A primer pair for detecting Esterella nematodes and its application

Abstract

The present invention relates to the field of microbial technology, and in particular to a primer pair for detecting Esterella nematodes and its application. The present invention provides a primer pair for detecting Esterella nematodes, the primer pair comprising a forward primer and a reverse primer; the sequence of the forward primer is shown in SEQ ID NO:1; the sequence of the reverse primer is shown in SEQ ID NO:2. The primer pair of the present invention can uniquely amplify a clear target fragment from Esterella nematodes DNA, thereby determining whether Esterella nematodes exists in the sample to be tested; and the primer pair has the advantages of good specificity, economy and short time consumption, and can provide technical guidance for the rapid identification of Esterella nematodes and the colonization detection of the bacteria in pine trees.

Description

Technical Field

[0001] The invention relates to the technical field of microorganisms, and in particular to a primer pair for detecting Esterella nematodes and application thereof. Background Art

[0002] Pine wood nematodes are major quarantine pests in the world. They are so destructive that they are called the "cancer" of pine trees. The current pesticide control methods mainly involve spraying chemicals to kill vector insects and injecting emamectin benzoate into tree trunks to control pine wood nematodes. However, there are problems such as chemical pesticides polluting the environment and the trunk injection method is not suitable for large-scale application.

[0003] Esterophilus nematodes Esteya vermicola It is the first reported pine wood nematode endoparasitic fungus in the world, showing high infectivity and mortality to pine wood nematodes. The Chinese patent with patent number ZL202011558429.4 authorizes a nematicidal fungus of Esterella nematodes Fxy120 and its application. The strain is the nematode Esterella Fxy120 strain, which is isolated from pine tissues in my country. In the forest, pine wood nematodes can be controlled by crown spraying and trunk injection of spore suspension. After spraying or injecting the fungus, the fungus can be isolated again from pine tissues by tissue separation, indicating that the fungus can colonize in pine trees, but this method is time-consuming, labor-intensive and difficult to obtain the target strain, which makes the identification of the fungus have a certain degree of accidental and randomness. With the rapid development of molecular biology, sequence sequencing-based methods have been widely used in the identification of target strains. PCR detection can specifically amplify the DNA fragments of the strain, eliminating the isolation and culture steps of the strain in the traditional method. The operation is simple, fast and accurate. Currently, there are no specific primers for PCR detection of Esterella nematodes. Establishing a method for rapid identification of Esterella nematodes will be helpful in evaluating its colonization ability on pine trees and provide technical support for further optimizing the use of this bacterium in forests. Summary of the invention

[0004] The purpose of the present invention is to provide a primer pair for detecting Esterella nematodes, which can uniquely amplify a clear target fragment from Esterella nematodes DNA, thereby determining whether Esterella nematodes exists in a sample to be tested.

[0005] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0006] The present invention provides a primer pair for detecting Esterella nematodes, the primer pair comprising a forward primer and a reverse primer;

[0007] The sequence of the forward primer is shown in SEQ ID NO: 1;

[0008] The sequence of the reverse primer is shown in SEQ ID NO:2.

[0009] The present invention also provides application of the primer pair in preparing a kit for detecting Esterella nematodes.

[0010] The present invention also provides a kit for detecting Esterella nematodes, and the kit comprises the primer pair.

[0011] The present invention also provides a method for detecting Esterella nematodes, comprising the following steps:

[0012] The DNA of the sample to be tested is used as a template and the primer pair is used to perform PCR amplification to obtain an amplified product; the amplification of the amplified product is detected by agarose gel electrophoresis to determine whether Esterella nematodes is present.

[0013] Preferably, the sample to be tested is fungal cells or pine tissue;

[0014] The pine tree tissue is needles, side branches or trunks of pine trees.

[0015] Preferably, the reaction system for PCR amplification is: 0.5-1.5 μL template, 8-12 μL 2×Taq PCRMaster, 0.3-0.7 μL forward primer, 0.3-0.7 μL reverse primer, and 6-10 μL ddH2O.

[0016] Preferably, the reaction conditions for the PCR amplification are: pre-denaturation at 92-96°C for 4-6 min; denaturation at 92-96°C for 20-40 s, annealing at 56-60°C for 20-40 s, extension at 70-74°C for 20-40 s, for a total of 33-37 cycles; extension at 70-74°C for 4-6 min.

