV plasmid and a pPIC9K-P4H(DP)-1 plasmid into a host bacterium to construct the engineering bacterium KM71H / 3A1THR-TEV-2#-P4H;

[0027] The pMChZ-3A1THR-TEV plasmid is constructed by connecting 3A1THR-TEV into the pMChZ-AOX plasmid;

[0028] The pMCrZ-3A1THR-TEV plasmid is constructed by connecting the 3A1THR-TEV into the pMCrZ-AOX plasmid;

[0029] The nucleotide sequence of the 3A1THR-TEV is shown in SEQ ID NO.9;

[0030] The pMChZ-AOX plasmid is obtained by modifying the pPIC9K plasmid as follows: replacing 4647-9266 bp of the pPIC9K plasmid with a DNA molecule with a nucleotide sequence as shown in SEQ ID NO.1; deleting BamHI located before αMF in the pPIC9K plasmid and the αMF by point mutation; introducing a BamHI recognition site between 1583-1584 bp of the pPIC9K plasmid by point mutation;

[0031] The pMCrZ-AOX plasmid is constructed by replacing PpHIS4 on the pMChZ-AOX plasmid with a DNA molecule having a nucleotide sequence as shown in SEQ ID NO.2;

[0032] The construction method of the pPIC9K-P4H(DP)-1 plasmid comprises: replacing KanR in the P4H 9K DP plasmid with a DNA molecule having a nucleotide sequence as shown in SEQ ID NO.5 to obtain the pPIC9K-P4H(DP)-1 plasmid.

[0033] Furthermore, the host bacteria is Pichia pastoris.

[0034] Furthermore, the Pichia pastoris is X33, GS115, KM71 or KM71H.

[0035] The present invention also provides an engineering bacterium expressing triple helical type III recombinant human collagen constructed according to the above construction method.

[0036] The present invention also provides the use of the above-mentioned engineering bacteria in the preparation of triple helical structure type III recombinant human collagen.

[0037] The present invention also provides a method for preparing triple helical type III recombinant human collagen expressed by yeast, comprising the steps of obtaining the triple helical type III recombinant human collagen by fermentation and purification using the above-mentioned engineering bacteria.

[0038] The present invention also provides a triple helical structure type III recombinant human collagen prepared according to the above preparation method.

[0039] The present invention also provides the use of the triple helical structure type III recombinant human collagen in the preparation of biopharmaceutical products, wherein the biopharmaceutical products are skin care products, skin repair dressings, implants, artificial skin, biomaterials and / or medical devices.

[0040] The present invention discloses the following technical effects:

[0041] The present invention transforms the plasmid and constructs a recombinant expression vector, firstly obtains a high-expression strain by screening the collagen expression amount, and then introduces the P4H expression plasmid into the strain to obtain a co-expression strain, which can be used to study the hydroxylation difference of full-length collagen by P4H from different sources in Pichia pastoris. The transformed plasmid that can be used for multi-copy in vitro and multi-copy in vivo at the same time facilitates the screening of high-copy strains, so that the obtained collagen has a triple helical structure.

[0042] The co-expression strain provided by the present invention obtains triple-helical type III recombinant human collagen through fermentation and purification. The co-expression strain has high expression of triple-helical recombinant humanized type III collagen and simple purification. The triple-helical type III recombinant human collagen obtained after purification contains hydroxyproline.

[0043] Compared with type III collagen of animal origin, the triple-helical type III recombinant human collagen provided by the present invention has the advantages of uniform molecular weight, high purity, and no hidden danger of virus transmission; the triple-helical type III recombinant human collagen has the characteristic triple-helical structure of collagen, and can self-assemble to form characteristic collagen microfibrils; the triple-helical type III recombinant human collagen can significantly promote the adhesion, proliferation and migration of human fibroblasts, and exhibits high biocompatibility and biological activity.

