MIRA-LFD kit and method for rapidly detecting alternaria kikuchiana

Abstract

The invention discloses an MIRA-LFD kit and method for rapidly detecting alternaria kikuchiana, and belongs to the technical field of rapid detection of plant diseases. The primer probe combination for rapidly detecting the alternaria kikuchiana is designed and screened by targeting the Alt a1 gene of the alternaria kikuchiana, and the primer probe combination is further developed into a freeze-dried product which can be stably stored and has good redissolution detection performance; according to the detection scheme, a NaOH solution (0.5 M) can be adopted to coarsely extract DNA at normal temperature, meanwhile, MIRA reaction can be completed by utilizing palm center temperature, and color development can be well performed on the colloidal gold test strip, so that field on-site detection of alternaria kikuchiana is effectively realized; moreover, the detection scheme also has the advantages of simplicity in operation, short detection time, no dependence on instruments and equipment, low detection limit, accuracy, reliability and the like, is convenient to popularize and use in grassroots, and has important significance on early diagnosis and precise prevention and treatment of the pear black spot.

Description

Technical Field

[0001] The invention belongs to the technical field of rapid detection of plant diseases, and particularly relates to a MIRA-LFD kit and a method for rapid detection of pear black spot pathogen. Background Art

[0002] Pear black spot is caused by Alternaria spp. fungi, which can occur during the growth and maturity of pear trees and is one of the important causes of early leaf fall and fruit rot in pear trees (Wang Qiong, 2021). Previous studies have shown that there are six different species of pathogens causing pear black spot in my country's main pear producing areas, including A. gaisen, A. alternata, A. tenuissima, A. arborescens, A. gossypin and A. longipes. Among them, A. tenuissima and A. alternata are the dominant species of pear black spot pathogens, with the widest distribution and an isolation rate of up to 94% (Li Yang, 2019).

[0003] Traditional identification methods for the pathogen of pear black spot disease include field symptom identification and diagnosis, fungal tissue isolation and culture, conidia morphological observation combined with molecular identification, etc. This detection method is stable and reliable, but it is time-consuming and requires professional personnel to operate. With the continuous development of molecular detection technology, Ma Haibo (2014) established a real-time fluorescence PCR for rapid detection of Korla pear black spot pathogen, and Li Yunfei et al. (2016) designed PCR primers for specific detection of Dangshan pear black spot pathogen for early disease diagnosis. Yang et al. (2019) targeted the Aacyt-b gene of A. alternata and designed a set of LAMP (loop-mediated isothermal amplification) detection primers. After reacting at a constant temperature of 65℃ for 1h, the color change was used to realize the visual detection of five pear black spot pathogens on pears, namely A. alternata, A. tenuissima, A. gaisen, A. arborescens and A. longipes. Yang Xue et al. (2022) targeted the AKT1 gene sequence of Alternaria gaisen, which regulates AK toxin, and established a basic RPA rapid detection method for detecting the pathogenic type of Alternaria gaisen, but the amplified product still needs to be displayed by gel electrophoresis and cannot be completely separated from laboratory conditions. On the one hand, the above molecular detection methods rely on specific experimental equipment, which is time-consuming and has complicated operating procedures. They are not suitable for field detection. On the other hand, the detection range of the six pathogens that cause pear black spot is limited.

[0004] Multienzyme isothermal rapid amplification (MIRA) is a new isothermal amplification technology developed in China based on recombinase. Unlike RPA and RAA, MIRA uses T4 phage DNA helicase gp41 protein and Streptomyces coelicolor recombinase recA to jointly open the double helix (Chen et al, 2021). Under the conditions of 37-42°C, the entire amplification process can be completed within 10-20 minutes (Tu et al, 2021). MIRA has been reported to be used in the rapid diagnosis of different types of pathogens in multiple fields, including the diagnosis of various clinical pathogens such as human SARS-CoV-2 virus, human neonatal cytomegalovirus HCMV, human pneumococcus, hemolytic Staphylococcus, and the diagnosis of animal diseases such as bovine coronavirus BCoVs and swine fever virus CSFV (Chen et al 2021, Liu et al 2024, Xing et al2024, Ji et al 2023, Ji et al 2023, Tu et al 2021). However, there are no reports on the actual application of MIRA rapid detection in the diagnosis of fungal diseases. Summary of the invention

[0005] In view of this, the present invention aims to develop a rapid detection scheme for the pathogen of pear black spot disease based on MIRA technology, and at the same time hopes to combine it with lateral flow chromatography test strips (Lateral flow dipstick, LFD) color development to achieve simple, rapid, specific and highly sensitive field visualization detection of pear black spot disease.