[0017] Preferably, if a band of 522 bp is detected, the sample to be tested contains Esterella nematodes; if a band of 522 bp is not detected, the sample to be tested does not contain Esterella nematodes.

[0018] Beneficial effects of the present invention:

[0019] The present invention provides a primer pair for detecting Esterella nematodes. The primer pair can uniquely amplify a clear target fragment from DNA of Esterella nematodes, so as to determine whether Esterella nematodes exists in a sample to be tested. The primer pair has the advantages of good specificity, economy and short time consumption, and can provide technical guidance for the rapid identification of Esterella nematodes and the colonization detection of the bacterium in pine trees. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 The electrophoresis detection result of the amplification product obtained by amplification using the primer pair described in Example 1 in Example 2;

[0021] Figure 2 The electrophoresis detection result of the amplification product obtained by amplification using the 28S-F / R primer pair in Example 2;

[0022] Figure 3 The electrophoresis detection result of the amplification product obtained by amplification using the Chi-F / R primer pair in Example 2;

[0023] Figure 4 The electrophoresis detection result of the amplification product obtained by amplification using the Chi-F1 / R1 primer pair in Example 2;

[0024] Figure 5 is the electrophoresis detection result of the amplification product obtained by amplification using the F3 / R3 primer pair in Example 3;

[0025] Figure 6 is the electrophoresis detection result of the amplification product obtained by amplification using the primer pair described in Example 1 in Example 3;

[0026] Figure 7 The sensitivity test results in Example 4, wherein lane 1: 100 ng / μL; lane 2: 10 ng / μL; lane 3: 1 ng / μL; lane 4: 1×10 -1 ng / μL; Lane 5: 1×10 -2 ng / μL; Lane 6: 1×10 -3 ng / μL; Lane 7: 1×10 -4 ng / μL; Lane 8: 1×10 -5 ng / μL; Lane 9: 1×10 -6 ng / μL; Lane 10: 1×10 -7 ng / μL; Lane 11: 1×10 -8 ng / μL; Lane 12: 1×10 -9 ng / μL; Lane 13: 1×10 -10 ng / μL; Lane 14: 1×10 -11 ng / μL; Lane 15: 1×10 -12 ng / μL; Lane 16: 1×10 -13 ng / μL; Lane 17: 1×10 -14 ng / μL; Lane 18: 1×10 -15 ng / μL; Lane M: 100 bp DNA ladder marker. DETAILED DESCRIPTION

[0027] The present invention provides a primer pair for detecting Esterella nematodes, the primer pair comprising a forward primer and a reverse primer;

[0028] The sequence of the forward primer is shown in SEQ ID NO: 1;

[0029] The sequence of the reverse primer is shown in SEQ ID NO: 2;

[0030] The SEQ ID NO: 1 is: 5'-TCCCTTCTCTCTCTCTGCCC-3';

[0031] The SEQ ID NO: 2 is 5'-GATTGGCGTTGATGGGGTTG-3'.

[0032] The present invention also provides the use of the primer pair in preparing a kit for detecting Esterella nematodes.

[0033] The present invention also provides a kit for detecting Esterella nematodes, and the kit comprises the primer pair.

[0034] The present invention also provides a method for detecting Esterella nematodes, comprising the following steps:

[0035] The DNA of the sample to be tested is used as a template and the primer pair is used to perform PCR amplification to obtain an amplified product; the amplification of the amplified product is detected by agarose gel electrophoresis to determine whether Esterella nematodes is present.

[0036] In the present invention, the sample to be tested is a fungal cell or a pine tree tissue;

[0037] The pine tree tissue is needles, side branches or trunks of pine trees.

[0038] In the present invention, the reaction system of PCR amplification is:

[0039] Template 0.5~1.5μL, preferably 0.8~1.2μL, more preferably 1μL;

[0040] 2×Taq PCR Master 8~12μL, preferably 9~11μL, more preferably 10μL;

[0041] Forward primer 0.3~0.7μL, preferably 0.4~0.6μL, more preferably 0.5μL;

[0042] 0.3-0.7 μL reverse primer, preferably 0.4-0.6 μL, more preferably 0.5 μL;

[0043] ddH2O 6 to 10 μL, preferably 7 to 9 μL, more preferably 8 μL.

[0044] In the present invention, in the agarose gel electrophoresis method, the concentration of agarose is 0.5% to 1.5%, preferably 1%.

