RPA primer pairs and RPA-LFD detection method for rapid detection of WSSV

Abstract

The present invention belongs to the technical field of nucleic acid detection, and specifically relates to an RPA primer pair and RPA-LFD detection method that can quickly detect WSSV. The present invention optimizes the RPA primer pair and RPA primer-probe combination based on a conservative sequence of the gene encoding the capsid protein of the white spot syndrome virus VP664, which has high specificity and low detection limit in detecting white spot syndrome virus, has no cross reaction with other viruses such as shrimp iris virus, and the detection limit can reach 100 copies of template. At the same time, the primer pair and primer-probe combination are suitable for RPA-LFD detection, and the reaction temperature can be set using a small constant temperature device, and the time required for the amplification reaction is short; the reaction result will be displayed on the test strip and can be observed with the naked eye, which is very suitable for on-site rapid detection of pathogens.

Description

Technical Field

[0001] The present invention belongs to the technical field of nucleic acid detection, and in particular relates to an RPA primer pair and an RPA-LFD detection method capable of rapidly detecting WSSV. Background Art

[0002] Recombinase Polymerase Amplification (RPA) is a new type of nucleic acid isothermal amplification technology developed in recent years based on recombinant polymerase. The principle is that the recombinase binds to the primer to form a protein-DNA complex, which can find homologous sequences in double-stranded DNA. Once the primer locates the homologous sequence, a chain exchange reaction will occur and initiate DNA synthesis, exponentially amplifying the target area on the template. The replaced DNA chain binds to the single-stranded DNA binding protein (SSB) to prevent further replacement.

[0003] Lateral flow device (LFD) is a simple consumable currently used for qualitative and semi-quantitative detection. RPA-LFD refers to a combination of RPA technology and LFD. The combination of the two can establish a rapid and sensitive visual on-site detection system. RPA-LFD is based on the RPA amplification principle. It uses biotin-labeled primers and FAM (6-carboxyfluorescein)-labeled probes to amplify the target nucleic acid. The final amplicon is both FAM-labeled and biotin-labeled. The front end of the LFD has gold nanoparticles with FAM antibodies, and the detection line has biotin antibodies. The product is dropped onto the test strip, and the FAM group on the amplicon reacts with the FAM antibody. The biotin antibody at the detection line binds to the biotin on the amplicon. Finally, a dark purple band is displayed on the detection line, and the uncaptured product binds to the specific antibody at the quality control line to display a dark purple band. RPA-LFD testing can be completed in 15 to 20 minutes and can be performed in an environment of 25 to 45°C. Therefore, accurate testing can be achieved with some simple heating equipment. RPA-LFD test results can be displayed on lateral flow test strips and can be observed with the naked eye. Even non-professionals can directly analyze the results, which is very suitable for rapid on-site testing.

[0004] RPA-LFD is a new pathogen detection technology that has been widely studied in the field of crop pathogen and livestock pathogen detection, but less studied in the field of aquatic animal pathogen detection.

[0005] White Spot Syndrome Virus (WSSV) is a pathogenic virus that infects shrimp (especially shrimp and other crustaceans) and belongs to the family White Spot Virus. WSSV is a large double-stranded DNA virus that causes white spot syndrome after infection, resulting in obvious white spots on the shrimp body, loss of appetite, worsening disease symptoms, and ultimately large-scale mortality. The virus is highly pathogenic and contagious, causing serious economic losses to the marine aquaculture industry. Controlling and preventing the spread of WSSV is the focus of current aquaculture research and management.

[0006] In this regard, CN115786593A provides a primer-probe combination and a kit for detecting white spot syndrome virus in shrimp. Xiaoming Xia et al. also provide a new real-time isothermal recombinase polymerase amplification (RPA) method for detecting WSSV in "Rapid Detection of Shrimp White Spot Syndrome Virus by Real Time, Isothermal Recombinase Polymerase Amplification Assay", but the target sequence they target is the VP28 gene, and professional instruments are still needed to analyze the results, which is not suitable for rapid on-site detection. Summary of the invention

[0007] The first object of the present invention is to provide an RPA primer pair for detecting White Spot Syndrome Virus, wherein the RPA primer pair comprises an upstream primer and a downstream primer, wherein the nucleotide sequence of the upstream primer is as follows: 5'-AGGAATATTGGAATGTCATCGCCAGCACGTGTG -3' (SEQ ID No. 1); the nucleotide sequence of the downstream primer is as follows: 5'-CTTGGCAGAGCATTCTGGATCAGTTCAGATTCG -3' (SEQID No. 2).

