Application of SDR16C5 encoding gene in regulating proliferation and differentiation of mouse preadipocyte cell line 3T3-L1

Abstract

The present invention relates to the field of biotechnology and discloses SDR16C5 The invention discloses an application of a coding gene in regulating the proliferation and differentiation of a mouse preadipocyte cell line 3T3-L1. SDR16C5 An overexpression vector encoding a gene, wherein the overexpression vector and SDR16C5 The interference fragment was transfected into the mouse preadipocyte cell line 3T3-L1, causing changes in the expression level of the target gene in 3T3-L1 cells. The results showed that overexpression SDR16C5 It can inhibit the proliferation activity of mouse pre-adipocyte cell line 3T3-L1 and promote the differentiation of pre-adipocyte cell line 3T3-L1. The present invention discovered for the first time the function of SDR16C5 in mouse pre-adipocyte cell line 3T3-L1. It helps to understand the gene regulation mechanism of lipid deposition, thereby controlling or preventing the occurrence and development of related diseases, and also provides a theoretical basis and technical support for animal breeding.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, specifically to the fields of molecular biology and genetics, and in particular to SDR16C5 Application of the coding gene in regulating proliferation and differentiation of the mouse preadipocyte cell line 3T3-L1. Background Art

[0002] The mouse preadipocyte cell line 3T3 (3T3-L1 cell line) is a classic cell model widely used in the study of adipocyte differentiation and metabolism. 3T3-L1 cells were originally derived from mouse embryonic fibroblasts, and they can be transformed into mature adipocytes (fat cells) under appropriate induction conditions. This cell line has a high differentiation potential and can enter the process of adipocyte differentiation through the stimulation of specific hormones and growth factors, thereby accumulating lipid droplets and showing the characteristics of mature adipocytes. Due to its easy culture, stable differentiation characteristics and high similarity to adipocytes in the body, 3T3-L1 cells are widely used to study adipocyte biology, metabolic regulation and the mechanism of obesity-related diseases.

[0003] SDR16C5 Short-chain dehydrogenase / reductase family 16C member 5 is an enzyme belonging to the short-chain dehydrogenase / reductase family, which is widely present in mammals. This type of enzyme is usually involved in a variety of important biochemical processes in cells, and its effects on adipocyte differentiation and metabolism have not been reported. Summary of the invention

[0004] The present invention first discovered SDR16C5 The encoding gene has a regulatory role in the proliferation and differentiation of the mouse preadipocyte line 3T3-L1.

[0005] In a first aspect, the present invention provides SDR16C5 The use of the coding gene in regulating the proliferation of mouse preadipocyte cell line 3T3-L1, the SDR16C5 The CDS sequence of the coding gene is shown in SEQ ID No. 1. SDR16C5 The encoding gene inhibits the proliferation activity of the mouse preadipocyte cell line 3T3-L1.

[0006] In a second aspect, the present invention provides SDR16C5 Use of a coding gene in regulating differentiation of a mouse preadipocyte cell line 3T3-L1, the SDR16C5 The CDS sequence of the coding gene is shown in SEQ ID No. 1. SDR16C5 The encoding gene promotes the differentiation of the mouse preadipocyte cell line 3T3-L1.

[0007] In the present invention, overexpression SDR16C5 The coding gene promotes the differentiation of mouse preadipocyte cell line 3T3-L1, which is reflected by: overexpression in mouse preadipocyte cell line 3T3-L1 SDR16C5 After encoding the gene, lipid droplet deposition was increased in the mouse preadipocyte cell line 3T3-L1 cells.

