A marine-derived trichoderma viride strain and its application

Abstract

The present invention provides a marine-derived Trichoderma viride strain, and the deposit number thereof is CGMCCNO.40808. The Trichoderma viride strain provided by the present invention has biological activity against tobacco root black rot, and can be applied to the prevention and treatment of tobacco root black rot. The antibacterial activity of the crude extract is tested by an agar diffusion method, and the results show that the secondary metabolism crude of the screened marine fungus MFZ23111 strain has an obvious inhibitory effect on tobacco root black rot fungi.

Description

Technical Field

[0001] The invention belongs to the technical field of microbial screening application and disease prevention and control, and specifically relates to a marine-derived green Trichoderma strain and application thereof. Background Art

[0002] Tobacco rhizome diseases are important diseases in tobacco leaf production in my country, which seriously affect the yield and quality of tobacco leaves. In recent years, with the unreasonable planting and cultivation of tobacco such as long-term continuous cropping, shallow tillage, and large-scale application of nitrogen fertilizers, the service function of soil micro-ecosystem has declined, and the occurrence of tobacco root black rot has worsened. Tobacco root black rot is a fungal soil-borne disease caused by Ascomycetes. It can cause damage in both the seedling stage and the field stage, mainly harming the roots of tobacco plants. After the disease occurs, the root tissue becomes black and necrotic, resulting in poor growth or even death of the aboveground part, which is also called "rotten roots, black roots", etc.

[0003] As people pay more and more attention to their own health and living environment, the disadvantages of traditional chemical pest control measures have attracted great attention. The widespread use of chemical pesticides has led to an increase in pesticide residues in the environment, and the most prominent problems are the increase in pest resistance and the resurgence of pests and diseases. As countries around the world further understand the various social, environmental, and human health problems caused by chemical pesticides, more and more chemical pesticides are restricted or banned. As a new type of pesticide with low toxicity, low residue, and pests and diseases that are not easy to develop resistance, biological pesticides have naturally become a hot spot for the modern pesticide industry to pay attention to and try to develop, and their research and development and industrialization have also become a national strategic need.

[0004] Microbial pesticides are an important type of biological pesticides, including agricultural antibiotics and live microbial pesticides. Microbial pesticides are separated and purified from natural products. They can be used directly for pest control, or as lead compounds to synthesize new pesticides. These pesticides can retain the advantages of low toxicity and low residue of the original bioactive substances, while overcoming the shortcomings of some natural products such as poor stability and low activity, so that the potential of bioactive substances can be fully tapped.

[0005] Although the breeding of disease-resistant varieties plays a dominant role in the prevention and control of crop diseases, there is currently a lack of highly effective disease-resistant varieties suitable for promotion and planting. Chemical control is quick and low-cost. In recent years, the dosage and frequency of chemical control have been increasing to control diseases, which has controlled the diseases to a certain extent, but also brought many negative effects, such as environmental pollution, increased resistance levels, and ecological balance disruption. In order to ensure the safety of green and environmentally friendly tobacco production, the development of highly effective biocontrol agents as an important means of biological control is extremely urgent. Summary of the invention

[0006] The present invention aims to provide a marine-derived Trichoderma viride strain and its application, namely a Trichoderma viride strain screened from marine moss and its application in the prevention and treatment of tobacco root black rot.

[0007] The present invention first provides a green Trichoderma (Trichoderma viride) strain MFT23111 screened from marine disc moss, which has been deposited in the China General Microbiological Culture Collection Center on August 18, 2023, with the deposit address of No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing, and the deposit number is CGMCCNO.40808.

[0008] The MFT23111 strain screened by the present invention is used for preventing and treating tobacco root black rot, and can also be used for preparing products with the function of preventing and treating tobacco root black rot.

[0009] The present invention also provides a metabolite of the MFT23111 strain, and a specific preparation method thereof is as follows:

[0010] The fermentation supernatant of the MFT23111 strain was extracted with an extractant, and the obtained organic phase was concentrated, eluted with methanol, and then evaporated to dryness at room temperature to obtain the metabolites of the MFT23111 strain.

[0011] The extractant, as specifically described in the examples, is ethyl acetate.

[0012] The fermentation is carried out by inoculating the MFT23111 strain into the PDB seawater culture medium and fermenting at 28°C.