[0045] In the present invention, the reaction conditions of the PCR amplification are: pre-denaturation at 92-96°C for 4-6 min; denaturation at 92-96°C for 20-40 s, annealing at 56-60°C for 20-40 s, extension at 70-74°C for 20-40 s, for a total of 33-37 cycles; extension at 70-74°C for 4-6 min;

[0046] The reaction conditions for PCR amplification are preferably: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 30 s, annealing at 58°C for 30 s, and extension at 72°C for 30 s, for a total of 35 cycles; and extension at 72°C for 5 min.

[0047] In the present invention, if a band of 522 bp is detected, the sample to be tested contains E. nematodes; if a band of 522 bp is not detected, the sample to be tested does not contain E. nematodes.

[0048] The technical solutions provided by the present invention are described in detail below in conjunction with the embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0049] Example 1 Design of primer pairs for detecting Esterella nematodes

[0050] Download the gene sequence of E. elegans (GeneBank: GCA_002778215.1) and different fungi from NCBI. Stu The gene sequence was aligned by MEGA6 software, and the DNA fragment unique to E. elegans was found in the CDS region. Primers were designed for the unique fragment using Primer3Plus: forward primer / reverse primer (F1 / R1): 5'-TCCCTTCTCTCTCTCTGCCC-3' (SEQ ID NO: 1) / 5'-GATTGGCGTTGATGGGGTTG-3' (SEQ ID NO: 2).

[0051] Example 2 Primer pair specificity verification

[0052] The primer specificity was tested using DNA of E. elegans strain Fxy120, strain CBS115803, and 14 other known fungi (as shown in Table 1 ) as templates;

[0053] The fungal genomic DNA extraction kit [purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd.] was used to extract the DNA of the 16 fungi in Table 1. The extracted DNA was used as a template and the primers described in Example 1 were used for PCR amplification to obtain amplified products. The amplification of the amplified products was detected by agarose gel electrophoresis. The results are as follows: Figure 1 As shown;

[0054] The reaction system for PCR amplification was: 1 μL template, 10 μL 2×Taq PCR Master, 0.5 μL forward primer, 0.5 μL reverse primer, 8 μL ddH2O;

[0055] The reaction conditions for PCR amplification were as follows: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 30 s, annealing at 58°C for 30 s, and extension at 72°C for 30 s, for a total of 35 cycles; extension at 72°C for 5 min;

[0056] A control group was set up, and the specific primer pair 28S-F / R reported in the literature: CAACAGGGATTGCCCCAGTAACGGCGAGT (SEQ ID NO: 3) / GATTAGTCTTTCGCCCCCATGCCCATATT (SEQID NO: 4) (Yin Can, Wang Yunbo, Zhang Yongan, et al. A pine wood sample preparation method for high target and quality DNA extraction for detection of Esteya vermicolaby PCR from living pine. Journal of Basic Microbiology,2018. Doi: 10.1002 / jobm.201800522), specific primer pair Chi-F / R: GTGCCTCTACCAAGACTCGC (SEQ ID NO:5) / CGCCAAATGTCAAGATCCGC (SEQ ID NO:6) (Wei Ke, Wang Qinghua, Wang Yuzhu et al. Rapid molecular detection of Esteya vermicola based on specific primers and the FTA-DNA extraction method. Biocontrol Science and Technology,2014. http: / / dx.doi.org / 10.1080 / 09583157.2014.900736), specific primer pair Chi-F1 / R1: AGCGGTAGCTTTCTGAGC (SEQ ID NO:7) / GGCTTGTTTGATTTTTCTG (SEQ ID NO:8) (Wei Ke, Analysis of microbial communities in trees with pine wilt disease and rapid detection of Esteya vermicola) The above method was used for amplification, and the amplification results are shown in the figure. Figures 2~4 shown.

[0057]

[0058] from Figure 1 It can be seen that the primer pair described in Example 1 is from Esterella nematodes Esteya vermicola A band of about 522 bp was amplified, while no amplification products were found in other fungi, indicating that the primers have strong specificity. Figure 2 It can be seen that the 28S-F / R primer pair can amplify products with the same fragment length from DNA of different fungal species, and this primer pair is not specific; Figure 3~4 It can be seen that the Chi-F / R primer pair and the Chi-F1 / R1 primer pair can amplify bands from other fungal DNAs, and the primers are not specific either.

