A circular RNA circTCONS and its application

Abstract

The present invention belongs to the field of biomedicine technology, and discloses a circular RNA circTCONS and its application. The circular RNA circTCONS of the present invention is highly expressed in triple-negative breast cancer of different genetic subtypes, and circTCONS directly intervenes in the folding of cytoskeletal proteins to affect the metastasis of triple-negative breast cancer, and can be used as a diagnostic and prognostic marker for triple-negative breast cancer, making up for the shortcomings of IHC and genetic testing, with good universality, and can be detected in all triple-negative breast cancer patients; the diagnostic and prognostic marker circTCONS of the present invention has good circularity, good in vivo and in vitro stability, and can be identified and detected in both in vivo and in vitro tissues.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine technology, and in particular to a circular RNA circTCONS and applications thereof. Background Art

[0002] The incidence of breast cancer has been increasing year by year, and it has become the first cancer in terms of incidence and mortality among female malignant tumors, seriously endangering women's health. Triple negative breast cancer (TNBC) is a type of breast cancer that is negative for estrogen receptors, progesterone receptors, and human epidermal growth factor receptor 2. As the subtype with the worst prognosis, it accounts for about 15% of breast cancers, of which about 30%-40% of patients develop malignant consequences such as metastasis during the follow-up period. Because triple negative breast cancer lacks effective therapeutic targets and has limited treatment options, it has the worst prognosis compared to other types of breast cancer.

[0003] TNBC is divided into six subtypes, immunomodulatory (IM), luminal androgen receptor (LAR), basal-like 1 (BL-1), basal-like 2 (BL-2), mesenchymal (M), and mesenchymal stem cell-like (MSL). These types are classified according to their gene expression combinations. PAM50 gene intrinsic subtype analysis showed that 1.6% of TNBC were luminal A, 3.2% were luminal B, 9.1% were HER2 overexpressed, and only 86.1% were BLBC. More and more studies are focusing on IHC alternative factors, such as CK5 / 6 or CK17CK5 / 6 or P-cadherin (cadherin), CK5 / 6 or CK14 all indicate basal differentiation, and different factors have different degrees of accuracy. EGFR and CKIT are also associated with BLBC. Other markers such as p63, smooth muscle actin (SMA), caveolin, and cyclin E are also increasingly being proposed. Although these factors are not included in the latest American Society of Clinical Oncology (ASCO) guidelines, they play an important role in auxiliary classification, prognosis assessment, and treatment.

[0004] Liquid biopsy based on blood samples is a type of non-invasive diagnostic method that analyzes the presence of circulating tumor cells (CTCs) and circulating tumor nucleic acids (ctNA), including circulating tumor DNA (ctDNA) and microRNA (miRNA) in blood specimens. The ctDNA found in the blood of cancer patients usually comes from primary tumors, CTCs, and apoptotic and necrotic cells during tumor development and progression. The content of tumor ctDNA in the blood depends on the size of the primary lesion or metastasis, so the content of ctDNA can reflect the size of the tumor load. However, CTC and ctDNA have a short half-life, poor stability, short mature and stable expression time, and are difficult to extract from in vitro specimens. In addition, many clinical studies using ctDNA as a diagnostic or prognostic marker have not obtained positive results, and its accuracy and reliability remain to be discussed.

[0005] Therefore, there is an urgent need to develop accurate, efficient, low-cost and highly universal markers for early diagnosis and efficacy prediction of triple-negative breast cancer, so as to be used for early diagnosis and prognostic risk assessment of clinical triple-negative breast cancer. Summary of the invention

[0006] The purpose of the present invention is to overcome the shortcomings of the prior art and provide a circular RNA circTCONS and its application.

[0007] To achieve the above purpose, the technical solution adopted by the present invention is as follows:

[0008] In a first aspect, the present invention provides a circular RNA for evaluating the prognosis of triple-negative breast cancer, wherein the RNA is circular RNA circTCONS.

[0009] The circular RNA circTCONS of the present invention is highly expressed in triple-negative breast cancer of different genetic subtypes. circTCONS directly intervenes in the folding of cytoskeletal proteins and affects the metastasis of triple-negative breast cancer. It can be used as a diagnostic and prognostic marker for triple-negative breast cancer, which makes up for the shortcomings of IHC and genetic testing. It has good universality and can be detected in all triple-negative breast cancer patients. The diagnostic and prognostic marker circTCONS of the present invention has good circularity and good in vivo and in vitro stability, and can be identified and detected in both in vivo and in vitro tissues.

