A simple, rapid and efficient method for constructing RNA interference vector and its application

Abstract

The present invention belongs to the field of genetic engineering and molecular biology, and specifically relates to a simple, fast and efficient method for constructing an RNA interference vector and its application. The method specifically includes designing specific primers with homology arms and restriction sites, amplifying exogenous DNA fragments using the specific primers, and using restriction endonucleases to Bam HI and Kpn Ⅰ Enzyme cut the RNA interference empty vector, and use the homologous recombination method to connect the exogenous DNA fragment to the RNA interference empty vector to form the RNA interference final vector. This method introduces a lethal gene on the RNA interference backbone vector. Combined with the homologous recombination method, only one homologous recombination is needed to simultaneously connect two exogenous DNA fragments into the two multiple cloning sites of the RNA interference vector, which greatly shortens the RNA interference vector construction cycle, and the vector construction positive rate reaches 100%. In addition, the selection of exogenous fragments is no longer limited by the restriction site, and can be freely selected, which broadens the range of targets.

Description

Technical Field

[0001] The present invention belongs to the field of genetic engineering and molecular biology, and specifically relates to a simple, rapid and efficient RNA interference vector construction method and application. Background Art

[0002] In the study of gene function, the function of the gene is explored by changing the expression of the gene. There are two different ways to change the expression of the gene: increasing the gene expression and decreasing the gene expression. The decreasing gene expression is divided into two types: partial decrease and gene knockout. In recent years, the birth of CRISPR / Cas9 gene editing technology has made gene knockout very simple and efficient. However, for some important genes, the inactivation of gene mutation may lead to very serious or even lethal phenotypes. Therefore, it is impossible to obtain stable experimental materials, which brings difficulties to the study of the function of these important genes. RNA interference does not cause the target gene to mutate, but only reduces the expression of the gene. While ensuring the survival of the experimental material, it will cause the organism to produce a certain phenotype. Therefore, RNA interference is an irreplaceable method for studying the function of important genes.

[0003] When constructing an RNA interference vector, the same DNA fragment of the target gene needs to be constructed into the two multiple cloning sites of the RNA interference vector, and the DNA fragments in the two multiple cloning sites are mutually reverse complementary. When constructing an RNA interference vector using the traditional method, first, the exogenous DNA fragments must be amplified using specific primers, and then the exogenous DNA fragments are connected to the RNA interference vector step by step using the enzyme-linking method. When connecting the first exogenous DNA fragment, two restriction endonucleases are needed to linearize the RNA interference vector. When connecting the second exogenous DNA fragment, the plasmid containing the first exogenous DNA fragment is needed as an intermediate vector, and two other restriction endonucleases are used to linearize the intermediate vector. This method for constructing an RNA interference vector is complicated, time-consuming, laborious, and inefficient, and requires experienced researchers to operate successfully; in addition, since the target DNA needs to be treated with restriction endonucleases, the target DNA cannot contain restriction endonuclease cutting sites, which limits the selection of exogenous fragments.

[0004] Homologous recombination is another common method for constructing vectors. However, since the DNA fragments connected to the two multiple cloning sites when constructing RNA interference vectors are reverse complementary to each other, if homologous recombination is used to construct RNA interference vectors, the DNA fragments recombined into the two multiple cloning sites are homologous arms to each other, which may lead to recombination failure. Therefore, no researchers have used homologous recombination to construct RNA interference vectors. Summary of the invention

[0005] In order to solve the technical problems in the prior art that RNA interference vector construction is complex, time-consuming and inefficient, the present invention provides a simple, fast and efficient RNA interference vector construction method and application.

[0006] Specifically, the technical solution of the present invention is as follows:

[0007] A simple, rapid and efficient method for constructing an RNA interference vector, the difference being that the method for constructing an RNA interference vector comprises:

[0008] Design specific primers with homology arms and restriction sites, use specific primers to amplify exogenous DNA fragment A and exogenous DNA fragment B, and use restriction endonucleases Bam HI and Kpn Ⅰ The RNA interference empty vector is cut by enzymes, and the exogenous DNA fragment A and the exogenous DNA fragment B are connected to the RNA interference empty vector by homologous recombination to form the RNA interference final vector.

[0009] The sequences of the homology arms and restriction sites of the specific primers are shown in SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3 and SEQ ID NO.4 respectively.