[0044] The triple-helical recombinant humanized type III collagen provided by the present invention has good water solubility and stable quality; the triple-helical mature type III collagen can be applied to the fields of medical health and medical beauty that require large molecular weight and high support collagen, such as widely used in skin care products, skin repair dressings, implants, artificial skin, biomaterials, medical devices and other fields. BRIEF DESCRIPTION OF THE DRAWINGS

[0045] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0046] Figure 1 is the plasmid map of pPIC9K;

[0047] Figure 2 is the plasmid map of pMChZ-AOX;

[0048] Figure 3 is the plasmid map of pMCrZ-AOX;

[0049] Figure 4 is the plasmid map of pMCeH-AOX;

[0050] Figure 5 Flowchart for constructing 3A1FL related expression strains; the rounded rectangle is the yeast strain, and the right-angled rectangle is the expression plasmid; Z R Indicates Zeocin resistance, Z S Indicates sensitivity to Zeocin; the number before # indicates the number of times the collagen expression plasmid was electroporated, and the number with a circle indicates that the same plasmid was used for electroporation as in the previous round;

[0051] Figure 6 The expression identification results of 3A1FL related strains; a is KM71 / 3A1FL-1#-Z with 6His as the primary antibody R Identification results; b is KM71 / 3A1FL-②#-Z with 6His as primary antibody R The identification result; c is KM71 / 3A1FL-②#-Z R and KM71 / 3A1FL-1#-Z R The identification results of F9; d is KM71 / 3A1FL-1#-Z S -P4HA test results of P4H; e is KM71 / 3A1FL-1#-Z S -P4HB test results of P4H;

[0052] Figure 7 Flowchart for constructing 3A1NproΔ related expression strains; the rounded rectangles are yeast strains, and the right-angled rectangles are expression plasmids; Z R Indicates Zeocin resistance, Z S Indicates sensitivity to Zeocin; the number before # indicates the number of times the collagen expression plasmid was electroporated, and the number with a circle indicates that the same plasmid was used for electroporation as in the previous round;

[0053] Figure 8 The expression identification results of 3A1NproΔ related strains; a is KM71 / 3A1NproΔ-1#-Z with COL3A as the primary antibody R b is the identification result of KM71 / 3A1NproΔ-1#-Z with 6His as the primary antibody R The identification results; c is KM71 / 3A1NproΔ-②#-Z R d is the identification result of KM71 / 3A1NproΔ-1#-Z with COL3A as the primary antibody R , the detection results of KM71 / 3A1NproΔ-2# and KM71 / 3A1NproΔ-2#-P4H; e is the detection results of P4HA1 and P4HB of KM71 / 3A1NproΔ-2#-P4H;

[0054] Figure 9 Flow chart for constructing 3A1THR-TEV related expression strains; the rounded rectangle is the yeast strain, and the right-angled rectangle is the expression plasmid; Z R Indicates Zeocin resistance, Z S Indicates sensitivity to Zeocin; the number before # indicates the number of times the collagen expression plasmid was electroporated;

[0055] Figure 10 The expression identification results of 3A1THR-TEV related strains; a is KM71H / 3A1THR-TEV-1#-Z R The identification results of b are KM71H / 3A1THR-TEV-1#-Z S 、KM71H / 3A1THR-TEV-2#-Z R and KM71H / 3A1THR-TEV-2#-P4H; c is the WB test result of the sample in b; d is the test result of KM71H / 3A1THR-TEV-2#-P4H and KM71H / 3A1THR-TEV-3#-P4H using COL3A and 6His as primary antibodies respectively;

[0056] Figure 11 It is a statistical graph of the copy number of the related strain 3A1THE-TEV;

[0057] Figure 12 The electrophoresis diagrams of the samples during the purification process and the samples after purification of 3A1THR-TEV are shown in Figure 1. Among them, a is the electrophoresis diagram of the samples during the purification process; b is the result of non-denaturing electrophoresis of the reconstituted lyophilized powder after purification;

[0058] Figure 13 This is the circular dichroism test result of 3A1THR-TEV;

[0059] Figure 14 The results are obtained by transmission electron microscopy. DETAILED DESCRIPTION

[0060] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but should be understood as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0061] It should be understood that the terms described in the present invention are only for describing a particular embodiment and are not intended to limit the present invention. In addition, for the numerical range in the present invention, it should be understood that each intermediate value between the upper and lower limits of the scope is also specifically disclosed. The intermediate value in any stated value or stated range, and each smaller range between any other stated value or intermediate value in the described range is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded in the scope.

[0062] Unless otherwise indicated, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art. Although the present invention describes only preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of a conflict with any incorporated document, the content of this specification shall prevail.

[0063] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments of the present invention description without departing from the scope or spirit of the present invention. Other embodiments derived from the present invention description will be apparent to those skilled in the art. The present invention description and examples are exemplary only.

[0064] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0065] Pichia pastoris KM71, Pichia pastoris KM71H and plasmid pPIC9K used in the following examples were purchased from Invitrogen.