[0010] As a preferred embodiment of the circular RNA for evaluating the prognosis of triple-negative breast cancer according to the present invention, the nucleotide sequence of the circular RNA circTCONS is shown in SEQ ID NO:1.

[0011] In a second aspect, the present invention uses a marker for identifying the circular RNA in the preparation of a reagent for diagnosing and treating triple-negative breast cancer, and the marker includes but is not limited to:

[0012] (1) a primer / primer set that binds to the circular RNA or a fluorescently labeled primer / primer set that binds to the circular RNA;

[0013] (2) a small molecule compound that binds to the circular RNA;

[0014] (3) A biological macromolecule that binds to the circular RNA, wherein the biological macromolecule includes but is not limited to: an antibody or an antibody functional fragment, a fluorescently labeled antibody or an antibody functional fragment, an RNA binding protein or a functional fragment thereof, a fluorescently labeled RNA binding protein or a functional fragment thereof.

[0015] In a third aspect, the present invention uses a marker for identifying the circular RNA in the preparation of a product for evaluating the prognosis of triple-negative breast cancer, and the marker includes but is not limited to:

[0016] (1) a primer / primer set that binds to the circular RNA or a fluorescently labeled primer / primer set that binds to the circular RNA;

[0017] (2) a small molecule compound that binds to the circular RNA;

[0018] (3) A biological macromolecule that binds to the circular RNA, wherein the biological macromolecule includes but is not limited to: an antibody or an antibody functional fragment, a fluorescently labeled antibody or an antibody functional fragment, an RNA binding protein or a functional fragment thereof, a fluorescently labeled RNA binding protein or a functional fragment thereof.

[0019] In a fourth aspect, the present invention provides a reagent or kit for evaluating the prognosis of triple-negative breast cancer, characterized in that it comprises the marker.

[0020] In a fifth aspect, the present invention uses the circular RNA in the preparation of a reagent for diagnosing triple-negative breast cancer, and the reagent is used to identify the circular RNA.

[0021] In a sixth aspect, the present invention uses the circular RNA in the preparation of a drug for treating triple-negative breast cancer, and the drug is used to silence or knock out the circular RNA.

[0022] In a seventh aspect, the present invention uses the circular RNA in the preparation of an evaluation reagent for screening and judging the prognosis of triple-negative breast cancer.

[0023] Compared with the prior art, the present invention has the following beneficial effects:

[0024] The circular RNA circTCONS of the present invention is highly expressed in triple-negative breast cancer of different genetic subtypes. circTCONS directly intervenes in the folding of cytoskeletal proteins and affects the metastasis of triple-negative breast cancer. It can be used as a diagnostic and prognostic marker for triple-negative breast cancer, making up for the shortcomings of IHC and genetic testing, with good universality, and can be detected in all triple-negative breast cancer patients; the diagnostic and prognostic marker circTCONS of the present invention has good circularity, good in vivo and in vitro stability, and can be identified and detected in both in vivo and in vitro tissues. The present invention solves the problem of the lack of accurate, efficient, low-cost and highly universal early diagnosis and efficacy prediction markers for triple-negative breast cancer. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 It is a flow chart of the technical solution of the present invention;

[0026] Figure 2 is the expression level of CircTCONS in triple-negative breast cancer cell lines;

[0027] Figure 3 is the expression level of circ58040 in triple-negative breast cancer cell lines;

[0028] Figure 4 is the expression level of circ1055 in triple-negative breast cancer cell lines;

[0029] Figure 5 RNase R digestion test for CircTCONS;

[0030] Figure 6 CircTCONS circular nucleic acid electrophoresis test;

[0031] Figure 7 Validate the circular interface position for CircTCONSsange sequencing;

[0032] Figure 8 For the CircTCONS nuclear-cytoplasmic separation experiment;

[0033] Fig. 9 FISH experiment for CircTCONS;

[0034] Fig.10 For CircTCONS functional phenotype experiments - invasion and migration;

[0035] Fig.11 Identify circTCONS binding proteins for pull-down;

[0036] Fig.12 Identification of circTCONS binding to DBN1 protein by RIP and CLIP;

[0037] Fig.13 The morphology of the cytoskeleton in the field of view of the NC group was normal;

[0038] Fig.14 The cytoskeleton in the field of view of the si-circRNA group was deformed, and the normal morphology of tumor cells was changed;

[0039] Fig.15 It is circ-RNA that interferes with F-actin, β-actin and EMT indicators;

