Gene fragment, vector and recombinant bacteria for interfering with AcINH3 expression and method for silencing AcINH3 expression to promote sugar accumulation in pineapple

Abstract

The present invention relates to the field of gene engineering technology, and in particular to a gene fragment, a vector and a recombinant bacterium that interfere with the expression of AcINH3, and a method for silencing the expression of AcINH3 to promote the sugar accumulation of pineapple. The gene fragment is shown in SEQ ID NO: 4, and has a length of 400 bp. The gene fragment can interfere with the expression of AcINH3, promote the sugar accumulation of pineapple fruit, and clarify that AcINH3 is related to the sugar accumulation of pineapple fruit. It provides a basis for rapid and efficient transient gene expression, and also provides a basis for the research of high-sugar pineapple germplasm.

Description

Technical Field

[0001] The invention relates to the technical field of genetic engineering, and in particular to a gene fragment, a vector and a recombinant bacterium for interfering with the expression of AcINH3, and a method for silencing the expression of AcINH3 to promote the accumulation of sugar in pineapple. Background Art

[0002] In the past, pineapples were mainly processed for canning. During the process of artificial selection and breeding, yield and resistance closely related to yield have always been the primary goals, while flavor quality traits are often neglected, and even yield is sacrificed at the cost of flavor quality, resulting in the loss of some gene loci related to flavor quality and the degradation of flavor quality traits.

[0003] The sugar composition and content of the fruit are important components of the fruit flavor quality. With the help of modern molecular biological techniques, exploring the key genes of sugar quality traits and analyzing the regulation mechanism of sugar metabolism are not only hot topics in flavor quality biology research, but also important links and components of modern breeding. However, the molecular regulatory mechanism of pineapple sugar quality formation is still unclear, and the sucrose metabolism in pineapple fruit and its related regulatory genes need to be studied and utilized urgently.

[0004] Based on this, the present invention is proposed. Summary of the invention

[0005] The object of the present invention is to provide a rapid and efficient method for verifying transient gene expression, and in particular to a gene fragment, a vector and a recombinant bacterium for interfering with AcINH3 expression, and a method for silencing AcINH3 expression to promote sugar accumulation in pineapple.

[0006] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0007] The present invention provides a gene fragment for interfering with the expression of AcINH3, and the gene fragment is shown as SEQ ID NO:4.

[0008] The present invention also provides the application of the gene fragment in silencing AcINH3 expression and promoting sugar accumulation in pineapple fruit.

[0009] The invention also provides application of the gene fragment in pineapple genetic breeding.

[0010] The present invention also provides a primer pair for amplifying the gene fragment, and the primer pair is shown in SEQ ID NO: 2-3.

[0011] The present invention also provides the use of the primer pair in preparing a product for silencing AcINH3 expression and promoting sugar accumulation in pineapple fruit and / or in preparing a product for pineapple genetic breeding.

[0012] The present invention also provides a vector for interfering with the expression of AcINH3, comprising the gene fragment and an empty vector;

[0013] The empty vector is pTRV2.

[0014] The present invention also provides the use of the vector in preparing a product for silencing AcINH3 expression and promoting sugar accumulation in pineapple fruit and / or in preparing a product for pineapple genetic breeding.

[0015] The present invention also provides a recombinant bacterium for interfering with the expression of AcINH3, comprising the gene fragment or the vector and an empty strain;

[0016] The empty vector strain is Agrobacterium.

[0017] The present invention also provides the use of the recombinant bacteria in preparing a product for silencing AcINH3 expression and promoting sugar accumulation in pineapple fruit and / or in preparing a product for pineapple genetic breeding.

[0018] The present invention also provides a method for silencing AcINH3 expression and promoting sugar accumulation in pineapple, comprising the following steps:

[0019] Infecting pineapple fruits with strains containing gene fragments, strains containing vectors or recombinant bacteria;

[0020] The gene fragment is the gene fragment described;

[0021] The carrier is the carrier described;

[0022] The recombinant bacteria are the recombinant bacteria described above;

[0023] The timing of infection is the pineapple fruit ripening period.