[0066] Example 1

[0067] 1. Construction of plasmids that can be used for both in vitro and in vivo multi-copy construction

[0068] Synthesize SEQ ID NO.1 sequence to replace pPIC9K (see the map) Figure 1), namely, the KanR resistance gene, Bom and AOX13'fragment elements in pPIC9K were deleted, the two ends of the replacement sequence contained lox71 and lox66 sequences, and there was a Cre transcription unit inside. The Cre gene was driven by the pAOX1 promoter with a mutated SacⅠ restriction site; there were prokaryotic and eukaryotic promoters before BleoR, which could be used for prokaryotic and eukaryotic screening, and there was a prokaryotic promoter before AmpR, which could be used for prokaryotic screening; BamHI (938-943bp) and αMF in front of αMF in pPIC9K were deleted by point mutation, and a BamHI recognition site was introduced between 1583-1584bp by point mutation to obtain the plasmid pMChZ-AOX (h represents the recombination site PpHIS4, and Z represents the screening marker BleoR; see the map for details). Figure 2 ). The plasmid can express Cre recombinase when induced by methanol, catalyze the recombination of lox71 and lox66, and realize the recovery of resistance genes. BamHI located after AOXtt can be used to construct in vitro multi-copy plasmids with the same tail enzyme.

[0069] SEQ ID NO.1:

[0070]

[0071]

[0072]

[0073] Among them, the 5' end Shown is lox71, 3' end The indicated number is lox66; "" indicates AmpR, P AmpR , Shown is the P of the mutant SacⅠ site AOX1 , "" indicates the Cre recombinase gene, AOX1tt shown, P TEF , lowercase letter P EM7 , For BleoR, CYC1tt shown.

[0074] The sequence of SEQ ID NO.2 (PpRGI2) was synthesized to replace PpHIS4 on pMChZ-AOX to obtain plasmid pMCrZ-AOX (r represents the recombination site is PpRGI2; the map is shown in Figure 3 shown).

[0075] The SEQ ID NO.3 sequence (PpENO) was synthesized to replace PpHIS4 on pMChZ-AOX, and the SEQ ID NO.4 sequence was synthesized to replace PEM7-BleoR-CYC1tt on pMChZ-AOX to obtain the plasmid pMCeH-AOX (e represents the recombination site is PpENO, H represents the screening marker is HygR; the map is shown in Figure 4 shown).

[0076] SEQ ID NO.4 (the underline is HygR, and the 3' end is TEFtt):

[0077] ATGGGTAAAAAGCCTGAACTCACCGCGACGTCTGTCGAGAAGTTTCTGATCGAAAAGTTCGACAGCGT CTCCGACCTGATGCAGCTCTCGGAGGGCGAAGAATCTCGTGCTTTCAGCTTCGATGTAGGAGGGCGTGGATATGTC CTGCGGGTAAATAGCTGCGCCGATGGTTTCTACAAAGATCGTTATGTTTATCGGCACTTTGCATCGGCCGCGCTCC CGATTCCGGAAGTGCTTGACATTGGGGAATTCAGCGAGAGCCTGACCTATTGCATCTCCCGCCGTGCACAGGGTGT CACGTTGCAAGACCTCCCTGAAACCGAACTGCCCGCTGTTCTGCAGCCGGTCGCGGAGGCCATGGATGCGATCGCT GCGGCCGATCTTAGCCAGACGAGCGGGTTCGGCCCATTCGGACCGCAAGGAATCGGTCAATACACTACATGGCGTG ATTTCATATGCGCGATTGCTGATCCCCATGTGTATCACTGGCAAACTGTGATGGACGACACCGTCAGTGCGTCCGT CGCGCAGGCTCTCGATGAGCTGATGCTTTGGGCCGAGGACTGCCCCGAAGTCCGGCACCTCGTGCACGCGGATTTC GGCTCCAACAATGTCCTGACGGACAATGGCCGCATAACAGCGGTCATTGACTGGAGCGAGGCGATGTTCGGGGATT CCCAATACGAGGTCGCCAACATCTTCTTCTGGAGGCCGTGGTTGGCTTGTATGGAGCAGCAGACGCGCTACTTCGA GCGGAGGCATCCGGAGCTTGCAGGATCGCCGCGGCTCCGGGCGTATATGCTCCGCATTGGTCTTGACCAACTCTAT CAGAGCTTGGTTGACGGCAATTTCGATGATGCAGCTTGGGCGCAGGGTCGATGCGACGCAATCGTCCGATCCGGAG CCGGGACTGTCGGGCGTACACAAATCGCCCGCAGAAGCGCGGCCGTCTGGACCGATGGCTGTGTAGAAGTACTCGC CGATAGTGGAAACCGACGCCCCAGCACTCGTCCGAGGGCAAAGGAATAA TCAGTACTGACAATAAAAAGATTCTTGTTTTCAAGAACTTGTCATTTGTATAGTTTTTTTATATTGTAGTTGTTCTATTTTAATCAAATGTTAGCGTGATTTATATTTTTTTCGCCTCGACATCATCTGCCCAGATGCGAAGTTAAGTGCGCAGAAAGTAATATCATGCGTCAATCGTATGTGAATGCTGGTCGCTATACTG.