[0008] SEQ ID No.1: ATGTCTCAAAACCTGGAATCAGTGAAGAACTTGCTTGTTTTCTTGGGAAAATCACTGTTGAGTGTTTTGGAGGCCCTACTTTTTCATGTCATCTCAAAACCACGGAAGAACGTTGCCGGTGAGATAGTGCTCATAACAGGTGCTGGGAGTGGACTAGGAAGGCTCTTAGCATTGCAGTTTGCCCGCCTGGGAGCAGTGCTTGTTCTCTGGGATGTGAACAAGGAGGCAAATGATGAGACTCATCAGTTAGCTCGGGAAGCAGGAGCTGCCAGAGTACATGCCTACACCTGTGACTGCAGCCGGAGGGAAGAAGTGTACAGAGTGGCTGACCAGGTTAAGAAAGAAGTTGGTGATGTCTCTATCCTCATCAACAATGCCGGCATTGTAACAGGCAGAAATTTCCTTGACTGCCCAGATGACCTCATGGAAAAGTCATTTGATGTCAATTTCAAAGCACATTTATGGATGTATAAAGCCTTCCTGCCTGCCATGATTGCTAACAACCACGGCCATTTGGTTTGCATTTCAAGTTCAGCTGGATTAATTGGAGTAAATGGGCTGTCAGACTATTGTGCAAGTAAATTCGCAGCCCTTGGATTTGCAGAATCTATGTTTATCGAAACACTTGCCAAGAAACAATGGGGGATCAAAACGACAATTGTGTGCCCATTCTTTATAAAAACTGGAATGTTTGAAGGTTGCACTACTAAGTGTCCTACTCTGTTACCAATTCTGGATCCAGAATATGCAGTTAGGAAAATCATAGATGCCATTCTCCAGGAGCAGCTCTACTTGTATATGCCCAAGTTTTTATACTTCATAGTGTTTCTAAAAAGCATCTTGCCAATCAAGACAGGAATACTTATAGCTGACTACCTGGGAGTCTTTCATATGACAGAGGGCTTCACTGGCCAAAAGAAGAAAACTTAA。

[0009] In the application provided by the present invention, by overexpressing SDR16C5The encoding gene inhibits the proliferation activity of the mouse preadipocyte cell line 3T3-L1. Specifically, SDR16C5 Encoding genes that play important roles in cell cycle progression.

[0010] In the application provided by the present invention, use SDR16C5 Overexpression vector encoding gene SDR16C5 Overexpression of coding genes.

[0011] More specifically, the present invention SDR16C5 The overexpression vector encoding the gene contains SDR16C5 The CDS region sequence of the coding gene, SDR16C5 The 5' end restriction site of the overexpression vector encoding the gene is BamhⅠ, and the 3' end restriction site is XhoⅠ.

[0012] In the present invention, SDR16C5 The regulation of proliferation of mouse preadipocyte cell line 3T3-L1 by the coding gene also includes: inhibition SDR16C5 The expression of the encoding gene promotes the proliferation activity of mouse preadipocyte cell line 3T3-L1 cells.

[0013] In the application of the present invention to promote the proliferation activity of mouse pre-adipocyte cell line 3T3-L1 cells, the interference fragment si- SDR16C5 inhibition SDR16C5 Expression of coding genes.

[0014] In a third aspect, the present invention provides SDR16C5 Method for detecting the regulation of proliferation and differentiation of the coding gene on the mouse pre-adipocyte cell line 3T3-L1, transfection in the mouse pre-adipocyte cell line 3T3-L1 SDR16C5 After the overexpression vector encoding the gene was added, CCK-8 was used to detect the proliferation activity of the gene on 3T3-L1 cells;

[0015] or in SDR16C5 3T3-L1 cells were induced to differentiate during continuous overexpression of the coding gene to detect SDR16C5 Effects of coding genes on differentiation of 3T3-L1 cells.

[0016] In a fourth aspect, the present invention provides a SDR16C5 An overexpression vector encoding a gene, the SDR16C5 The overexpression vector encoding the gene contains SDR16C5 The CDS region sequence of the coding gene, SDR16C5 The 5' end restriction site of the overexpression vector encoding the gene is BamhⅠ, and the 3' end restriction site is XhoⅠ.

[0017] In a fifth aspect, the present invention provides a method for detecting SDR16C5 A primer pair encoding gene expression level, the nucleotide sequence of the primer pair is shown in SEQ ID No.2-3.