[0008] The second object of the present invention is to provide an RPA primer-probe combination, which comprises: the primer pair and the probe; the modified nucleotide sequence of the probe is as follows: 5'-fluorescent group-CAAGGGAACTGTCGCTTCAGCCATGCCAGCCGTC-dSpacer-TCCAGGCAACCGATG-alkyl carbon spacer-3' (SEQ ID No. 3).

[0009] The third object of the present invention is to provide a reagent, which contains the RPA primer pair or the RPA primer-probe combination.

[0010] The fourth object of the present invention is to provide a kit, which contains the RPA primer pair or the RPA primer-probe combination.

[0011] The fifth object of the present invention is to provide the use of the RPA primer pair or the RPA primer probe combination in the preparation of a reagent or a kit, wherein the reagent or kit is applied to at least one of the following aspects:

[0012] 1) Used to detect white spot syndrome virus;

[0013] 2) Used for the diagnosis or auxiliary diagnosis of diseases related to white spot syndrome virus infection.

[0014] The sixth object of the present invention is to provide an RPA-LFD detection method for detecting white spot syndrome virus (including diagnostic and non-diagnostic purposes), which comprises: using the RPA primer pair, or the RPA primer probe combination, or the reagent, or the kit to perform an RPA reaction on the nucleic acid of the sample to be tested, and then using a lateral flow immunoassay strip to detect the reaction product.

[0015] The present invention optimizes the RPA primer pair and RPA primer probe combination based on a conservative sequence of the gene encoding the capsid protein of the white spot syndrome virus VP664, which has high specificity and low detection limit in detecting white spot syndrome virus, has no cross reaction with other viruses such as shrimp iris virus, and the detection limit can reach 100 copies of template. At the same time, the primer pair and primer probe combination are suitable for RPA-LFD detection, and the reaction temperature can be set using a small constant temperature device, and the time required for the amplification reaction is short; the reaction results will be displayed on the test strip and can be observed with the naked eye, which is very suitable for on-site rapid detection of pathogens. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] In order to more clearly illustrate the specific implementation methods of the present invention or the technical solutions in the prior art, the drawings required for use in the specific implementation methods or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are some implementation methods of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0017] Figure 1 : This is the RPA-LFD detection result of the white spot syndrome virus in the embodiment of the present invention; in this figure, N is the negative control; P is the positive control, that is, the white spot syndrome virus DNA.

[0018] Figure 2 It is the specificity determination result in the example of the present invention; In this figure, N: negative control; P: positive control; 1: STIV; 2: SHIV; 3: GFHNV; 4: KHV, 5: EHP.

[0019] Figure 3 The detection limit determination results in the examples of the present invention; in the figure, N: negative control; 1: template amount 10 1 copies; 2: template amount 10 2 copies; 3: template quantity 10 3 copies; 4: template amount 10 4 copies; 5: template quantity 10 5 copies; 6: template amount 10 6 copies; 7: template amount 10 7 copies; 8: template amount 10 8 copies.

[0020] Figure 4 The detection limit test results in the comparative example of the present invention; in this figure, N: negative control; 1: template amount 10 1 copies; 2: template amount 10 2 copies; 3: template quantity 10 3 copies; 4: template amount 10 4 copies; 5: template quantity 10 5 copies; 6: template amount 10 6 copies; 7: template amount 10 7 copies; 8: template amount 10 8 copies. DETAILED DESCRIPTION

[0021] The specific embodiments of the present invention are described in detail below. It should be understood that the specific embodiments described herein are only used to illustrate and explain the present invention, and are not used to limit the present invention. Those skilled in the art may make various modifications and changes to the present invention without departing from the scope or spirit of the present invention. For example, a feature described or illustrated as part of one embodiment may be used in another embodiment to produce a further embodiment.

[0022] Unless otherwise indicated, the meaning of all terms (including technical and scientific terms) used to disclose the present invention is the same as that commonly understood by those of ordinary skill in the art to which the present invention belongs. By way of further guidance, the following definitions are used to better understand the teachings of the present invention. The terms used herein in the specification of the present invention are only for the purpose of describing specific embodiments and are not intended to limit the present invention.