[0078] 2. Construction of recombinant expression vector

[0079] The DNA sequences expressing 3A1FL, 3A1NproΔ, and 3A1THR-TEV were synthesized, and the DNA sequence encoding 6×HisTag tag was added to the carboxyl end to make it contain a specific affinity purification tag for easy immunological detection. The exogenous DNA was connected into the expression vectors pMChZ, pMCrZ, and pMCeH to construct the recombinant expression vectors pMChZ-3A1FL, pMChZ-3A1NproΔ, pMCrZ-3A1NproΔ, pMChZ-3A1THR-TEV, pMCrZ-3A1THR-TEV, and pMCeH-3A1THR-TEV expressing 3A1FL, 3A1NproΔ, and 3A1THR-TEV, respectively.

[0080] Synthesize SEQ ID NO.5 to replace KanR in P4H9KDP plasmid (disclosed in Chinese patent CN114480471A), that is, add P at the 5' end of the selection marker (according to the direction of pPIC9K plasmid). TEF and P EM7 , CYC1tt was added to the 3' end to obtain the P4H expression vector pPIC9K-P4H(DP)-1.

[0081] SEQ ID NO.5:

[0082]

[0083] Among them, "" indicates P TEF , P EM7 , Shown is KanR, and “” shows CYC1tt.

[0084] Example 2

[0085] 1.3 Construction and expression identification of A1FL-related strains

[0086] 1.13A1FL related expression plasmid construction

[0087] The complete amino acid sequence (1466aa) of human type III collagen (https: / / www.uniprot.org / uniprot / P02461) was reverse translated according to the Pichia pastoris codon table, and the GC content and secondary structure were optimized to obtain the corresponding nucleic acid sequence, i.e., the type III collagen α1 chain DNA sequence in CN114480471A.

[0088] The primer 3A1FLF (5'-cgGAATTC GAAACG The type III collagen α1 chain DNA sequence was amplified by using 3A1FL R (5'-atagtttagcggccgcttaatgatgatgatgatgatgCAAAAAGCAAACAGGTCCAACA-3', SEQ ID NO11), and an EcoRⅠ site was introduced at the 5' end, and a 6His tag and a NotⅠ site were introduced at the 3' end; after double digestion with EcoRⅠ and NotⅠ, the DNA was cloned into the corresponding site of pMChZ-AOX to obtain pMChZ-3A1FL.

[0089] 1.23A1FL related expression strain construction and expression identification

[0090] according to Figure 5The process shown below constructs the relevant expression strain KM71 / 3A1FL-1#-Z R 、KM71 / 3A1FL-1#-Z S 、KM71 / 3A1FL-②#-Z R and KM71 / 3A1FL-1#-Z S -P4H, the electroporation method refers to Invitrogen's Pichia Expression Kit USER GUIDE. pMChZ-3A1FL was linearized with SalⅠ and coated on YPDZ (bleomycin, 300μg / mL) plates after electroporation; pPIC9K-P4H(DP)-1 was linearized with BspEⅠ and coated on YPDG (Geneticin, 500μg / mL) plates after electroporation. Large colonies of the grown transformants were streaked twice on the screening plate to obtain a single clone for shake flask induction. The engineered strain was inoculated in a 100mL Erlenmeyer flask containing 10mL BMGY medium and cultured at 30°C and 220rpm until OD 600 Centrifuge at 3000g for 5 min at room temperature to collect the cells, and resuspend them in BMMY medium to a concentration of OD 600 The cell culture medium was placed on a shaker at 230°C and 220 rpm for 3 days, and 100% methanol was added to the culture medium every 24 hours to a final concentration of 1.0%. After the induction, the bacterial liquid sample was collected, the sample volume was 1 mL, placed in a 1.5 mL EP tube, centrifuged at 12000g for 5 min at 4°C, and the supernatant and bacteria were collected respectively. 80 μL of the supernatant was added with 20 μL of loading buffer, heated at 80°C for 5 min to prepare the sample, and 20 μL was taken for SDS-PAGE. 200 μL of cell wall breaking solution and 40% liquid volume of 0.5 mm glass beads were added to the bacteria; vortexed for 1 min, placed on ice for 1 min, and cycled 6 times; centrifuged at 3000g for 3 min at 4°C, 80 μL of the supernatant (total protein) was added with 20 μL of loading buffer, heated at 99°C for 5 min to prepare the sample, and 20 μL was taken for SDS-PAGE, followed by Western Blot. Collagen was detected using anti-6His antibody (D191001; Shanghai Bioengineering) and COL3A antibody (B-10; SANTA CRUZ), the α subunit of P4H was detected using P4HA1 antibody (Wuhan Fine), the β subunit of P4H was detected using P4HB antibody (ET7110-92; Hangzhou Huaan Biotechnology), and the internal control antibody ACT_YEAST was purchased from Bioss.