[0010] SEQ ID NO.1: gggagggcgcgcctgcaggtacc

[0011] SEQ ID NO.2: cacgcgtacgtaaggttggatcc

[0012] SEQ ID NO.3: aacaattcaattcagtggagctc

[0013] SEQ ID NO.4: agcaggactctagaccccactagt

[0014] Among them, the sequences of the homologous arms and restriction site of the forward specific primer used to amplify the exogenous DNA fragment A are shown in SEQ ID NO.1, the sequences of the homologous arms and restriction site of the reverse specific primer are shown in SEQ ID NO.2, the sequences of the homologous arms and restriction site of the forward specific primer used to amplify the exogenous DNA fragment B are shown in SEQ ID NO.3, and the sequences of the homologous arms and restriction site of the reverse specific primer are shown in SEQ ID NO.4; except for the homologous arms and restriction site sequences, the other sequences of the exogenous DNA fragment A and the exogenous DNA fragment B are reverse complementary sequences.

[0015] The RNA interference empty vector has two ccdB gene expression boxes, which are respectively located inside two multiple cloning sites of the RNA interference vector. The ccdB gene can kill common Escherichia coli.

[0016] The RNA interference empty vector sequence is shown in SEQ ID NO.5.

[0017] SEQ ID NO.5:

[0018]

[0019] The application of the simple, rapid and efficient RNA interference vector construction method in constructing an RNA interference vector is characterized in that it comprises the following steps:

[0020] Step 1: Design specific primers with homology arms and restriction sites for the target gene;

[0021] Step 2: using the designed specific primers to amplify the exogenous DNA fragments by PCR, the exogenous DNA fragments are exogenous DNA fragment A and exogenous DNA fragment B, and the exogenous DNA fragment A and the exogenous DNA fragment B, except for the homology arm and restriction site sequences, other sequences are reverse complementary sequences;

[0022] Step 3: Use restriction enzymes Bam HI and Kpn Ⅰ Enzyme digestion of RNA interference empty vector;

[0023] Step 4: Using a homologous recombinase, the PCR product of step 2 and the empty vector digestion product of step 3 are homologously recombined to obtain a ligation product;

[0024] Step 5: After the ligation product is transferred to Escherichia coli, culture and plasmid extraction are performed in sequence, and enzyme digestion is performed to verify the positive RNA interference final vector.

[0025] The sequences of the homologous arms and restriction sites of the specific primers are shown in SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3, and SEQ ID NO.4, respectively, wherein the sequences of the homologous arms and restriction sites of the forward specific primer used to amplify the exogenous DNA fragment A are shown in SEQ ID NO.1, the sequences of the homologous arms and restriction sites of the reverse specific primer are shown in SEQ ID NO.2, the sequences of the homologous arms and restriction sites of the forward specific primer used to amplify the exogenous DNA fragment B are shown in SEQ ID NO.3, and the sequences of the homologous arms and restriction sites of the reverse specific primer are shown in SEQ ID NO.4.

[0026] The RNA interference empty vector has two ccdB gene expression boxes, which are respectively located inside two multiple cloning sites of the RNA interference vector. The ccdB gene can kill common Escherichia coli.

[0027] The RNA interference empty vector sequence is shown in SEQ ID NO.5.

[0028] The reaction system for enzymatic digestion of RNA interference empty vector is: RNA interference empty vector 3 μg, 10 × Buffer 5 μl, Bam HI 1 μl,Kpn Ⅰ 1 μl, add ddH2O to 50 μl, and digest at 37℃ for 1 h.

[0029] The homologous recombination reaction system is: 1 μl exogenous DNA fragment A, 1 μl exogenous DNA fragment B, 1 μl RNA interference empty vector digestion product, 2 μl 5×CE II Buffer, 1 μl Exnase® II, ddH2O to 10 μl, and react at 37℃ for 30 min.

[0030] Compared with the prior art, the present invention has the following beneficial effects:

[0031] (1) A simple, rapid and efficient method for constructing RNA interference vectors was established. This method can simultaneously connect exogenous DNA fragments into the two multiple cloning sites of RNA interference vectors through only one recombination, greatly shortening the construction cycle of RNA interference vectors;

[0032] (2) The lethal gene ccdB of Escherichia coli was introduced into the backbone vector ds1301 of RNA interference, and then the target interference vector was constructed by homologous recombination. The introduction of the lethal gene and the use of the homologous recombination method will significantly increase the positive rate. The results showed that the positive rate was 100%, and the operation steps were also greatly simplified;

[0033] (3) Since the homologous recombination vector construction method does not require enzyme cleavage of exogenous fragments, the selection of exogenous fragments is no longer restricted by enzyme cleavage sites, but can be freely selected, thus broadening the range of targets;