[0013] The MFT23111 strain with biological activity against tobacco root black rot obtained by the present invention can be used for the prevention and treatment of tobacco root black rot. The antibacterial activity of the crude extract was tested by an agar diffusion method. The results showed that the secondary metabolism crude of the screened marine fungus MFT23111 strain had a significant inhibitory effect on tobacco root black rot fungi. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] Figure 1 :The colony morphology of strain MFT23111 on PDA medium, the left is the front photo, and the right is the back photo;

[0015] Figure 2 :The inhibitory effect of secondary metabolites of strain MFT23111 on tobacco root black rot, where the left picture is strain MFT23111, the middle is blank control, and the right is drug control;

[0016] Figure 3 : TLC profile of secondary metabolites of strain MFT23111;

[0017] Figure 4 : HPLC spectrum of secondary metabolites of strain MFT23111. DETAILED DESCRIPTION

[0018] The strain of the present invention is described in detail below in conjunction with specific examples.

[0019] Example 1: Isolation, identification and cultivation of marine fungus MFT23111 strain

[0020] The moss collected from the first bathing beach in Qingdao, Shandong Province in June 2014 was placed on PDA culture medium (medium preparation method: peel potatoes, cut 200g into small pieces, add 1L of seawater and boil for 30min, filter through 4-6 layers of gauze, add 20g of glucose, dissolve, and use distilled water to replenish lost water. For solid culture medium, add 1.5-2% agar, sterilize at 121℃, and autoclave for 20min.) and cultured at 28℃. The MFT23111 strain was isolated and purified from a single spot. The strain was identified as Trichoderma viride by 18s rDNA ITS gene sequence analysis.

[0021] Its 18s rDNA ITS gene sequence is as follows:

[0022] AGATTCGCGACCCGGACCCGGGCCGGGATGTTCACAACCCTTTGTTGTCCGACTCTGTTGCCTCCGGG

[0023] GCGACCCTGCCTCCGGGCGGGGGCCCCGGGTGGACACTTCAAAACTCTTGCGTAACTTTGCAGTCTGA

[0024] GTAAATTTAATTAATAAATTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGC

[0025] AGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGC

[0026] GCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATT

[0027] GGGCGACGCGGTCCGCCGCGCGCCTCAAATCGACCGGCTGGGTCTTTCGTCCCCTCAGCGTTGTGGAA

[0028] ACTATTCGCTAAAGGGTGCCGCGGGAGGCCACGCCGTAAAACAACCCCATTTTCCAAGGTTGACCTCG

[0029] GATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAA (SEQ ID NO: 1).

[0030] Colony culture morphology and optimal culture conditions:

[0031] The MFT23111 strain was cultured on PDA medium for 7 days. The colony diameter was 2.5 cm, dark green, dense mud, with radial lines and smooth edges ( Figure 1 The optimal growth temperature of MFT23111 strain is 28℃, the optimal pH value is 10, the optimal culture time is 8d, and the optimal culture medium is seawater PDB medium.

[0032] The microscopic morphology is as follows:

[0033] The hyphae have septate branches, and the conidiophores are short lateral branches of the hyphae. The lateral branches are alternately branched, forming bottle-shaped stalks at the ends of the branches. The conidia are oval and clustered at the top of the stalks.

[0034] Example 2: Control effect of marine fungus strain MFT23111 on tobacco root black rot

[0035] The marine fungus MFT23111 strain was inoculated into PDB liquid medium and cultured at 28°C for about 40 days. After fermentation, the supernatant was extracted three times with an equal volume of ethyl acetate, and the obtained organic phase was concentrated under reduced pressure on a rotary evaporator, eluted with methanol, and evaporated to dryness at room temperature to obtain a crude metabolic extract of the MFT23111 strain.

[0036] The antibacterial activity of the crude extracts was tested by agar diffusion method.

[0037] Punch 3 holes (aperture 3mm) evenly along the center line of the culture dish, and insert the pathogenic fungus cake into the middle hole. Then, take 50μL of crude extract solution and add it to the holes on both sides, and culture it in a 28℃ incubator. Set prochloraz as the positive control and DMSO as the negative control, and set 3 replicates. Check and measure the antibacterial diameter after 2 to 10 days, and statistically analyze the antibacterial activity based on the measurement results.

[0038] The results showed that when the concentration of the secondary metabolite crude extract of the marine fungus MFT23111 strain was 10 mg / mL, the antibacterial diameter reached 51.34 mm and the inhibition rate was 64.53%, indicating that the MFT23111 strain screened by the present invention has a good control effect on tobacco root black rot and has a good promotion and application value.