[0018] SEQ ID No.2( SDR16C5 -F): 5'-ACGTTGCCGGTGAGATAGTG-3';

[0019] SEQ ID No.3( SDR16C5 -R): 5'-CTCCTGCTTCCCGAGCTAAC-3'.

[0020] The internal reference gene used in the present invention is β-actin The primers for detecting the expression level of the internal reference gene are shown in SEQ ID No.4-5.

[0021] SEQ ID No.4( β-actin -F):5'-TGTACCCAGGCATTGCTGAC-3';

[0022] SEQ ID No.5( β-actin -R): 5'-AACGCAGCTCAGTAACAGTCC-3'.

[0023] In a sixth aspect, the present invention provides interference SDR16C5 The si-RNA encoding gene expression, the sequence of the si-RNA is shown as SEQ ID No.6.

[0024] SEQ ID No. 6: AGACUAUUGUGCAAGUAAAUU.

[0025] The beneficial effects of the present invention are:

[0026] The development and regulation of mammalian fat is a very complex process, and analyzing the development and metabolism of fat is one of the hot topics that scientists around the world have been paying attention to. SDR16C5 The effect of the encoding gene on the proliferation and differentiation of the mouse preadipocyte cell line 3T3-L1 is crucial for analyzing the growth metabolism of mammalian fat.

[0027] The present invention is to SDR16C5 The overexpression vector or interference fragment was transfected into the mouse preadipocyte cell line 3T3-L1 to overexpress or interfere with its expression in the cells. SDR16C5 It can inhibit the proliferation activity of mouse preadipocyte cell line 3T3-L1, while the cell viability is significantly promoted after interfering with its expression; and overexpression SDR16C5It can promote the deposition of lipid droplets in the mouse preadipocyte cell line 3T3-L1, and the number of lipid droplets in the cells is significantly reduced after interfering with its expression. SDR16C5 The encoded gene has the function of inhibiting the proliferation of mouse preadipocyte line 3T3-L1 and promoting its lipid deposition. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] In order to more clearly illustrate the technical solutions in the present invention or the prior art, the following briefly introduces the drawings required for use in the embodiments or the description of the prior art. Obviously, the drawings described below are some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0029] Figure 1 The overexpression vector is transfected into 3T3-L1 cells in the present invention SDR16C5 After 36 h, the cells were collected and RNA was extracted. RT-qPCR was used to detect overexpression and interference efficiency. SDR16C5 The upstream and downstream primers of SDR16C5 used in qPCR detection are SEQ ID No.2 and SEQ ID No.3, and the upstream and downstream primers of the internal reference gene β-actin are SEQ ID No.4 and SEQ ID No.5. Among them, A is the expression level of the overexpression vector SDR16C5 and the empty vector in 3T3-L1 cells after transfection. SDR16C5 Gene expression; B is the expression of the interference fragment and the control in 3T3-L1 cells SDR16C5 Gene expression level.

[0030] Figure 2 The results of the cell proliferation activity of the present invention are shown in Figure 1. A is the cell proliferation activity after transfection of the overexpression vector SDR16C5 and empty vector in 3T3-L1 cells; B is the cell proliferation activity detected by CCK-8 after transfection of the interference fragment and control in 3T3-L1 cells.

[0031] Figure 3 The results of the present invention in which the overexpression vector SDR16C5 and empty vector, interference fragment and control were transfected into 3T3-L1 cells, and the cell cycle was detected by flow cytometry, wherein A is the effect of the overexpression vector SDR16C5 and empty vector on the cell cycle; B is the effect of the interference fragment and control on the cell cycle.

[0032] Figure 4The cell differentiation conditions after 8 days of induction of differentiation in 3T3-L1 cells transfected with overexpression vector SDR16C5 and empty vector, interference fragment and control in the present invention. Among them, A is the effect of transfection of overexpression vector SDR16C5 and empty vector on cell differentiation, and B is the effect of transfection of interference fragment and control on cell differentiation.