[0034] (4) This method only requires two restriction endonucleases to linearize the vector, while the traditional method requires four restriction endonucleases, saving costs;

[0035] (5) The exogenous DNA fragments and linearized vectors used in this method do not need to be purified and can be directly used in homologous recombination reactions, saving time and experimental costs. BRIEF DESCRIPTION OF THE DRAWINGS

[0036] Figure 1 This is a flowchart of RNA interference vector construction;

[0037] Figure 2 This is the vector map of the RNA interference empty vector DS1301C;

[0038] Figure 3 This is the gel image of RNA interference vector digestion of rice AL1 gene, where Marker: DNA molecular weight standard; Lanes 1-4: restriction endonuclease Bam H Ⅰ and KpnⅠ: RNA interference vector of four rice AL1 genes after restriction digestion; bp: base pair. DETAILED DESCRIPTION

[0039] The principles and features of the present invention are described below in conjunction with the accompanying drawings. The examples are only used to explain the present invention and are not used to limit the scope of the present invention. Unless otherwise specified, the experimental methods used in the examples are conventional methods; the reagents and materials used can be obtained from commercial channels.

[0040] Example Construction of RNA interference vector of rice AL1 gene

[0041] Step 1: Design specific primers with homology arms and restriction sites for the target gene;

[0042] In this embodiment, primers are designed for rice gene AL1 (gene number LOC_Os03g31150), with a total of 4 primers, namely AL1A-F, AL1A-R, AL1B-F, and AL1B-R. The sequence of primer AL1A-F is shown in SEQ ID NO.6; the sequence of primer AL1A-R is shown in SEQ ID NO.7; the sequence of primer AL1B-F is shown in SEQ ID NO.8; and the sequence of primer AL1B-R is shown in SEQ ID NO.9.

[0043] SEQ ID NO.6: gggagggcgcgcctgcaggtaccgaccgtccgttcttctcagg

[0044] SEQ ID NO.7: cacgcgtacgtaaggttggatcccataggagacgcccaacctc

[0045] SEQ ID NO.8: aacaattcaattcagtggagctccataggagacgcccaacctc

[0046] SEQ ID NO.9: agcaggactctagaccccactagtgaccgtccgttcttctcagg

[0047] Step 2: Amplify the exogenous DNA fragment by PCR using the designed specific primers;

[0048] The DNA fragment A of the AL1 gene was amplified by PCR using primers AL1A-F and AL1A-R, and the DNA fragment B of the AL1 gene was amplified by PCR using primers AL1B-F and AL1B-R. The PCR products were detected by agarose gel electrophoresis and stored for future use.

[0049] Step 3: Use restriction enzymes Bam HI and Kpn Ⅰ Enzyme digestion of RNA interference empty vector;

[0050] The enzyme digestion system is: 3 μg of RNA interference empty vector, 5 μl of 10 × Buffer, Bam HI 1 μl, Kpn Ⅰ 1 μl, add ddH2O to 50 μl, and digest at 37℃ for 1 h.

[0051] Step 4: Using a homologous recombinase, the PCR product of step 2 and the empty vector digestion product of step 3 are homologously recombined to obtain a ligation product;

[0052] The recombinant system was as follows: 1 μl DNA fragment A of AL1 gene, 1 μl DNA fragment B of AL1 gene, 1 μl RNA interference empty vector digestion product, 2 μl 5×CE II Buffer, 1 μl Exnase® II, ddH2O to 10 μl, and reaction at 37℃ for 30 min.

[0053] Step 5: After the ligation product is transformed into Escherichia coli, it is cultured and the plasmid is extracted in sequence, and the positive RNA interference final vector is obtained by enzyme digestion verification.

[0054] The ligation product was transformed into Escherichia coli Trans1-T1.

[0055] Take 30 μL of E. coli competent cells (Trans1-T1 Phage Resistant Chemically Competent Cell) melted in an ice bath and add it to a 1.5 mL sterile centrifuge tube, then add 5 μL of the ligation product, mix gently, and place in an ice bath for 30 min.

[0056] Heat shock in a 42 ℃ water bath for 30 sec, then quickly transfer to ice and place for 2 min. Do not shake the centrifuge tube during this process.

[0057] Add 600 μL LB liquid culture medium (without antibiotics) to each centrifuge tube, mix well, and incubate at 37 °C and 180 r / min for 1 h to revive the E. coli.

[0058] Centrifuge at 6000 r / min for 30 sec, discard 400 μL supernatant, suspend the bacteria with the remaining 200 μL culture medium, transfer all the bacterial liquid to an LB culture dish containing kanamycin, spread it and dry it, mark it, and place it upside down in a 37 ℃ constant temperature incubator for overnight culture.