[0024] The present invention provides a gene fragment, vector and recombinant bacteria that interfere with the expression of AcINH3, and a method for silencing the expression of AcINH3 to promote the sugar accumulation of pineapple. The gene fragment is shown in SEQ ID NO: 4, and the length is 400bp. The gene fragment can interfere with the expression of AcINH3 and promote the sugar accumulation of pineapple fruit. It is clear that AcINH3 is related to the sugar accumulation of pineapple fruit. The method of the present invention uses a virus-mediated gene silencing method to study the effect of silencing AcINH3 expression on sugar components and contents. It is a rapid and efficient detection method. Compared with the traditional long-term, high-cost and low-efficiency research method that takes more than 3 years to develop gene functions, it greatly saves time and improves efficiency. It provides a basis for rapid and efficient transient gene expression and also provides a basis for the research of high-sugar pineapple germplasm. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1The PCR detection results of the gene fragment and vector interfering with AcINH3 expression are shown in FIG. (M represents 2000 DNAMarker; 1 represents the PCR detection results of the gene fragment interfering with AcINH3 expression; 2 to 6 represent the PCR detection results of the vector interfering with AcINH3 expression);

[0026] Figure 2 The actual picture of pineapple fruit infected with bacterial solution (the left picture is infected with pTRV1+pTRV2 bacterial solution, and the right picture is infected with pTRV1+pTRV2-AcINH3 bacterial solution);

[0027] Figure 3 The effect of silencing AcINH3 expression on the sugar content of pineapple fruit (the upper figure shows sucrose content, the middle figure shows glucose content, and the lower figure shows fructose content);

[0028] Figure 4 is the expression level of AcINH3. DETAILED DESCRIPTION

[0029] The present invention provides a gene fragment that interferes with AcINH3 expression. The gene fragment is shown in SEQ ID NO: 4, SEQ ID NO: 4: GGAACTCGACGGCGTTCATCCGCGCGAGCTGCGGCGCGACGCTGTACCCGCGGCTCTGCTACGCGTCGCTCTCGACCTACGCGGACTCGGTCGCGGAGAGCCCCGTCGCGCTCGCGCGCCTCGCCTCGAACGTCACCGCCGCGCCTCCGCGCCCTCTCCGCCCGAGTCGCCGCCCTCCGCCGCCGCCGCGCCGCGC CGCCTCTCGGGAGGCCGCGGCGCTGCGCGACTGCTGCGAGTCGGCGGGCGACGCCGCCGACCTCGCGCGCCGCGCCGGGGCGGAGCTCGCGCGTCTCGACGCCGGCGCGGCGGCGGCGGCGGCGGCGGGGTCGGGGGCGGCTTGGAGGGTCGCGAACGCGCAGACGTGGCTGAGCGCCGCGCTCACGAACGAGGACACTTG.

[0030] In the present invention, the sequence size of the gene fragment is 400 bp.

[0031] In the present invention, the CDS sequence of the pineapple invertase inhibitor AcINH3 is shown in SEQ ID NO: 1, SEQ ID NO: 1:.

[0032] In the present invention, AcINH3 is a pineapple invertase inhibitor. Previous studies have found that the expression of AcINH3 is closely related to the sugar content and significantly affects the conversion rate of sucrose to hexose, but its function and mechanism of action in pineapple sugar accumulation need to be further clarified.

[0033] The present invention also provides the application of the gene fragment in silencing AcINH3 expression and promoting sugar accumulation in pineapple fruit.

[0034] The invention also provides application of the gene fragment in pineapple genetic breeding.

[0035] The present invention also provides a primer pair for amplifying the gene fragment, and the primer pair is shown in SEQ ID NO: 2-3.

[0036] SEQ ID NO: 2 is an upstream primer, and the specific sequence is: GGAACTCGACGGCGTTCAT; SEQ ID NO: 3 is a downstream primer, and the specific sequence is: CAAGTGTCCTCGTTCGTGAG.

[0037] The present invention also provides the use of the primer pair in preparing a product for silencing AcINH3 expression and promoting sugar accumulation in pineapple fruit and / or in preparing a product for pineapple genetic breeding.

[0038] The present invention also provides a vector for interfering with the expression of AcINH3, comprising the gene fragment and an empty vector;

[0039] The empty vector is pTRV2. The empty vector pTRV2 was purchased from Wuhan Kejin Biotechnology Co., Ltd.