[0040] Fig.16 The morphology and structure of β-actin in the NC group were normal; staining in the figure: F-actin, β-actin, DAPI;

[0041] Fig.17 The morphology and structure of β-actin in the Si-circRNA group are abnormal; staining in the figure: F-actin, β-actin, DAPI;

[0042] Fig.18 For the CircTCONS paraffin section in situ hybridization experiment; Fig.18 A and B: Tissue sections of patients with high circTCONS expression; C: Tissue sections of patients who did not achieve pathological complete remission after neoadjuvant therapy showed that circTCONS expression became lower; D: Tissue sections of patients with pathological complete remission after neoadjuvant therapy showed no circTCONS expression; E: There were differences in circTCONS expression in triple-negative breast cancer, among which there were more patients with relatively high circTCONS expression. DETAILED DESCRIPTION

[0043] To better illustrate the purpose, technical solutions and advantages of the present invention, the present invention will be further described below in conjunction with specific embodiments. It should be understood by those skilled in the art that the specific embodiments described herein are only used to explain the present invention and are not intended to limit the present invention.

[0044] Unless otherwise specified, the experimental methods used in the examples, such as RNA extraction, reverse transcription and qPCR experiments, Western Blot experiments, multiple fluorescence in situ hybridization (FISH) experiments, RAN pull-down experiments, RIP experiments (RNA Binding Protein Immunoprecipitation, RNA binding protein immunoprecipitation), etc., are all conventional methods or are performed using conventional kits; the materials, reagents, etc. used, unless otherwise specified, can be obtained from commercial channels.

[0045] Example 1: Screening of diagnostic and prognostic markers

[0046] Two GEO circRNA sequencing datasets were included, including GEO1: GSE111504, which included the parental MDA-MB-231 strain of triple-negative breast cancer cells, brain metastasis strains, lung metastasis strains, and bone metastasis strains, and the whole genome sequencing platform was Arraystar Human circRNA Array v2; GEO2: GSE113230 included three pairs of triple-negative breast cancer cells and adjacent cells, and the whole genome sequencing platform was HiSeq3000, Illumina.

[0047] We screened highly metastatic circRNAs in GSE111504, and screened highly expressed circRNAs in breast cancer in GSE113230. We took the intersection of the two highly expressed subsets, and found that three circRNAs were expressed in both subsets, including Has_circ_0006455 (circ TCONS), Has_circ_0058040, and Has_circ_0001055.

[0048] Breast cancer cell lines, including 10A, MDA-MB-231, MDA-MB-468, BT-549, BT-474, SKBR3 and tool cell HEK-293T, were purchased from the ATCC official website. Each cell line was cultured, and cell RNA was extracted. The cDNA of each cell line was obtained by reverse transcription and RT-qPCR was performed to identify the expression of the three circRNAs screened in triple-negative breast cancer. Multiple triple-negative breast cancer cell lines were used to identify whether the expression of Has_circ_0006455 (circ TCONS), Has_circ_0058040, and Has_circ_0001055 in triple-negative breast cancer was uniform, such as Figure 2 As shown: Circ TCONS is more highly expressed in triple-negative breast cancer cell lines; Figure 3 As shown: The expression level of Has_circ_0058040 in triple-negative breast cancer cell lines is extremely low; Figure 4 The expression levels of Has_circ_0001055 in triple-negative breast cancer cell lines are inconsistent.

[0049] The primer sequences used are:

[0050] Has_circ_0006455(circ TCONS):

[0051] Forward primer:TCTGCCAGTTGATGTCATGCT;

[0052] Reverse primer: TGGTTCTGCATCCTTTGGTGT.

[0053] hsa_circ_0058040:

[0054] Forward primer: TGGGCAGATTTCTGGACTTCA;

[0055] Reverse primer:TTTGTTCCCTGGCTCACGA.

[0056] hsa_circ_0001055:

[0057] Forward primer: ACCAGCCCTCGTCTATCTGT;

[0058] Reverse primer: CCTGAGAGAGCCCTGTTGTG.

[0059] GAPDH:

[0060] Forward primer: GGACCTGACCTGCCGTCTAG;

[0061] Reverse primer: GTAGCCCAGGATGCCCTTGA.

[0062] By comparing tool cells, normal breast cells 10A, triple-negative breast cancer cell lines, and luminal breast cancer cell lines, it was found that only CircTCONS had a higher expression level in triple-negative breast cancer cell lines, and the expression level in triple-negative breast cancer cell lines was relatively uniform.