[0091] Formula of cell wall breaking solution: 50 mM sodium phosphate (pH 7.4), 1 mM EDTA, 5% glycerol and 1 mM phenylmethylsulfonyl fluoride (PMSF) were dissolved in anhydrous ethanol to prepare a 100× mother solution, which was added before cell wall breaking.

[0092] The WB test results of related strains are as follows Figure 6 As shown, Figure 6 In a, 6His antibody was used as primary antibody, KM71 / 3A1FL-1#-Z R The full-length collagen can be detected. After repeated electroporation of the same plasmid, the expression level decreases and the target protein can hardly be detected. Figure 6 As shown in b and c. The modified P4H expression plasmid can normally express P4HA and P4HB subunits, such as Figure 6 As shown in d and e.

[0093] 2.3 Construction and expression identification of A1NproΔ related strains

[0094] 2.13A1NproΔ related expression plasmid construction

[0095] The plasmid containing the type III collagen α1 chain DNA sequence in CN114480471A was used as a template and primers 3A1NproΔF

[0096] The 3A1NproΔ sequence was amplified by using 3A1FL R (cgGAATTCGAAACGATGATGTCATTCGTTCAAAAAGGTTCTTGGCTTCTTCTTGCA TTGCTTCATCCTACTATTATCTTGGCTCAATACGACTCTTATGACGTG, SEQ ID NO.12), and after double digestion with EcoRⅠ and NotⅠ, it was cloned into the corresponding site of pMChZ-AOX to obtain pMChZ-3A1NproΔ, and then cloned into the corresponding site of pMCrZ-AOX to obtain pMCrZ-3A1NproΔ.

[0097] The amino acid sequence of 3A1NproΔ is shown in SEQ ID NO.6, and the nucleotide sequence is shown in SEQ ID NO.7.

[0098] 2.23A1NproΔ related expression strain construction and expression identification

[0099] according to Figure 7 The process shown in the figure uses KM71 as the starting strain to construct the related expression strain KM71 / 3A1NproΔ-1#-Z R 、KM71 / 3A1NproΔ-1#-Z S 、KM71 / 3A1NproΔ-②#-Z R, KM71 / 3A1NproΔ-2# and KM71 / 3A1NproΔ-2#-P4H. The electroporation method was based on the Pichia Expression Kit USER GUIDE of Invitrogen. pMChZ-3A1NproΔ was linearized with SalⅠ and plated on YPDZ (300μg / mL) plates after electroporation. The selected transformants KM71 / 3A1NproΔ-1#-Z R After induction, the bacterial liquid was streaked onto a YPD plate, and the grown colonies were spotted onto YPD and YPDZ (100 μg / mL) plates respectively. The strain that grew normally on the YPD plate but could not grow on the YPDZ plate was the strain KM71 / 3A1NproΔ-1#-Z with the recovery screening marker. S ; pMCrZ-3A1NproΔ was linearized with SpeⅠ and coated on YPDZ (300μg / mL) plates after electroporation; pPIC9K-P4H(DP)-1 was linearized with BspEⅠ and coated on YPDG (500μg / mL) plates after electroporation.