[0023] The terms "and / or", "or / and", and "and / or" used in this article include any one of two or more related listed items, and also include any and all combinations of related listed items, and the arbitrary and all combinations include any two related listed items, any more related listed items, or a combination of all related listed items. It should be noted that when at least three items are connected by at least two conjunctions selected from "and / or", "or / and", and "and / or", it should be understood that in this application, the technical solution undoubtedly includes technical solutions that are all connected by "logical and", and undoubtedly includes technical solutions that are all connected by "logical or". For example, "A and / or B" includes three parallel solutions of A, B and A+B. For example, the technical solution of "A, and / or, B, and / or, C, and / or, D" includes any one of A, B, C, and D (that is, the technical solution that is all connected by "logical OR"), and also includes any and all combinations of A, B, C, and D, that is, the combination of any two or any three of A, B, C, and D, and also includes the combination of four of A, B, C, and D (that is, the technical solution that is all connected by "logical AND").

[0024] As used herein, the terms "comprising", "including" and "comprising" are synonymous and are inclusive or open-ended and do not exclude additional, unrecited members, elements or method steps.

[0025] Numerical ranges expressed as endpoints herein include all numbers and fractions subsumed within the range, as well as the recited endpoints.

[0026] The present invention relates to concentration values, and the meaning includes fluctuations within a certain range. For example, it can fluctuate within a corresponding precision range. For example, 2%, it is allowed to fluctuate within ±0.1%. For values ​​that are large or do not require too fine control, it is also allowed to have a greater fluctuation. For example, 100mM, it is allowed to fluctuate within the range of ±1%, ±2%, ±5%, etc. Involving molecular weight, it is allowed to have a fluctuation of ±10%.

[0027] In the present invention, descriptions such as "plurality" and "multiple" refer to quantities greater than or equal to 2 unless otherwise specified.

[0028] In the present invention, the technical features described in an open manner include closed technical solutions composed of the listed features, and also include open technical solutions containing the listed features.

[0029] In the present invention, “preferred”, “better”, “more preferred” and “suitable” are only used to describe implementation methods or examples with better effects. It should be understood that they do not constitute limitations on the scope of protection of the present invention.

[0030] In the present invention, "optionally", "optional", "optionally", "optionally", "optional", "optional", "optional" means optional, that is, it means to be selected from any one of the two parallel schemes of "yes" or "no". If multiple "optional" or "optional" appear in a technical solution, unless otherwise specified and there is no contradiction or mutual restriction, each "optional" or "optional" is independent.

[0031] The present invention first provides an RPA primer pair for detecting White Spot Syndrome Virus (WSSV). The RPA primer pair comprises an upstream primer and a downstream primer, wherein the nucleotide sequence of the upstream primer is as follows: 5'-AGGAATATTGGAATGTCATCGCCAGCACGTGTG -3' (SEQ ID No. 1); the nucleotide sequence of the downstream primer is as follows: 5'-CTTGGCAGAGCATTCTGGATCAGTTCAGATTCG -3' (SEQID No. 2).

[0032] The present invention found that the above primer pair can significantly improve the detection effect of WSSV, has better specificity and lower detection limit, and can achieve efficient amplification effect under lower isothermal conditions (37°C) (amplification reaction time only requires 15 minutes).

[0033] Furthermore, the present invention also provides an RPA primer-probe combination, which comprises: the primer pair and the probe; the modified nucleotide sequence of the probe is as follows: 5'-fluorescent group-CAAGGGAACTGTCGCTTCAGCCATGCCAGCCGTC-dSpacer-TCCAGGCAACCGATG-alkyl carbon spacer-3' (SEQ ID No. 3).

[0034] In some embodiments, the 5' end of the downstream primer is modified with a Biotin group.

[0035] In some embodiments, the fluorescent group is selected from one of FAM (Fluorescein amidite), HEX (Hexachloro-fluorescein), TET (Tetrachlorofluorescein), Cyanine dye, ROX (Carboxy-X-rhodamine), and Texas Red. In some specific embodiments, the fluorescent group is FAM.

[0036] In some embodiments, the alkyl carbon spacer is selected from one of C2 Spacer, C3 Spacer and C4 Spacer. In some specific embodiments, the alkyl carbon spacer is C3 Spacer.

[0037] In a specific embodiment, the modified nucleotide sequence of the probe is as follows: 5'-FAM-CAAGGGAACTGTCGCTTCAGCCATGCCAGCCGTC-dSpacer-TCCAGGCAACCGATG-C3 Spacer-3'.

[0038] Furthermore, the present invention also provides a reagent, which contains the RPA primer pair or the RPA primer-probe combination.