[0063] Example 2: Identification of circular RNA CircTCONS properties

[0064] (1) Identification of circular properties of circular RNA CircTCONS

[0065] RNA samples extracted from MDA-MB-231 cells were digested at 37°C for 10 min using 3U RNaseR / μg. The digested RNA was extracted with phenol:chloroform:isoamyl alcohol (volume ratio 25:24:1) and recovered by ethanol precipitation. The recovered RNA was reverse transcribed and RT-qPCR was performed to analyze the ratio of linear RNA and circular RNA.

[0066] By RNase R digestion test, such as Figure 5 As shown: The circular structure of CircTCONS is more stable, and it was found that linear RNA was eliminated, while CircTCONS was not eliminated because it had a more stable circular structure, verifying its circular structure.

[0067] (2) Identification of circular RNA CircTCONS

[0068] RNA samples of MDA-MB-231 cells were extracted and reverse transcribed to obtain cDNA samples. The gDNA samples of MDA-MB-231 cells were directly extracted using the TIANGEN brand gDNA extraction kit, and trans-loop primers and reverse shearing primers were designed. The cDNA and gDNA samples were amplified by RT-qPCR using the RT-qPCR method, and the amplified products were subjected to nucleic acid electrophoresis. Figure 6 As shown: Trans-circular primers can guide CircTCONS to form a circle, verifying the possibility of CircTCONS forming a circle.

[0069] Trans-loop primer sequences:

[0070] Forward primer:TCTGCCAGTTGATGTCATGCT;

[0071] Reverse primer: TGGTTCTGCATCCTTTGGTGT.

[0072] Anti-cleavage primer sequence:

[0073] Forward primer: AGGGACAGAAATGGATGGACT;

[0074] Reverse primer: CCTGGTTCTGCATCCTTTGG.

[0075] (3) Circular RNA CircTCONS circular structure

[0076] The gene sequence of CircTCONS was obtained from a public database. The gene sequence (such as SEQ ID NO: 1) is:

[0077] GCTTAATACTTAGAAAGTGCTAGAGCAGCCTCTATTAGGGGATCTCTCTCTGATTGTACTCCACTTGCTGTAACACCAAAGGATGCAGAACCAGGTTCTGTAGCAGAAATTGCTGGTGTCTGTGGCAGGGGAGGG CACCTGAGGACAGGGAAGAAGAAACATATTTTTATCTTTATGGAGCAGCACATTGTTCCCAAATACCTTCTGCTTTAAGGGACAGAAATGGATGGACTTTTTCTGTCTTTTCTGCCAGTTGATGTCATGCTTGCAG;

[0078] Length: 272 nt; located at chr19:20327948-20331226strand:-; CircTCONS circular interface sequencing, see Figure 7 CircTCONS ring interface site.

[0079] (4) CircTCONS localization and identification

[0080] MDA-MB-231 cells were subjected to nuclear-cytoplasmic separation and CircTCONS probe FISH experiments, such as Figure 8 After nuclear-cytoplasmic separation, CircTCONS was highly expressed in the cytoplasm and Fig. 9 As shown: CircTCONS is highly expressed in the cytoplasm, so circTCONS was identified to be mainly localized in the cytoplasm, see Figure 8 and Fig. 9 .

[0081] In summary, CircTCONS is a highly expressed, cytoplasmic, and very stable circular RNA in triple-negative breast cancer.

[0082] Example 3: CircTCONS promotes tumor invasion and migration

[0083] siRNA transfection experiment:

[0084] Inoculate 6-well plates, with 3-4*10^4 cells in each well, and transfect after 12 hours of complete culture medium; each well requires 500ul transfection solution. Among them, A solution: Opti-MEM 250ul, lipo3000 3ul, mix well and let it stand for 5 minutes, B solution: Opti-MEM 250ul, siRNA3ul, mix well and let it stand for 5 minutes, A solution and B solution are mixed and let it stand for 15 minutes; aspirate the complete culture medium, add 500ul transfection solution and 1.5ml serum-free culture medium to each well; change the medium after 6-8 hours, aspirate the liquid, and add 2ml complete culture medium without double antibodies to each well.

[0085] Example 1 shows that CircTCONS is highly expressed in the triple-negative breast cancer cell line MDA-MB-231. By interfering with the expression of circTCONS by siRNA, the functional phenotype differences between the normal group and the interference group were analyzed. It was found that after interfering with CircTCONS, the invasion and migration functions of MDA-MB-231 cells were weakened. Fig.10 As shown: CircTCONS affects tumor cell invasion and migration, proving that CircTCONS promotes tumor metastasis.