[0100] The strain was induced in a shake flask, the method was the same as 1.2. After induction, the cell wall was broken to extract the total protein, and the same total protein was loaded for SDS-PAGE and WB. The WB test results were as follows: Figure 8 As shown. KM71 / 3A1NproΔ-1#-Z R The full-length 3A1NproΔ can be detected, e.g. Figure 8 As shown in a and b, the expression level of the same plasmid decreased after repeated electroporation, and the target protein was almost undetectable. Figure 8 As shown in c. The expression level was improved by electroporation twice using the plasmid with the replaced recombination site. Figure 8 As shown in d. The modified P4H expression plasmid can normally express P4HA and P4HB subunits, such as Figure 8 As shown in figure e.

[0101] 3.3A1 Construction and expression identification of THR-TEV related strains

[0102] 3.13A1THR-TEV related expression plasmid construction

[0103] A 6His tag was added between the signal peptide and the N-terminal peptide, and QP was added before the 6His tag to improve the efficiency of signal peptide cleavage; a TEV cleavage sequence was added between the N-terminal peptide and the 3-helix region; a TEV cleavage sequence was added between the 3-helix region and the C-terminal peptide, and a 6His tag was added to the C-terminus to obtain the 3A1THR-TEV amino acid sequence, as shown in SEQ ID NO.8, and the red background is the TEV recognition site. The amino acid sequence was optimized according to the expression preference of Pichia pastoris to obtain a nucleic acid sequence, as shown in SEQ ID NO.9, and cloned into the EcoRⅠ and NotⅠ sites of pMChZ-AOX and pMCrZ-AOX, respectively, to obtain expression plasmids pMChZ-3A1THR-TEV and pMCrZ-3A1THR-TEV; cloned into the BspEⅠ and NotⅠ sites of pMCeH-AOX to obtain the expression plasmid pMCeH-3A1THR-TEV.

[0104] 3.23A1THR-TEV related expression strain construction and expression identification

[0105] according to Fig. 9 The process shown in the figure uses KM71H as the starting strain to construct the 3A1THR-TEV related expression strain KM71H / 3A1THR-TEV-1#-Z R 、KM71H / 3A1THR-TEV-1#-Z S 、KM71H / 3A1THR-TEV-2#-Z R , KM71H / 3A1THR-TEV-2#-P4H and KM71H / 3A1THR-TEV-3#-P4H. The electroporation method was based on Invitrogen's Pichia Expression Kit USER GUIDE. pMChZ-3A1THR-TEV was linearized with SalⅠ and coated on YPDZ (300μg / mL) plates after electroporation. The selected transformants were KM71H / 3A1THR-TEV-1#-Z R After induction, the bacterial liquid was streaked on a YPD plate, and the grown colonies were spotted on YPD and YPDZ (100 μg / mL) plates respectively. The strain that grew normally on the YPD plate but could not grow on the YPDZ plate was the strain KM71 / 3A1THR-TEV-1#-Z with the recovery screening marker. S ; pMCrZ-3A1THR-TEV was linearized with SpeⅠ and coated on YPDZ (300μg / mL) plates after electroporation; pPIC9K-P4H(DP)-1 was linearized with BspEⅠ and coated on YPDG (500μg / mL) plates after electroporation; pMCeH-3A1THR-TEV was linearized with XbaⅠ and coated on YPDH (hygromycin, 200μg / mL) plates after electroporation.

[0106] The strain was induced in a shake flask, the method was the same as 1.2. After induction, the cell wall was broken to extract the total protein, and the same total protein was loaded for SDS-PAGE and WB. The WB test results were as follows: Fig.10 As shown, KM71H / 3A1THR-TEV-1#-Z R The full-length 3A1THR-TEV can be detected, e.g. Fig.10 As shown in a. The plasmid pMCrZ-3A1THR-TEV with the recombination site changed to RGI2 was used for two electroporations, and the expression level was similar to that of KM71H / 3A1THR-TEV-1#-Z S near( Fig.10 b). After being transferred into pPIC9K-P4H(DP)-1, P4HA and P4HB subunits can be expressed normally ( Fig.10 b). The plasmid pMCeH-3A1THR-TEV with the recombination site changed to ENO was used for three electroporations, and the expression levels of some strains were significantly increased ( Fig.10 In (d), different screening markers are used, and the screening markers can be uniformly recovered after multiple rounds of electroporation verification.

[0107] 3.33A1 Identification of target gene copy number in THR-TEV related expression strains

[0108] The strains and plasmid pMChZ-3A1THR-TEV screened out from different batches were commissioned to Shanghai Sangon Biotechnology to detect the copy number of the target gene 3A1THR-TEV using digital PCR, and the PCR instrument was BIO-RAD's T100.