[0039] In some specific embodiments, the reagent further contains a solvent for dissolving the primer pair or the primer-probe combination as described above, such as TE buffer (Tris-EDTA buffer) or other solvents suitable for DNA stabilization.

[0040] The present invention also provides a kit, which contains the RPA primer pair or the RPA primer-probe combination.

[0041] In some embodiments, the kit further comprises: a nucleic acid detection test strip.

[0042] In some embodiments, the nucleic acid detection test strip is a lateral flow device (LFD).

[0043] In some specific embodiments, the kit further contains: an RPA enzyme mixture; the RPA enzyme mixture contains a recombinase, a single-stranded binding protein (SSB) and a DNA polymerase. These are core components of the RPA reaction known in the art. In some embodiments, the individual components in the RPA enzyme mixture can also be provided separately.

[0044] In some specific embodiments, the kit further comprises: a reaction buffer; the reaction buffer is used to provide an ionic environment and necessary chemical conditions suitable for RPA enzyme activity.

[0045] In some embodiments, the kit further comprises: Mg² + In some specific embodiments, Mg² is provided in the form of Mg-acetate. + Mg² + It is required for DNA polymerase activity as known in the art.

[0046] In some specific embodiments, the kit further contains: a stabilizer and a preservative to ensure the stability of the kit during storage and use.

[0047] In some specific embodiments, the kit further comprises: a detergent to help reduce inhibitors in the sample and improve amplification efficiency.

[0048] In some embodiments, the kit further comprises: a positive control and / or a negative control. For verifying the accuracy and specificity of the RPA reaction. In some embodiments, the positive control comprises a polynucleotide fragment having a sequence as shown in SEQ ID No. 4.

[0049] In some embodiments, the kit further comprises: extraction and dilution buffers. If the kit is designed to detect directly from complex samples, it may contain buffers for sample lysis and DNA release.

[0050] In some specific embodiments, the kit further comprises: instructions for providing detailed operating steps, reaction conditions, usage guidelines and precautions.

[0051] Other components in the kit mentioned in the present invention can be obtained through commercial channels, and can be provided in multiple or one reagent in the form of a single reagent or a combination.

[0052] Furthermore, the present invention also provides the use of the RPA primer pair or the RPA primer-probe combination in preparing a reagent or a kit, wherein the reagent or the kit is applied to at least one of the following aspects:

[0053] 1) Used to detect white spot syndrome virus;

[0054] 2) Used for the diagnosis or auxiliary diagnosis of diseases related to white spot syndrome virus infection.

[0055] In some specific embodiments, the diseases associated with white spot syndrome virus infection include, but are not limited to, one or more of White Spot Syndrome (WSS), Red Body Disease, myonecrosis, digestive tract lesions, and immune system failure. These diseases often occur in shrimps and other invertebrates infected by WSSV.

[0056] The present invention also provides an RPA-LFD detection method for detecting white spot syndrome virus (including diagnostic purposes and non-diagnostic purposes), which comprises: using the RPA primer pair, or the RPA primer probe combination, or the reagent, or the kit to perform an RPA reaction on the nucleic acid of the sample to be tested, and then using a lateral flow immunoassay strip to detect the reaction product.

[0057] The present invention also provides an RPA-LFD detection method for diagnosing or assisting in the diagnosis of diseases associated with white spot syndrome virus infection, which comprises: using the RPA primer pair, or the RPA primer probe combination, or the reagent, or the kit to perform an RPA reaction on the nucleic acid of a sample to be tested, and then using a lateral flow immunoassay strip to detect the reaction product.

[0058] In specific implementation, when only the C line (control band) appears on the nucleic acid test strip (such as LFD), the test result is WSSV nucleic acid negative; if the C line and T line (test band) appear at the same time, the test result is WSSV nucleic acid positive.

[0059] During specific implementation, those skilled in the art can confirm the reaction system and reaction conditions of RPA detection based on common sense.

[0060] In some embodiments, each 50 μL reaction system contains 21±3 pmoL of upstream primer, 21±3 pmoL of downstream primer, and 6±1 pmoL of probe.

[0061] In some embodiments, the reaction temperature of the RPA reaction is 37±1°C.

[0062] In some embodiments, the reaction time of the RPA reaction is 15±2 min. The method of the present invention can achieve a better amplification result in 15 min. The upper limit mentioned here is more based on the consideration of detection efficiency. In actual detection, the reaction time here can also be extended.