[0059] Shake culture.

[0060] Add 2 mL of kanamycin-resistant LB liquid culture medium to a sterilized 10 mL centrifuge tube, pick a single colony into the culture medium, place it in a shaker, and culture at 37 °C and 180 r / min for 12-16 h.

[0061] Plasmid restriction enzyme digestion detection.

[0062] Plasmid was extracted by alkaline lysis, restriction enzyme Bam H Ⅰ and Kpn Ⅰ Enzyme digestion plasmid detection, the enzyme digestion system is as follows:

[0063] Plasmid 500 ng

[0064] 10×Buffer 2 μL

[0065] Bam H Ⅰ 0.2 μL

[0066] Kpn Ⅰ 0.2 μL

[0067] ddH2O to 20 μL

[0068] The enzyme digestion was carried out at 37 °C for 30 min and the fragments were detected by 1.5% agarose gel electrophoresis.

[0069] The results of enzyme digestion are as follows Figure 3 As shown, the four plasmids all cut out exogenous fragments of the correct size, with a positive rate of 100%, and sequencing showed no mutation.

[0070] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

Claims

1. A method for constructing an efficient RNA interference vector, characterized in that: The RNA interference vector construction method comprises: Design specific primers with homology arms and restriction sites, amplify exogenous DNA fragment A and exogenous DNA fragment B using the specific primers, cut RNA interference empty vector with restriction endonucleases BamHI and KpnⅠ, connect exogenous DNA fragment A and exogenous DNA fragment B into RNA interference empty vector by homologous recombination to form RNA interference final vector; Among them, the sequence of the homologous arm and restriction site of the forward specific primer used to amplify the exogenous DNA fragment A is shown in SEQ ID NO.1, the sequence of the homologous arm and restriction site of the reverse specific primer is shown in SEQ ID NO.2, the sequence of the homologous arm and restriction site of the forward specific primer used to amplify the exogenous DNA fragment B is shown in SEQ ID NO.3, and the sequence of the homologous arm and restriction site of the reverse specific primer is shown in SEQ ID NO.4; The RNA interference empty vector has two ccdB gene expression cassettes, which are respectively located inside two multiple cloning sites of the RNA interference vector, and the ccdB gene can kill common Escherichia coli; The RNA interference empty vector sequence is shown in SEQ ID NO. 5; Except for the homology arms and restriction site sequences, the other sequences of the exogenous DNA fragment A and the exogenous DNA fragment B are reverse complementary sequences.

2. The use of the RNA interference vector construction method according to claim 1 in constructing an RNA interference vector, characterized in that: The following steps are involved: Step 1: Design specific primers with homology arms and restriction sites for the target gene; Step 2: using the designed specific primers to amplify the exogenous DNA fragments by PCR, the exogenous DNA fragments are exogenous DNA fragment A and exogenous DNA fragment B, and the exogenous DNA fragment A and the exogenous DNA fragment B, except for the homology arm and restriction site sequences, other sequences are reverse complementary sequences; Step 3: Use restriction endonucleases BamHI and KpnⅠ to digest the RNA interference empty vector; Step 4: Using a homologous recombinase, the PCR product of step 2 and the empty vector digestion product of step 3 are homologously recombined to obtain a ligation product; Step 5: The ligation product is transferred to Escherichia coli, cultured, and plasmids are extracted in sequence, and enzyme digestion is performed to verify the positive RNA interference final vector; The sequences of the homologous arms and restriction sites of the specific primers in step 1 are shown in SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3, and SEQ ID NO.4, respectively, wherein the sequences of the homologous arms and restriction sites of the forward specific primer used to amplify the exogenous DNA fragment A are shown in SEQ ID NO.1, the sequences of the homologous arms and restriction sites of the reverse specific primer are shown in SEQ ID NO.2, the sequences of the homologous arms and restriction sites of the forward specific primer used to amplify the exogenous DNA fragment B are shown in SEQ ID NO.3, and the sequences of the homologous arms and restriction sites of the reverse specific primer are shown in SEQ ID NO.4; In step 3, the amount of RNA interference empty vector digested was 3 μg, 50 μl reaction system, and digestion was carried out at 37 °C for 1 h. The homologous recombination reaction system in step 4 is: 1 μl exogenous DNA fragment A, 1 μl exogenous DNA fragment B, 1 μl RNA interference empty vector digestion product, 2 μl 5×CE II Buffer, 1 μl Exnase II, ddH2O to 10 μl, and react at 37°C for 30 min.

Images