[0109] The mass of a single copy of dsDNA is calculated according to the formula Perform calculations.

[0110] According to the estimated yeast genome size of 9.4 Mb, the mass of one copy of the genome is 10.33×10 -6 ng, calculate the genome copy number in 1 μL template, and the ratio of the final copy number of 1 μL DNA to the genome copy number in 1 μL template in the report is the copy number of the target gene in yeast. The size of pMChZ-3A1THR-TEV is 13938 bp. According to the above formula, the mass of 1 copy of plasmid is 1.53×10 -8 ng. The ratio of the copy number of 3A1THR-TEV in each strain to the copy number of 3A1THR-TEV in pMChZ-3A1THR-TEV was plotted, as shown in Fig.11 The results were consistent with the WB results of 3.2, and the copy number of 3A1THE-TEV in KM71H / 3A1THE-TEV-3#-P4H was significantly higher than that in other strains.

[0111] 4.KM71H / 3A1THR-TEV-3#-P4H high density fermentation

[0112] Seed medium YPG (yeast powder 10g / L, peptone 20g / L and glycerol 10g / L); fermentation medium BSM medium (85% H3PO4 26.7 ml / L, CaSO4·2H2O 0.93g / L, K2SO4 18.2 g / L, MgSO4·2H2O 14.9g / L, KOH 4.13g / L, glycerol 40g / L and PMT1 trace element mother solution 4.0mL / L); feed medium (50% W / V glycerol, 12mL PTM1 trace element mother solution per liter); induction medium (100% methanol, 12mL PTM1 trace element mother solution per liter); PTM1 trace element mother solution: sterilized by filtration with a 0.22μm filter membrane and stored at 4°C. After the fermentation medium was sterilized at high temperature, the PTM1 trace element mother solution was added when the temperature dropped to room temperature, and the pH was adjusted to 6.0 with ammonia water.

[0113] The batch culture conditions and induced expression conditions of the engineered strain KM71H / 3A1THR-TEV-3#-P4H were as follows: the batch fed-batch culture method was adopted, and the culture temperature was 30°C. The engineered bacteria were inoculated into a 1L shake flask containing 200mL of seed culture medium YPG, and cultured for 18h at 220rpm and 30°C until the OD 600 =8. Use a 5L fermentation tank (Baoxing Biotechnology) with 2L of fermentation medium. Before inoculation, adjust the speed to 300rpm, the ventilation volume to 4L / min, the temperature to 30°C, and adjust the pH with an alkali solution prepared with concentrated ammonia water to set the pH to 6.0. First, connect 0.9mL PTM1, then connect the prepared 200mL seed solution into the tank (flame circle inoculation), then click on the dissolved oxygen electrode to calibrate, and start fermentation after calibration. When the dissolved oxygen drops to 30% for the first time during growth, use the dissolved oxygen cascade speed function to maintain 30%; wait for the glycerol to be consumed, the dissolved oxygen to rebound, and the dissolved oxygen to be greater than 70% (OD 600 value of about 20), cancel the dissolved oxygen cascade speed, increase the stirring speed to 650rpm, use 30% linkage feeding of glycerol, and feed 150mL. Stop feeding glycerol, after the dissolved oxygen rebounds to more than 70%, induce culture with methanol, and feed at a constant rate of 4mL / h. After induction for 80h, OD 600 If the change is not obvious or decreases, you can release the tank.

[0114] 5.3A1THR-TEV purification and identification of target protein after purification

[0115] After the fermentation, the bacterial liquid was centrifuged at 5000 rpm for 30 min to collect the bacteria, which were resuspended in the purified cell-breaking solution at a ratio of 1:10 (W:V) and broken four times by a homogenizer at 1000 bar. After the breaking, the cells were centrifuged at 12000 rpm and 4°C for 30 min to separate the supernatant and precipitate.

[0116] Purification cell wall breaking solution formula: 10mM Tris-HCl (pH 7.4), 100mM NaCl and 100mM glycine.

[0117] The precipitate was dissolved in washing buffer, centrifuged at 1000 rpm for 30 min, and then reconstituted with 8 M urea. After reconstitution with reconstitution buffer overnight, the pH was adjusted to 3.0, and pepsin was added to digest overnight at 4°C. After ultrafiltration and desalting, the lyophilized powder was reconstituted and subjected to non-denaturing electrophoresis (4-16% non-denaturing precast gel, catalog number: BN1002BOX, Invitrogen). The results are as follows: Fig.12 As shown in b, the triple-helical collagen after removal of the C-terminal propeptide is about 300 kDa. The results shown in the figure are consistent with the theory.