[0086] SiRNA sequences:

[0087] SiRNA-1:

[0088] Sense(5'-3'):AUGUCAUGCUUGCAGGCUUAATT;

[0089] Antisense(5'-3'):UUAAGCCUGCAAGCAUGACAUTT.

[0090] SiRNA-2:

[0091] Sense(5'-3'):GAUGUCAUGCUUGCAGGCUUATT;

[0092] Antisense(5'-3'):UAAGCCUGCAAGCAUGACAUCTT.

[0093] Example 4: Mechanism of action of CircTCONS

[0094] 1. RAN pull-down experiment

[0095] Harvest MDA-MB-231 cells by centrifugation at 1000g for 5 min at 4℃ in 2 large dishes, and discard the supernatant. Resuspend the pellet with 1ml ice-cold PBS and centrifuge at 1000g for 5min at 4℃. Resuspend the pellet with 2ml Cell lysis buffer (fresh protease inhibitors, RNAse inhibitors, phosphatase inhibitors) and place on ice for 30min, inverting and mixing several times. Centrifuge at 13000g for 35min at 4℃. For the negative control group (using the control probe) and the target group (using the circTCONS probe), take 250μl streptavidin agarose beads from each group, wash the beads with buffer A, and remove the stock solution (using the Thermo Fisher RNA pull-down kit). Prepare precleared cell lysate: Incubate each group of cell lysates with 250μl streptavidin agarose beads at 4℃ for 30min with rotation. Centrifuge at 2500rpm for 30s, retain the supernatant, and add 1 volume of buffer A. Add 3 μg of biotin-labeled RNA to precleared cell lysate. Incubate at 4°C for 1 hour in a rotary shaker. Purify proteins bound to biotin-labeled RNA: add 30 μl of washed streptavidin agarose beads and incubate at 4°C overnight. Wash five times with buffer A, remove the supernatant, elute the protein, add 1*loading buffer to each protein sample and boil at 98 degrees for 5 minutes. Perform silver staining on the protein samples after Western Blot experiment, and perform mass spectrometry detection on the differential bands.

[0096] Protein mass spectrometry was performed after RNA pull-down experiments and found that Fig.11 Shown: Mass spectrometry identification of circTCONS-binding proteins captured by the pull-down experiment, among which those that matched the size of the target proteins were mainly HSP90AB1, DBN1, and EWSR1 proteins.

[0097] 2. RIP experiment (RNA Binding Protein Immunoprecipitation) and CLIP experiment (crosslinking-immunprecipitation)

[0098] (1) RIP experiment

[0099] 1) Obtain cell lysate:

[0100] Wash the cells in the culture dish or culture flask twice with cold PBS, add cold PBS and scrape the cells with a cell scraper, collect them into EP tubes, centrifuge at 1000rpm, 4℃ for 5min, discard the supernatant, collect the cells, resuspend the cells with an equal volume of RIP lysis buffer, pipet evenly and let stand on ice for 5min.

[0101] 2) Preparation of magnetic beads-antibodies

[0102] Resuspend the magnetic beads, pipette 50 μl of the resuspended magnetic bead suspension into each EP tube, add 500 μl RIP Wash Buffer to each tube, vortex and shake, place the EP tube on the magnetic rack, remove the supernatant, and repeat once; resuspend the magnetic beads with 100 μl RIP Wash Buffer, incubate at room temperature for 30 min, place the EP tube on the magnetic rack, and discard the supernatant; add 500 μl RIP Wash Buffer, vortex and shake, and discard the supernatant, repeat once; add 500 μl RIP Wash Buffer, vortex and shake, and place on ice.

[0103] 3) RNA binding protein immunoprecipitation

[0104] Place the EP tube on the magnetic rack, remove the supernatant, add 900ul RIP, Immunoprecipitation Buffer to each tube, mix 100μl cell lysate in the magnetic bead-antibody complex to make a total volume of 1ml, incubate at 4℃ for 3h to overnight, centrifuge briefly, place the EP tube on the magnetic rack, remove the supernatant, add 500μl RIP Wash Buffer, vortex and place the EP tube on the magnetic rack, remove the supernatant, and repeat washing 6 times.