[0039] Example 3: Activity of secondary metabolites of marine fungus strain MFT23111 against Myzus persicae

[0040] The marine fungus MFT23111 strain was inoculated into PDB liquid medium and cultured at 28°C for about 40 days. After fermentation, the supernatant was extracted three times with an equal volume of ethyl acetate, and the obtained organic phase was concentrated under reduced pressure on a rotary evaporator, eluted with methanol, and evaporated to dryness at room temperature to obtain a crude metabolic extract of the MFT23111 strain.

[0041] The toxicity of the crude extract of secondary metabolism to tobacco aphids was tested by the insect-leaf dipping method. Filter paper was placed in a petri dish (9 cm in diameter), and 1 mL of distilled water was added to maintain a suitable humidity. A tobacco leaf of appropriate size was immersed in the solution for 10 seconds, dried, and then placed in a petri dish. The tobacco leaf stalk was moisturized with absorbent cotton and water. The tobacco leaves with aphids were immersed in the diluted crude extract solution for 10 seconds, and 30 aphids (uniform size, healthy, wingless aphids) were picked and placed in the petri dish.

[0042] The results showed that the active ingredients of the crude extract of the secondary metabolism of the marine fungus MFT23111 strain had certain activity against tobacco aphids. At a concentration of 10 mg / mL, the 48-hour corrected mortality rate against tobacco aphids was 100%.

[0043] The above results show that the MFT23111 strain screened by the present invention has a good control effect on tobacco aphids and has a good value for promotion and application.

[0044] Example 4: Analysis of the richness of secondary metabolites of marine fungus strain MFT23111

[0045] The marine fungus MFT23111 strain was inoculated into liquid PDB medium and fermented at 28°C for about 40 days. After fermentation, the supernatant of the liquid PDB medium was extracted three times with an equal volume of ethyl acetate, and the obtained organic phases were concentrated under reduced pressure on a rotary evaporator, eluted with methanol, and evaporated to dryness at room temperature to obtain the crude secondary metabolic extracts of the liquid fermentation and solid fermentation of the MFT23111 strain.

[0046] The obtained crude extract of MFT23111 strain fermentation was dissolved in an appropriate amount of methanol and analyzed by thin layer chromatography (TLC) and high performance liquid chromatography (HPLC). The number of sample points on the thin layer plate, the richness, the number of chromatographic peaks and the ultraviolet absorption curve were compared and analyzed to analyze the variety richness and content of secondary metabolites of strain MFT23111 ( Figure 3 , Figure 4 ).

[0047] The TLC developing system was dichloromethane:methanol=10:1 or 20:1, and the color developing agent was anisaldehyde-sulfuric acid.

[0048] Table 2: HPLC standard procedure table

[0049] Time (min) Flow rate (mL / min) Methanol water 0-5 0.8 10％ 90％ 5-35 0.8 10％-100％ 90％-0 35-45 0.8 100％ 0 45-50 0.8 100％-10％ 0-90％ 50-60 0.8 10％ 90％

[0050] From the results, it can be seen that under the two culture methods, the strain MFT23111 has a high richness of secondary metabolites, with 4 obvious main chromatographic peaks and several secondary peaks.

[0051] The above results show that the strain screened by the present invention can be used for the prevention and treatment of tobacco root black rot, and its secondary metabolites also have obvious inhibitory effects on tobacco root black rot fungi.

Claims

1. A viride, characterized in that The preservation number of the green mold is CGMCC NO.40808.

2. Use of the green Trichoderma according to claim 1 in preventing and treating tobacco root black rot.

3. Use of the viride according to claim 1 in controlling tobacco aphid.

4. Use of the viride according to claim 1 in preparing products for preventing and treating tobacco root black rot or tobacco aphid.

5. A product for preventing and controlling tobacco root black rot or tobacco aphid, characterized in that: The product contains the live bacteria of the green mold according to claim 1.

6. The article according to claim 5, characterized in that The product also contains the metabolites of the green mold according to claim 1, and the metabolites are obtained by adding an extractant to the fermentation supernatant of the strain according to claim 1 for extraction, concentrating the obtained organic phase, eluting with methanol and evaporating to dryness at room temperature, wherein the extractant is ethyl acetate; and the fermentation is performed by inoculating the strain into a PDB seawater culture medium and fermenting at 28°C.

Images