[0118] Wash buffer formula: 50 mM Tris-HCl (pH 7.5), 2 M urea and 1 mM EDTA.

[0119] Refolding buffer formula: 50 mM sodium phosphate (pH 7.5), 5 mM DTT, 1 mM EDTA and 5% glycerol.

[0120] 6.3 Structural Characterization of A1THR-TEV Lyophilized Powder

[0121] 3A1THR-TEV lyophilized powder was reconstituted and then hydrolyzed by acid. The treated samples were analyzed by LC-MS, the peak area of ​​the targeted data was calculated by MassLynx quantitative software, and the identification results were obtained by the standard curve method. The results showed that the hydroxyproline content reached more than 40% of the total proline.

[0122] The 3A1THR-TEV lyophilized powder was diluted with the blank control solution to a concentration of 0.2 μg / μL.

[0123] Circular dichroism detection: Set the parameters as start wavelength (Begin) 190nm, end wavelength (End) 260nm, step (Step) 1nm, repeat (Repeat) 1 time, acquisition time (Acquisition period) 1s / point, cuvette width 0.1cm. Load the blank control solution, the loading volume is 300μL, and the test is deducted. Then test the sample, the loading volume is 300μL, and the data is saved after the test. The results are as follows Fig.13 As shown, there is a negative peak at 195 nm and a positive peak at 221 nm, which is consistent with the CD characteristics of triple-helical collagen.

[0124] The collagen samples were negatively stained and then tested by transmission electron microscopy. The test results were as follows: Fig.14 Shown are the typical structural features of collagen microfibrils with alternating light and dark characteristics.

[0125] The embodiments described above are only descriptions of the preferred modes of the present invention, and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope determined by the claims of the present invention.

Claims

1. A method for constructing an engineering bacterium KM71H / 3A1THR-TEV-3#-P4H expressing triple helical type III recombinant human collagen, characterized in that: The method comprises the steps of transforming pMChZ-3A1THR-TEV plasmid, pMCrZ-3A1THR-TEV plasmid, pPIC9K-P4H(DP)-1 plasmid and pMCeH-3A1THR-TEV plasmid into host bacteria to construct the engineering bacteria KM71H / 3A1THR-TEV-3#-P4H; The pMChZ-3A1THR-TEV plasmid is constructed by connecting 3A1THR-TEV into the pMChZ-AOX plasmid; The pMCrZ-3A1THR-TEV plasmid is constructed by connecting the 3A1THR-TEV into the pMCrZ-AOX plasmid; The pMCeH-3A1THR-TEV plasmid is constructed by connecting the 3A1THR-TEV into the pMCeH-AOX plasmid; The nucleotide sequence of the 3A1THR-TEV is shown in SEQ ID NO.9; The pMChZ-AOX plasmid is obtained by modifying the pPIC9K plasmid as follows: replacing 4647-9266 bp of the pPIC9K plasmid with a DNA molecule with a nucleotide sequence as shown in SEQ ID NO.1; deleting BamHI and the αMF in front of the αMF in the pPIC9K plasmid by point mutation; and introducing a BamHI recognition site between 1583-1584 bp of the pPIC9K plasmid by point mutation; The pMCrZ-AOX plasmid is constructed by replacing PpHIS4 on the pMChZ-AOX plasmid with a DNA molecule with a nucleotide sequence as shown in SEQ ID NO.2; The pMCeH-AOX plasmid is constructed by replacing PEM7-BleoR-CYC1 tt on the pMChZ-AOX with a DNA molecule having a nucleotide sequence as shown in SEQ ID NO.4; The construction method of the pPIC9K-P4H(DP)-1 plasmid comprises: replacing KanR in the P4H 9KDP plasmid with a DNA molecule with a nucleotide sequence as shown in SEQ ID NO.5 to obtain the pPIC9K-P4H(DP)-1 plasmid; The host bacteria is Pichia pastoris KM71H.

2. An engineered bacterium expressing triple helical type III recombinant human collagen constructed according to the construction method of claim 1.

3. Use of the engineered bacteria as claimed in claim 2 in the preparation of triple helical type III recombinant human collagen.

4. A method for preparing triple helical type III recombinant human collagen expressed in yeast, characterized in that: The method comprises the steps of obtaining the triple helical type III recombinant human collagen by fermentation and purification using the engineering bacteria described in claim 2.

Images