[0105] 4) RNA purification

[0106] Resuspend the magnetic bead-antibody complex in 150ul Proteinase K Buffer and incubate at 55℃ for 30min. After incubation, place the EP tube on a magnetic rack, transfer the supernatant to a new EP tube, add 250μl RIP WashBuffer to the supernatant in each tube, add 400μl phenol:chloroform:isoamyl alcohol to each tube, vortex and centrifuge at 14,000rpm at room temperature for 10min, carefully pipette 350μl upper aqueous phase into a new EP tube, add 400μl chloroform to each tube, vortex and centrifuge at 14,000rpm at room temperature for 10min, pipette 300μl upper aqueous phase into a new EP tube, add 50μl Salt SolutionⅠ, 15μl SaltSolutionⅡ, 5μl Precipitate to each tube Enhancer, 850μl anhydrous ethanol (RNase-free), mix, -80℃ overnight, centrifuge at 14,000rpm, 4℃ for 30min, discard the supernatant, rinse once with 80% ethanol, centrifuge at 14,000rpm, 4℃ for 15min, discard the supernatant, dry, dissolve in 10-20μl DEPC water, and store at -80℃.

[0107] 5) Perform reverse transcription and RT-qPCR experiments on each group of RNA samples and analyze the results.

[0108] (2) CLIP experiment

[0109] 1) UV cross-linking:

[0110] Remove the culture medium and wash once with pre-cooled 1× PBS, then remove the PBS; place the cells on ice and place them under a 365nm UV lamp for cross-linking for 10 minutes;

[0111] 2) Obtain cell lysate:

[0112] Wash the cells in the culture dish or culture bottle twice with cold PBS, add cold PBS and scrape the cells with a cell scraper, collect them into EP tubes, centrifuge at 1000rpm, 4℃ for 5min, discard the supernatant, collect the cells, resuspend the cells with an equal volume of CLIP lysis buffer, pipet evenly and let stand on ice for 5min.

[0113] 3) Preparation of magnetic beads-antibodies

[0114] Resuspend the magnetic beads, pipette 50 μl of the resuspended magnetic bead suspension into each EP tube, add 500 μl RIP Wash Buffer to each tube, vortex and shake, place the EP tube on the magnetic rack, remove the supernatant, and repeat once; resuspend the magnetic beads with 100 μl RIP Wash Buffer, incubate at room temperature for 30 min, place the EP tube on the magnetic rack, and discard the supernatant; add 500 μl RIP Wash Buffer, vortex and shake, and discard the supernatant, repeat once; add 500 μl RIP Wash Buffer, vortex and shake, and place on ice.

[0115] 4) RNA binding protein immunoprecipitation

[0116] Place the EP tube on the magnetic rack, remove the supernatant, add 900ul RIP, Immunoprecipitation Buffer to each tube, mix 100μl cell lysate in the magnetic bead-antibody complex to make a total volume of 1ml, incubate at 4℃ for 3h to overnight, centrifuge briefly, place the EP tube on the magnetic rack, remove the supernatant, add 500μl CLIP Wash Buffer, vortex and place the EP tube on the magnetic rack, remove the supernatant, and repeat washing 6 times.

[0117] 5) RNA purification

[0118] Resuspend the magnetic bead-antibody complex in 150ul Proteinase K Buffer and incubate at 55℃ for 30min. After incubation, place the EP tube on a magnetic rack, transfer the supernatant to a new EP tube, add 250μl RIP WashBuffer to the supernatant in each tube, add 400μl phenol:chloroform:isoamyl alcohol to each tube, vortex and centrifuge at 14,000rpm at room temperature for 10min, carefully pipette 350μl upper aqueous phase into a new EP tube, add 400μl chloroform to each tube, vortex and centrifuge at 14,000rpm at room temperature for 10min, pipette 300μl upper aqueous phase into a new EP tube, add 50μl Salt SolutionⅠ, 15μl SaltSolutionⅡ, 5μl Precipitate to each tube Enhancer, 850μl anhydrous ethanol (RNase-free), mix, -80℃ overnight, centrifuge at 14,000rpm, 4℃ for 30min, discard the supernatant, rinse once with 80% ethanol, centrifuge at 14,000rpm, 4℃ for 15min, discard the supernatant, dry, dissolve in 10-20μl DEPC water, and store at -80℃.

[0119] 6) Perform reverse transcription and RT-qPCR experiments on each group of RNA samples and analyze the results.

[0120] like Fig.12 As shown: RIP and CLIP results showed that compared with the IgG group, circTCONS bound more tightly to DBN1 protein and bound more weakly to HSP90AB1 and EWSR1 proteins.

[0121] It can be seen that CircTCONS can bind to the atypical skeleton protein DBN1. The binding of CircTCONS to DBN1 was verified by RIP and CLIP experiments, and the invasion and migration function of tumor cells was affected by interfering with skeleton proteins.