[0040] The present invention also provides the use of the vector in preparing a product for silencing AcINH3 expression and promoting sugar accumulation in pineapple fruit and / or in preparing a product for pineapple genetic breeding.

[0041] The present invention also provides a recombinant bacterium for interfering with the expression of AcINH3, comprising the gene fragment or the vector and an empty strain;

[0042] The empty vector strain is Agrobacterium.

[0043] The present invention also provides the use of the recombinant bacteria in preparing a product for silencing AcINH3 expression and promoting sugar accumulation in pineapple fruit and / or in preparing a product for pineapple genetic breeding.

[0044] The present invention also provides a method for silencing AcINH3 expression and promoting sugar accumulation in pineapple, comprising the following steps:

[0045] Infecting pineapple fruits with strains containing gene fragments, strains containing vectors or recombinant bacteria;

[0046] The gene fragment is the gene fragment described;

[0047] The carrier is the carrier described;

[0048] The recombinant bacteria are the recombinant bacteria described above;

[0049] The timing of infection is the pineapple fruit ripening period.

[0050] The technical solution provided by the present invention is described in detail below in conjunction with embodiments.

[0051] Example 1

[0052] Construction of the vector for AcINH3 expression

[0053] According to the CDS sequence of AcINH3 (SEQ ID NO: 1), a specific primer pair (SEQ ID NO: 2-3) was designed, SEQ ID NO: 1: SEQ ID NO: 2 is an upstream primer, and the specific sequence is: GGAACTCGACGGCGTTCAT; SEQ ID NO: 3 is a downstream primer, and the specific sequence is: CAAGTGTCCTCGTTCGTGAG.

[0054] The CDS sequence of AcINH3 was used as a template and amplified using the primer pair shown in SEQ ID NO: 2-3.

[0055] Amplification system 25 μL: 10 μM upstream primer 1 μL, 10 μM downstream primer 1 μL, template 1 μL, 2×EasyTaq®PCRSuperMix 12.5 μL, Nuclease-free Water 9.5 μL.

[0056] Reaction program: 98°C for 60 s; 98°C for 10 s, 60°C for 15 s, 72°C for 15 s, 30 cycles; 72°C for 2 min.

[0057] The size of the amplified gene fragment is 400 bp (shown in SEQ ID NO: 4). PCR was used to detect whether the gene fragment was constructed correctly. The PCR test results are as follows: Figure 1 The gene fragment shown in SEQ ID NO: 4 was purified, and the purified gene fragment was inserted into the pTRV2 vector using BamHI and SmaI restriction endonucleases. After transformation, PCR detection and sequencing, the pTRV2-AcINH3 vector with positive clones interfering with AcINH3 expression was finally obtained, and the pTRV2-AcINH3 vector was successfully constructed. The results of PCR detection of the pTRV2-AcINH3 vector are shown in Figure 1 shown.

[0058] SEQ ID NO: 4: GGAACTCGACGGCGTTCATCCGCGCGAGCTGCGGCGCGACGCTGTACCCGCGGCTCTGCTACGCGTCGCTCTCGACCTACGCGGACTCGGTCGCGGAGAGCCCCGTCGCGCTCGCGCGCCTCGCCTCGAACGTCACCGCCGCGCCTCCGCGCCCTCTCCGCCCGAGTCGCCGCCCTCCGCCGCCGCCGCGCCGCGC CGCCTCTCGGGAGGCCGCGGCGCTGCGCGACTGCTGCGAGTCGGCGGGCGACGCCGCCGACCTCGCGCGCCGCGCCGGGGCGGAGCTCGCGCGTCTCGACGCCGGCGCGGCGGCGGCGGCGGCGGCGGGGTCGGGGGCGGCTTGGAGGGTCGCGAACGCGCAGACGTGGCTGAGCGCCGCGCTCACGAACGAGGACACTTG.

[0059] Example 2

[0060] The pTRV2-AcINH3 vector for interfering with AcINH3 expression constructed in Example 1 was transformed into Agrobacterium, and after PCR verification, positive single colonies were selected to obtain the recombinant bacteria pTRV2-AcINH3. The recombinant bacteria were stored at low temperature.

[0061] The empty vectors pTRV1 and pTRV2 were transformed into Agrobacterium, respectively. After PCR verification, positive single colonies were selected to obtain pTRV1 single colonies and pTRV2 single colonies, which were stored at low temperature for future use.