[0063] In some embodiments, the reaction product may be diluted first, and then the diluted reaction product may be detected using a lateral flow immunoassay strip.

[0064] In some embodiments, the temperature for testing using the lateral flow immunoassay strip is room temperature.

[0065] In some embodiments, the time for detection using the lateral flow immunoassay strip is 5±1 min. In the method of the present invention, a better detection result can be achieved in 5 min. The upper limit mentioned here is more based on the consideration of detection efficiency. In actual detection, the time here can also be extended.

[0066] By optimizing the reaction system and reaction conditions, the specificity of the method of the present invention is enhanced, there is no cross reaction with other viruses, and no nonspecific amplification; the detection limit is reduced, and the template amount can reach 100 copies; the target gene can be detected in just 20 minutes, while the traditional nested PCR takes about 3 to 4 hours, and the fluorescent PCR takes 1 to 1.5 hours.

[0067] Embodiments of the present invention will be described in detail below in conjunction with examples. It should be understood that these examples are only used to illustrate the present invention and are not intended to limit the scope of the present invention. The experimental methods in the following examples that do not specify specific conditions are preferably referred to the guidance provided in the present invention, and can also be based on the experimental manual or normal conditions in this area, and can also be based on other experimental methods known in the art, or according to the conditions recommended by the manufacturer.

[0068] In the following specific embodiments, the measured parameters of raw material components may have slight deviations within the range of weighing accuracy unless otherwise specified. For temperature and time parameters, acceptable deviations caused by instrument test accuracy or operation accuracy are allowed.

[0069] The commercially available kits mentioned in the following examples are only examples. In fact, when using the primer pairs and primer-probe combinations of the present invention, those skilled in the art can configure the required reaction reagents based on common sense and are not limited to the commercially available kits mentioned in the following examples.

[0070] Example 1

[0071] The present invention uses a conserved sequence (SEQ ID No. 4) of the capsid protein encoding gene of white spot syndrome virus VP664 as a template to design and screen a set of RPA-LFD primer probes:

[0072] Upstream primer: 5′- AGGAATATTGGAATGTCATCGCCAGCACGTGTG -3′ (SEQ ID No .1);

[0073] Downstream primer: 5′- Biotin- CTTGGCAGAGCATTCTGGATCAGTTCAGATTCG -3′ (SEQ ID No. 2);

[0074] Probe: 5'-FAM-CAAGGGAACTGTCGCTTCAGCCATGCCAGCCGTC-dSpacer-TCCAGGCAACCGATG-C3 Spacer-3' (SEQ ID No. 3).

[0075] The target gene (138bp):

[0076] AGGAATATTGGAATGTCATCGCCAGCACGTGTGCACCGCCGACGCCAAGGGAACTGTCGCTTCAGCCATGCCAGCCGTCTTTCCAGGCAACCGATGGAAACGGTAACGAATCTGAACTGATCCAGAATGCTCTGCCAAG (SEQ ID No. 4).

[0077] After further optimization and exploration, the reaction system and specific detection method are as follows:

[0078] The reaction system was prepared using the FastRAA Nucleic Acid Amplification Kit (Test Strip Method) of Jiangsu Qitian Gene Biotechnology Co., Ltd., as shown in Table 1:

[0079] Table 1

[0080]

[0081] A metal bath apparatus was used, and the reaction conditions were: constant temperature at 37°C and reaction time of 15 min.

[0082] After the reaction is completed, extract 10 μL of the reaction product, add 90 μL 1ⅹPBS to dilute and mix; place the test strip sample area in the reaction solution, incubate at room temperature for 5 minutes, and observe the results. If only the C line (control band) appears on the test strip, the test result is WSSV nucleic acid negative; if both the C line and the T line (test band) appear, the test result is WSSV nucleic acid positive.

[0083] Water was used as negative control and white spot syndrome virus DNA was used as template (positive control). The test results are shown in Figure 1 From the results, it can be seen that the reaction system and reaction method of the present invention can detect white spot syndrome virus well.

[0084] Example 2

[0085] The reaction system and detection method in Example 1 were used, and the nucleic acids of Chinese soft-shelled turtle iridovirus (STIV), shrimp iridovirus (SHIV), crucian carp hematopoietic necrosis virus (GFHNV), koi herpesvirus (KHV) and shrimp enterocytosis (EHP) were used as templates for RPA-LFD amplification, white spot syndrome virus DNA was used as a positive control, and water was used as a negative control.