[0122] 3. circTCONS binds to the non-classical skeleton protein DBN1, affecting the structure and arrangement of actin. An NC negative control group and a SiRNA-1 group were set up. After treating MDA-MB-231 cells with SiRNA-1, the cells were seeded into a confocal glass-bottomed dish. The classic skeleton protein F-actin was stained with phalloidin, which appeared red under a confocal microscope. The cell nucleus was stained with DAPI, which appeared blue under a confocal microscope. The continuity and integrity of the skeleton protein morphology of the two groups of cells were observed and compared. Fig.13 As shown: In the NC group, the cytoskeleton morphology in the field of view is normal, and the color of phalloidin at the cell membrane is uniform and continuous, that is, the cytoskeleton F-actin connectivity and integrity are good; Fig.14 As shown in the si-circTCONS group, the cytoskeleton in the field of view was deformed, and the tumor cells MDA-MB-231 lost their normal morphology after knocking down circTCONS.

[0123] It can be seen that circTCONS directly binds to the non-classical skeleton protein DBN1. Interference with circTCONS revealed that the cytoskeletal structure of MDA-MB-231 cells was disordered, the classical actin arrangement was broken, and the continuity was lost.

[0124] 4. Effects of circTCONS and DBN1 on F-actin skeleton folding

[0125] A NC negative control group, siRNA-1 group and siRNA-2 group were set up. After MDA-MB-231 cells were treated with siRNA-1 and siRNA-2 for 48 hours, the protein solution was extracted, and the expression levels of actin F-actin and β-actin proteins, and the expression level of microtubule protein β-tublin in the three groups of cells were verified by WB experiments, and the changes in the cytoskeleton after knocking down circTCONS were evaluated; at the same time, the expression levels of EMT key proteins Vimtin and E-cad were verified, and the changes in cell invasion and migration abilities after knocking down circTCONS were evaluated.

[0126] like Fig.15As shown: After circ-RNA intervention, F-actin decreased, β-actin increased, and the expression of EMT-related proteins Vimtin and E-cad was weakened after circ-RNA intervention.

[0127] It can be seen that circTCONS and DBN 1 affect tumor cell migration by interfering with the folding of the F-actin skeleton. After interfering with circTCONS, the cytoskeleton protein monomer β-actin increased and F-actin decreased, which means that the mature and correctly folded skeleton protein decreased after interfering with circ-RNA; at the same time, the expression of EMT-related proteins was weakened after interfering with circ-RNA, which means that the cell invasion and migration ability was weakened.

[0128] Confocal imaging was used to observe the changes of F-actin and β-actin after intervention with circTCONS. Fig.16 and Fig.17 After knocking down circTCONS, the continuity of F-actin changed, with multiple breaks visible, and β-actin monomers aggregated and lost their normal arrangement, which means that β-actin monomers aggregated and the folding transformation process of β-actin to F-actin was blocked.

[0129] Example 6: Effect of CircTCONS on the diagnosis and prognosis of triple-negative breast cancer

[0130] 1. CircTCONS paraffin section in situ hybridization experiment:

[0131] (1) Preparation of buffer solution

[0132] 3% citric acid: Add 3g of citric acid (C6H8O7·H2O) to 100mL of distilled water, pH about 2.0.

[0133] 2×SSC: Add 17.6 g of sodium chloride and 8.8 g of trisodium citrate (C6H5O7Na3·2H2O, molecular weight 294) to 1000 mL of distilled water.

[0134] 0.5×SSC: add 100mL 2×SSC to 300mL distilled water.

[0135] 0.2×SSC: Add 30mL 2×SSC to 270mL distilled water.

[0136] 20% glycerol: add 20ml glycerol to 80ml distilled water.

[0137] PBS for in situ hybridization: 1000 ml of distilled water plus 30 g of sodium chloride, 6 g of Na2HPO4·12H2O, and 0.4 g of NaH2PO4·2H2O, pH 7.2-7.6.

[0138] 0.01M TBS: Add 8.5g sodium chloride, 1.2g Tris, and 0.45-0.5ml pure acetic acid to 1000ml distilled water and adjust the pH to 7.2-7.6.

[0139] (2) Paraffin sections were routinely dewaxed to water

[0140] Immerse the paraffin sections in xylene for 5 minutes twice to fully dewax; immerse the paraffin sections in 95% ethanol, 75% ethanol, and 50% ethanol for 5 minutes each to fully dehydrate; wash the paraffin sections with PBS 3 times, 3 minutes each time to fully wash.