[0062] Single colonies of pTRV1, pTRV2, and pTRV2-AcINH3 were selected and inoculated into the culture medium containing rifampicin (50 mg mL -1 ) and kanamycin (100 mg mL -1 ) in YEP liquid medium, cultured at 200 rpm at 28°C for 1 day to obtain pTRV1 seed solution, pTRV2 seed solution and pTRV2-AcINH3 seed solution; 1 mL of pTRV1 seed solution, pTRV2 seed solution and pTRV2-AcINH3 seed solution were added to 25 mL of YEP liquid medium containing rifampicin and kanamycin, and 2 μL of 100 mM acetosyringone (AS) and 100 μL of 0.5 M aqueous morpholineethanesulfonic acid (MES) were added, and cultured at 28°C with shaking until OD 600 The value was 1.0, and the cells were collected by centrifugation at 4000 rpm for 10 min at room temperature, and then resuspended in 10 mM MgCl2 to OD 600 The value is 1.0; then add 200mM AS (2μL per milliliter of bacterial solution) and let it stand for 3h to obtain pTRV1 bacterial solution, pTRV2 bacterial solution and pTRV2-AcINH3 bacterial solution; mix the pTRV1 bacterial solution with the pTRV2 bacterial solution and the pTRV2-AcINH3 bacterial solution in a 1:1 ratio to obtain pTRV1+pTRV2 bacterial solution and pTRV1+pTRV2-AcINH3 bacterial solution for use.

[0063] Bali pineapple fruits were selected as research materials, and bacterial infection experiments were carried out at maturity. The pTRV1+pTRV2-AcINH3 bacterial solution was injected into the fruits of the treatment group, and the pTRV1+pTRV2 bacterial solution was injected into the fruits of the control group. The bacterial solution OD 600 The value is 1.0, and each treatment is repeated 3 times. After 10 days of treatment, pulp samples were collected and the sugar content was determined. Figure 2~3 shown.

[0064] Using Primer-BLAST in NCBI, specific qRT-PCR primers were designed according to the CDS sequence of AcINH3 (SEQ ID NO: 1) (Table 1), and the CDS sequence of AcINH3 (concentration of 50 ng·μL -1 ) as a template, Actin The internal reference gene was amplified using the 2× TransStart® Top Green qPCR SuperMix Kit on a Roche LightCycler480II real-time fluorescence quantitative PCR instrument. Three biological replicates were set for each reaction, and 2 -ΔΔCt The relative expression of each gene was analyzed by the method. Figure 4 shown.

[0065] Table 1 qRT-PCR detection primers

[0066]

[0067] Figures 2~4 It showed that after 10 days of treatment, the pineapple fruit infected with the pTRV1+pTRV2-AcINH3 bacterial solution AcINH3 The expression level of α was significantly reduced, and the content of sucrose, glucose and fructose increased. AcINH3 It can increase the accumulation of sugar in pineapple fruit.

[0068] As can be seen from the above embodiments, the present invention provides a gene fragment, vector and recombinant bacteria that interfere with the expression of AcINH3, and a method for silencing the expression of AcINH3 to promote the accumulation of sugar in pineapple. The gene fragment is shown in SEQ ID NO: 4, and the length is 400bp. The gene fragment can interfere with the expression of AcINH3 and promote the accumulation of sugar in pineapple fruit. It is clear that AcINH3 is related to the accumulation of sugar in pineapple fruit. The method of the present invention uses a virus-mediated gene silencing method to study the effect of silencing AcINH3 expression on sugar components and contents. It is a fast and efficient detection method. Compared with the traditional long-term, high-cost and low-efficiency research method that takes more than 3 years to develop gene functions, it greatly saves time and improves efficiency. It provides a basis for rapid and efficient transient gene expression and also provides a basis for the study of high-sugar pineapple germplasm.

[0069] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. Application of the gene fragment shown in SEQ ID NO: 4 in silencing AcINH3 expression and promoting sugar accumulation in pineapple fruit.

2. A method for silencing AcINH3 expression to promote sugar accumulation in pineapple fruit, characterized in that: The steps include: Infecting pineapple fruits with a strain containing the gene fragment shown in SEQ ID NO: 4; The timing of infection is the pineapple fruit ripening period.

Images