[0033] Figure 5 The present invention is to transfect the overexpression vector SDR16C5 and empty vector, interference fragment and control in 3T3-L1 cells, and induce differentiation for 8 days to show the distribution and content of lipid droplets. Among them, A and B are overexpression vectors SDR16C5 A and empty vector transfection, the distribution of oil droplets in the cells after Oil Red staining, D and E are the distribution of oil droplets in the cells after Oil Red staining after interference fragment and control transfection; C and F are the lipid droplet contents obtained by extracting lipid droplets in the cells with isopropanol. DETAILED DESCRIPTION

[0034] In order to make the purpose, technical solution and advantages of the present invention clearer, the technical solution of the present invention will be clearly and completely described below in conjunction with the drawings of the present invention. Obviously, the described embodiments are part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0035] In a specific embodiment of the present invention, the overexpression vector and its control pcDNA3.1(+) empty vector are transfected into the mouse preadipocyte cell line 3T3-L1 using Lipofectamine 3000; and siRNA and si-NC are transfected into the mouse preadipocyte cell line 3T3-L1 using Lipofectamine RNAiMAX.

[0036] Unless otherwise specified, the equipment and reagents used in the present invention are conventional in the art.

[0037] Example 1 SDR16C5 Effects on the proliferation of mouse preadipocyte cell line 3T3-L1

[0038] The SDR16C5 gene is a member of the short-chain dehydrogenase / reductase superfamily and can promote the biosynthesis of retinoids when expressed in mammalian cells.

[0039] The present invention constructs an overexpression vector of SDR16C5, constructs the CDS region sequence of SDR16C5 into the overexpression vector pcDNA3.1(+), and designs and synthesizes the interference fragment si-SDR16C5 of SDR16C5, wherein the interference fragment si-SDR16C5 is shown in SEQ ID No.6.

[0040] si-SDR16C5 (SEQ ID No. 6): AGACUAUUGUGCAAGUAAAUU.

[0041] The present invention designs three interference fragments for the same target, among which the interference efficiency of si-SDR16C5 shown in SEQ ID No.6 reaches 28.2%, and the interference efficiencies of the other two interference fragments are 38.9% and 62.0%, and the sequence information is shown in SEQID No.7 and SEQ ID No.8.

[0042] SEQ ID No.7:GAAUCUAUGUUUAUCGAAACA;

[0043] SEQ ID No. 8: GGCUUACUUCAAAGAAGAAAG.

[0044] The mouse pre-adipocyte cell line 3T3-L1 was cultured at 37°C, 5% CO2, and saturated humidity. After the cells were fully grown, the cells were plated. Taking a 6-well plate as an example, the cell fusion in the cell bottle reached more than 80% before subculture and plating. First, wash the cells twice with PBS preheated at 37°C, then add an appropriate amount of 0.25% trypsin to digest the cells. After most of the cells have been detached from the wall, add complete medium to terminate the digestion, and then transfer the above mixture to a 15mL centrifuge tube for centrifugation at 1000rpm for 5min. After the centrifugation is completed, the supernatant is discarded, and the cells are resuspended with complete medium preheated at 37°C, evenly plated in a 6-well plate, and cultured in an incubator at 37°C, 5% CO2, and saturated humidity.

[0045] Cell transfection, when the cell confluence reaches about 80%, SDR16C5 overexpression vector and pcDNA3.1(+) empty control are transfected; when the cell confluence reaches about 40%, si-SDR16C5 and si-NC control are transfected. Taking 6-well plate as an example, the overexpression transfection system is: ① Add 4μL Lipofectamine 3000 to 100μl opti-MEM; ② Add 1500ng overexpression vector plasmid (or empty vector of the same mass) and 4μL p3000 to 100μlopti-MEM, ① and ② systems are mixed separately for 5min, and then ① and ② are mixed for 15-20min, and then transfected. The interference fragment transfection system is as follows: ① Add 6μL Lipofectamine RNAiMAX to 100μL opti-MEM; ② Add 3μL siRNA (si-NC) to 100μL opti-MEM, ① and ② systems are mixed separately for 5 minutes, and then ① and ② are mixed for 15-20 minutes, and then transfection is performed. All experiments were repeated at least three times to ensure the reproducibility of the results.