[0141] (3) Exposure of nucleic acid fragments

[0142] Add 3% citric acid freshly diluted pepsin (1 mL 3% citric acid plus 2 drops of concentrated pepsin, mix well) to the slices and digest at 37°C or room temperature for 15 min. Wash 3 times with 0.5M PBS for 5 min. Wash once with distilled water.

[0143] (4) Fixation: Fix after pepsin digestion. The fixative is 4% paraformaldehyde containing 1 / 1000 DEPC. Fix at room temperature for 5 minutes. Wash with distilled water 3 times.

[0144] (5) Pre-hybridization: Preparation of wet box - Add 20% glycerol to the bottom of the dry hybridization box to maintain humidity. Add 20 μL of pre-hybridization solution to each section. Incubate at 40°C for 2 hours. Aspirate excess liquid without washing.

[0145] (6) Hybridization: Add 20 μL of hybridization solution to each slice. Remove the protective film of the cover glass for in situ hybridization and cover the slice to prevent the slice from drying out during the hybridization process. Hybridize overnight in a constant temperature oven at 40°C.

[0146] (7) Post-hybridization washing: remove the coverslip and wash with 2×SSC at 37°C for 5 min twice; wash with 0.5×SSC at 37°C for 15 min once; wash with 0.2×SSC at 37°C for 15 min once (if there is non-specific staining, repeat the wash with 0.2×SSC for 15 min 1-2 times).

[0147] (8) Add blocking solution: 37℃ for 30 min. Shake off excess liquid and do not wash.

[0148] (9) Add biotinylated mouse anti-digoxigenin: 120 min at room temperature. Wash with PBS for in situ hybridization for 5 min x 4 times.

[0149] (10) Add SABC-AP dropwise: 37°C for 30 min. Wash with 0.01 M TBS for 5 min x 4 times.

[0150] (11) BCIP / NBT color development: Dilute BCIP / NBT (×20) with 0.01M TBS (pH 9.2) at a ratio of 1:20 and mix well. Add the color development solution to the specimen. Incubate at 37°C for 30 min. Wash thoroughly with water.

[0151] (12) If necessary, re-stain with Nuclear Fast Red for 5-15 minutes and wash with water.

[0152] (13) After natural drying, the slides were sealed with neutral resin and photographed.

[0153] 2. Quantitative analysis of in situ hybridization results using Image J

[0154] (1) Import the in situ hybridization images into Image J;

[0155] (2) Adjust Image J parameters: Change Type to RGB Stack; Image-Adjust-Threshold automatically selects the positive cell area and adjusts the brown area to match the red area in Image J; Analyze-Set measurements, check Diaplay Label and Area Fraction; Analyze-Measure; record %Area data as the quantitative analysis result, evaluate the expression level of circTCONS, and divide it into two groups: relatively high expression group and relatively low expression group.

[0156] 3. Statistical analysis and drawing with Graphpad

[0157] (1) Import the %Area data of the high expression group and the low expression group obtained by quantitative analysis with Image J into Graphpad to draw pictures;

[0158] (2) The paired t-test was used to compare the two groups of data, two-tailed P value, P < 0.01, there was a significant difference between the two groups, with more patients in the relatively high expression group.

[0159] Paraffin sections of 46 patients with early triple-negative breast cancer were collected. The expression of circTCONS in patients with triple-negative breast cancer was evaluated by circRNA fluorescence in situ hybridization experiment. It was found that the expression level of circTCONS in triple-negative breast cancer was higher. Fig.18 , 30 patients had relatively high expression levels, 16 patients had relatively low expression levels, and 46 patients had higher circTCONS expression levels than their adjacent tissues, indicating a poor prognosis. In addition, in patients with early triple-negative breast cancer, the expression of circTCONS in patients with pathological complete remission after classic neoadjuvant therapy (paclitaxel combined with anthracycline or paclitaxel combined with platinum) was significantly reduced.

[0160] Finally, it should be noted that the above embodiments are only used to illustrate the technical solution of the present invention rather than to limit the scope of protection of the present invention. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that the technical solution of the present invention can be modified or replaced by equivalents without departing from the essence and scope of the technical solution of the present invention.

Claims

1. The use of circular RNA in the preparation of a reagent for diagnosing triple-negative breast cancer, characterized in that: The reagent is used to identify the circular RNA; the nucleotide sequence of the circular RNA is shown in SEQ ID NO:1.

Images