[0086] Test results are shown in Figure 2 The results show that the detection method established by the present invention is positive only when the white spot syndrome virus DNA is used as a template, and has no cross reaction with other viruses.

[0087] Example 3

[0088] The recombinant plasmid containing the target gene was diluted 10 times in a gradient manner, and the recombinant plasmid solution of each dilution was used as a template for RPA-LFD amplification, and water was used as a negative control.

[0089] Test results are shown in Figure 3 , the results show that: when the template amount is 100 copies, the test result is still positive; when the template amount is 10 copies, no T line can be seen, and it is judged to be negative. Therefore, the detection limit of the white spot syndrome virus RPA-LFD detection method established by the present invention is 100 copies of the template amount.

[0090] Comparative Example

[0091] This comparative example provides some of the primers screened out by the present invention and their detection limit effect data. The specific primer probe sequences are shown in Table 2, and the specific determination method of the detection limit is the same as in Example 3.

[0092] Table 2 Eliminated primer probe sets

[0093]

[0094] Test results are shown in Figure 4 From this result, it can be seen that under the same reaction system and reaction conditions, the detection limit of primer probe set 1 is about 10 4 The detection limit of primer probe set 2 is about 10 6 The template amount of each copy is higher than that of the primer probe set of the present invention.

[0095] The above-mentioned embodiments only express several implementation methods of the present invention, and the description is relatively specific and detailed, but it cannot be understood as limiting the scope of the invention patent. It should be pointed out that for ordinary technicians in this field, several modifications and improvements can be made without departing from the concept of the present invention, which all belong to the protection scope of the present invention.

Claims

1. An RPA primer-probe combination for detecting White Spot Syndrome Virus, comprising a primer pair and a probe; in, The primer pair comprises an upstream primer and a downstream primer. The nucleotide sequence of the upstream primer is as follows: 5'- AGGAATATTGGAATGTCATCGCCAGCACGTGTG -3'; The nucleotide sequence of the downstream primer is as follows: 5'-CTTTGGCAGAGCATTCTGGATCAGTTCAGATTCG -3'; The modified nucleotide sequence of the probe is as follows: 5'-Fluorophore-CAAGGGAACTGTCGCTTCAGCCATGCCAGCCGTC-dSpacer-TCCAGGCAACCGATG-Alkyl Carbon Spacer-3'.

2. The RPA primer-probe combination according to claim 1, wherein: The 5' end of the downstream primer is modified with a Biotin group.

3. The RPA primer-probe combination according to claim 1 or 2, wherein: The fluorescent group is selected from one of FAM, HEX, TET, Cyanine dye, ROX, and Texas Red; And / or, the alkyl carbon spacer is selected from one of C2 Spacer, C3 Spacer and C4 Spacer. 4 . A reagent comprising the RPA primer-probe combination according to any one of claims 1 to 3 .

5. A kit comprising the RPA primer-probe combination according to any one of claims 1 to 3. The kit according to claim 5 , further comprising: a lateral flow immunoassay test strip.

7. Use of the RPA primer-probe combination according to any one of claims 1 to 3 in the preparation of a reagent or a kit, wherein: The reagent or kit is applied to at least one of the following aspects: 1) Used to detect white spot syndrome virus; 2) Used for the diagnosis or auxiliary diagnosis of diseases related to white spot syndrome virus infection.

8. An RPA-LFD detection method for detecting white spot syndrome virus for non-diagnostic purposes, comprising: Using the RPA primer-probe combination described in any one of claims 1 to 3, or the reagent described in claim 4, or the kit described in claim 5 or 6, the nucleic acid of the sample to be tested is subjected to RPA reaction, and then the reaction product is detected using a lateral flow immunoassay strip.

9. The RPA-LFD detection method for detecting white spot syndrome virus for non-diagnostic purposes according to claim 8, wherein: Each 50 μL reaction system contained 21±3 pmoL of upstream primer, 21±3 pmoL of downstream primer and 6±1 pmoL of probe.

10. The RPA-LFD detection method for detecting white spot syndrome virus for non-diagnostic purposes according to claim 8 or 9, wherein: The reaction temperature of the RPA reaction is 37±1°C, and the reaction time is 15±2 min.

11. The RPA-LFD detection method for detecting white spot syndrome virus for non-diagnostic purposes according to claim 8, wherein: The temperature for testing using lateral flow immunoassay strips is room temperature and the time is 5±1 min.

Images