[0059] Example 3 Detection of colonization of Esterella nematode on pine needles

[0060] (1) Inoculate the red fluorescent E. elegans Fxy120-PS on PDA medium and culture at 25°C for 7 days. Inoculate the bacterial cake into PDB medium and culture at 200 rpm and 25°C for 7 days to obtain a spore suspension of the strain. Adjust the concentration to 1×10 7 spores / mL; 15 mL of spore suspension was sprayed on 3-year-old Masson pine seedlings in the greenhouse, with 3 replicates per group, and sterile water was sprayed as a control; 48 hours after spraying, the Masson pine needles were taken for testing;

[0061] 1 g of Masson pine needles were cut into pieces for DNA extraction; Fxy120-PS strain fluorescent fragment specific primers F3 / R3 [TCAGTTCATGTACGGCTCCAA (SEQ ID NO: 9) / GAGGTGATGTCCAACTTGATGT (SEQ ID NO: 10)] and the primer pair F1 / R1 shown in Example 1 were synthesized, and PCR amplification was performed according to the reaction system and reaction conditions of PCR amplification in Example 2 to obtain an amplified product, and the amplified product was detected by agarose gel electrophoresis to obtain an electrophoresis pattern, as shown in FIG. Figures 5 and 6 shown.

[0062] from Figures 5 and 6 It can be seen that the expected bands can be amplified using both F3 / R3 and F1 / R1 primers in the DNA of Masson pine needles sprayed with the nematode Estergastrointestinalis strain Fxy120-PS, while no bands were amplified in the control group sprayed with sterile water, indicating that the primer pair described in Example 1 can effectively detect the colonization of nematode Estergastrointestinalis on Masson pine.

[0063] Example 4 Sensitivity Detection Test

[0064] DNA of E. elegans Fxy120 was extracted and diluted to 100 ng / μL by ten-fold dilution method to 1×10 -15 ng / μL, using the Esterella nematode DNA diluted into different concentration gradients as a template, using the F1 / R1 primer pair described in Example 1, and performing PCR amplification according to the reaction system and reaction conditions of PCR amplification in Example 2 to obtain an amplified product, and the amplified product was detected by agarose gel electrophoresis to obtain an electrophoresis pattern. The results are as follows Figure 7 shown.

[0065] from Figure 7 It can be seen that specific bands can be amplified when the concentration of E. elegans DNA in the test sample is higher than 1 ng / μL.

[0066] It can be seen from the above embodiments that the present invention provides a primer pair for detecting Esterella nematodes and its application, the primer pair can uniquely amplify a clear target fragment from the DNA of Esterella nematodes, thereby determining whether Esterella nematodes exists in the sample to be tested; and the primer pair has the advantages of good specificity, economy and short time consumption.

[0067] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A primer pair for detecting Esterella nematodes, characterized in that: The primer pair includes a forward primer and a reverse primer; The sequence of the forward primer is shown in SEQ ID NO: 1; The sequence of the reverse primer is shown in SEQ ID NO:

2.

2. Use of the primer pair according to claim 1 in preparing a kit for detecting Esterella nematodes.

3. A kit for detecting Esterella nematodes, characterized in that: The kit comprises the primer pair according to claim 1.

4. A method for detecting Esterella nematodes, characterized in that: The steps include: Using the DNA of the sample to be tested as a template, PCR amplification is performed using the primer pair described in claim 1 to obtain an amplified product; agarose gel electrophoresis is used to detect the amplification of the amplified product to determine whether Esterella nematodes is present.

5. The method according to claim 4, characterized in that The sample to be tested is fungal cells or pine tissue; The pine tree tissue is needles, side branches or trunks of pine trees.

6. The method according to claim 5, characterized in that The reaction system of the PCR amplification is: 0.5-1.5 μL template, 8-12 μL 2×Taq PCR Master, 0.3-0.7 μL forward primer, 0.3-0.7 μL reverse primer, and 6-10 μL ddH2O.

7. The method according to claim 6, characterized in that The reaction conditions of the PCR amplification are: pre-denaturation at 92-96°C for 4-6 min; denaturation at 92-96°C for 20-40 s, annealing at 56-60°C for 20-40 s, and extension at 70-74°C for 20-40 s, for a total of 33-37 cycles; Extend at 70~74℃ for 4~6min.

8. The method according to claim 7, characterized in that If a band of 522 bp is detected, the sample to be tested contains E. nematodes; if a band of 522 bp is not detected, the sample to be tested does not contain E. nematodes.

Images