[0046] After 36 hours of cell transfection, the cell status was observed. The cell status was good and the degree of fusion could reach about 90%. The cells were collected at this time.

[0047] RNA was extracted from the cells and the overexpression efficiency and interference efficiency of SDR16C5 were detected by RT-qPCR (e.g. Figure 1 The results showed that compared with the control group, the expression level of SDR16C5 was significantly increased after transfection with the SDR16C5 overexpression vector; compared with the control group, the expression level of si-SDR16C5 interference fragment was significantly inhibited after transfection with the si-SDR16C5 interference fragment. The above results can be used for the next step of detection.

[0048] Cell Counting Kit-8 (CCK-8) was used to detect cell proliferation activity. 4 3T3-L1 cells were seeded in a 96-well plate with a volume of 100 µL per well. After seeding, the cells were cultured at 37°C and 5% CO2 for about 8 hours for transfection. The transfection time was recorded as 0h, and 10µL of CCK-8 reagent was added to each well at 12h, 24h, 36h, and 48h, and incubated for another 2 hours under the same conditions. The absorbance was measured at a wavelength of 450 nm using an ELISA reader to evaluate the proliferation activity of the cells. The results showed that compared with the control group, the overexpression SDR16C5 After 24h, 36h, and 48h, the cell proliferation activity was significantly inhibited (e.g. Figure 2 A); and interference SDR16C5 The cell proliferation activity was significantly promoted 24h and 36h after expression (e.g. Figure 2B).

[0049] Cell cycle was detected by flow cytometry. 3T3-L1 cells seeded in 6-well plates were transfected as above. 36 hours after transfection, the cells were treated, first washed with PBS, digested with 0.25% trypsin, and terminated with complete medium to obtain cell pellets, which were then resuspended with 70% ethanol and then fixed at 4°C overnight. Cell cycle analysis was performed using a BD Accuri C6 flow cytometer.

[0050] The results showed that compared with the control group, the overexpression SDR16C5 There is no significant effect on the progression of the cell cycle (e.g. Figure 3 A); and interference SDR16C5 After gene expression, the proportion of cells in the S phase of the cell cycle decreased significantly, indicating a decrease in DNA synthesis, indicating that this gene plays an indispensable role in the cell cycle (e.g. Figure 3 B).

[0051] Based on the above results, SDR16C5 The gene can inhibit the proliferation activity of the mouse preadipocyte cell line 3T3-L1 and play an important role in cell cycle progression.

[0052] Example 2 SDR16C5 Effects on differentiation of mouse preadipocyte cell line 3T3-L1

[0053] In organisms, lipids are not only an important source of energy, but also participate in the construction of cell structure and the regulation of various physiological functions. Genes directly affect the synthesis, decomposition and storage of lipids by encoding enzymes, transport proteins and receptors involved in lipid metabolism. Therefore, studying the regulatory mechanism of lipid deposition is crucial to understanding complex metabolic processes, such as obesity, cardiovascular disease and diabetes. By deeply exploring the regulatory mechanism of lipid deposition, the occurrence and development of related diseases can be controlled or prevented.

[0054] In addition, research on lipid differentiation also provides a theoretical basis and technical support for animal breeding, which helps to optimize the meat quality and health of animals and enhance the sustainability and economic benefits of agricultural production. The regulatory mechanism of SDR16C5 in the lipid metabolism process in cells is not clear.

[0055] The present invention further detects SDR16C5Effect on differentiation of mouse preadipocyte cell line 3T3-L1, this example is the same as Example 1, the CDS region sequence of SDR16C5 is constructed into the overexpression vector pcDNA3.1(+), and the interference fragment si-SDR16C5 of SDR16C5 is designed and synthesized, and the interference fragment si-SDR16C5 is shown in SEQ ID No.6, and transfection is performed. After 48 hours of transfection, the cells are overgrown and contact inhibition occurs, and the cells are induced to differentiate at this time. The induction differentiation medium is 90% DMEM medium, 10% fetal bovine serum (FBS), 850mM insulin, 1μM dexamethasone, 0.5mM isobutylmethylxanthine (IBMX), 1μM rosiglitazone; the maintenance differentiation medium is 90% DMEM medium, 10% fetal bovine serum (FBS), 850mM insulin, 1μM rosiglitazone. The first transfection of cells was recorded as the first transfection, and the cells were continuously overexpressed and interfered every 3 days thereafter; the appearance of contact inhibition in the cells was recorded as day 0, at which time the cells were induced to differentiate and replaced with induction differentiation medium, and then replaced with maintenance differentiation medium every 2 days until the cells were harvested on the 8th day of differentiation.

[0056] On the 8th day of differentiation, cells were collected, RNA was extracted, and RT-qPCR was performed. SDR16C5 The overexpression efficiency and interference efficiency (such as Figure 4 The results showed that compared with the control group, the transfected SDR16C5 Its expression level was significantly increased after overexpression of the vector; compared with the control group, its expression level was significantly inhibited after transfection of the si-SDR16C5 interference fragment. The above results can be used for the next step of detection.

[0057] The differentiation of cells was detected by Oil Red O staining. The specific operation is as follows: aspirate the culture medium in the cell wells and wash the cells twice with PBS preheated at 37°C; fix with 4% formaldehyde solution at room temperature for 20 minutes to ensure that the cells are completely covered in formaldehyde to prevent the cells from falling off during the fixation process; gently wash the fixed cells with PBS three times for 5 minutes each time. This step is to remove excess formaldehyde and other non-cellular components and reduce background staining; prepare Oil Red O working solution, mix 0.5% Oil Red O storage solution with water in a ratio of 3:2 and filter, then add the staining solution to the cells and stain at room temperature for 30 minutes. Oil Red O staining can specifically stain lipid droplets in red cells; remove the Oil Red O staining solution and gently rinse the cells with 60% isopropanol for 1-2 minutes to remove excess dye; wash the cells again with PBS twice for 5 minutes each time to completely remove unbound dye; observe and image the stained samples under an optical microscope. After taking pictures, 1 mL of isopropanol was added to each well of the cell wells of the 6-well plate to extract lipid droplets in the cells for quantitative analysis.

[0058] The results showed that overexpression SDR16C5 After , the number of lipid droplets in the cells was significantly higher than that in the control group (such as Figure 5 AC); the opposite result occurs after interference (such as Figure 5 DF). SDR16C5 It can promote the differentiation of mouse preadipocyte cell line 3T3-L1 and thus affect lipid deposition.

[0059] Based on the above results, SDR16C5 It can promote the differentiation of mouse preadipocyte cell line 3T3-L1 and thus affect lipid deposition.

[0060] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or make equivalent replacements for some of the technical features therein. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. SDR16C5 The use of the coding gene in regulating the proliferation of mouse preadipocyte cell line 3T3-L1 is characterized in that: Said SDR16C5 The CDS sequence of the coding gene is shown in SEQ ID No.

1. SDR16C5 The encoding gene inhibits the proliferation activity of the mouse preadipocyte cell line 3T3-L1.

2. SDR16C5 The use of the coding gene in regulating the differentiation of mouse preadipocyte cell line 3T3-L1 is characterized in that: Said SDR16C5 The CDS sequence of the coding gene is shown in SEQ ID No.

1. SDR16C5 The encoding gene promotes the differentiation of the mouse preadipocyte cell line 3T3-L1.

3. The use according to claim 2, characterized in that: Overexpression in the mouse preadipocyte cell line 3T3-L1 SDR16C5 After encoding the gene, lipid droplet deposition was increased in the mouse preadipocyte cell line 3T3-L1 cells.

4. The use according to any one of claims 1 to 3, characterized in that: use SDR16C5 Overexpression vector encoding gene SDR16C5 Overexpression of a gene encoding SDR16C5 The overexpression vector encoding the gene contains SDR16C5 The CDS region sequence of the coding gene, SDR16C5 The 5' end restriction site of the overexpression vector encoding the gene is BamhⅠ, and the 3' end restriction site is XhoⅠ.

Images