[0006] In order to achieve the above object, the present invention specifically adopts the following scheme:

[0007] The first aspect of the present invention provides a MIRA-LFD kit for rapid detection of pear black spot pathogen, which at least comprises the following MIRA detection primers and probes:

[0008] MIRA-Alt-1F: 5'-ACTACGTCTGGAAGATTTCCGAGTTCTACG-3',

[0009] MIRA-Alt-1R: 5'-Biotin-TAGTATATCTGAATCTGCGAAGTAATCGAAGG-3';

[0010] Probe MIRA-Alt-1P:

[0011] FAM-AACACTCGACTTCACCTGCTCTCACTCAGCCTHFACAAGCTTGAGGACCAC-C3-spacer.

[0012] Preferably, in the above MIRA-LFD kit, the MIRA detection primers and probes are in the form of freeze-dried microspheres; more preferably, the molar ratio of MIRA-Alt-1F, MIRA-Alt-1R and MIRA-Alt-1P in the freeze-dried microspheres is 1:1:0.3.

[0013] Preferably, the MIRA-LFD kit further comprises a DNA extraction reagent; in some embodiments of the present invention, the DNA extraction reagent is a 0.5 M NaOH solution.

[0014] The second aspect of the present invention provides a MIRA-LFD method for rapid detection of pear black spot pathogen, which comprises the following steps:

[0015] S1, extracting DNA from the sample to be tested;

[0016] S2, using the DNA obtained in step S1 as a template, using primers MIRA-Alt-1F, MIRA-Alt-1R and probe MIRA-Alt-1P to perform MIRA reaction;

[0017] S3. Using a colloidal gold test strip to color the reaction product obtained in step S2, and judging whether the sample to be tested contains pear black spot pathogens according to the color development result, wherein the pear black spot pathogens include A. gaisen, A. alternata, A. tenuissima, A. arborescens, A. gossypin and A. longipes.

[0018] In the MIRA-LFD method of the present invention, the samples to be tested include but are not limited to plant leaves, fruits, and the like.

[0019] Preferably, in the above MIRA-LFD method, step S1 specifically comprises: sampling from the lesions of leaves or fruits, extracting with NaOH solution at room temperature, and then taking the supernatant for the reaction in step S2.

[0020] Preferably, in the above MIRA-LFD method, the conditions of the MIRA reaction in step S2 are: constant temperature reaction at 35-37° C. for 6-15 min, or holding the reaction tube containing the MIRA reaction system in the palm of a latex glove for 12-15 min.

[0021] In the MIRA-LFD method of the present invention, the judgment method of step S3 is: if the colloidal gold test strip displays both the quality control line and the detection line, the sample to be tested contains pear black spot pathogen (i.e., a positive result); if the colloidal gold test strip only displays the quality control line, the sample to be tested does not contain pear black spot pathogen or the pear black spot pathogen content is lower than the detection limit (i.e., a negative result).

[0022] Compared with the prior art, the present invention has the following beneficial effects:

[0023] (1) The present invention is the first to apply MIRA rapid detection to fungal detection and successfully realizes field visualization detection of pear black spot pathogen, and has the advantages of simple operation, high sensitivity, and strong specificity.

[0024] (2) In order to achieve specific detection of six species of pear black spot pathogens, the present invention deeply explored the sequence differences of different species of pear black spot pathogens, selected the Alt a1 gene targeting pear black spot pathogens for the first time to design detection primers, and further screened out primer combinations that can specifically detect six species of pear black spot pathogens from numerous primer combinations that conform to the MIRA primer design principles through a large number of experiments.

[0025] (3) The primer-probe combination obtained by the screening of the present invention has excellent stability after being prepared into freeze-dried microspheres, and can still obtain accurate and reliable detection results when it is directly used for field visualization detection. This not only helps to further simplify the operation, but also the obtained freeze-dried product is easy to store and convenient to carry.

[0026] (4) The primer-probe combination provided by the present invention is suitable for crude extraction products of NaOH at room temperature, and the reaction can be completed in a short time using the palm temperature. At the same time, the obtained reaction product has a good color development effect on the colloidal gold test strip, thereby enabling rapid detection in the field, completely eliminating the dependence on instruments.

[0027] (5) The visualization detection method of the present invention can reduce the detection limit to 1×10 -7 ng / μL, which is much higher than conventional PCR detection, and is conducive to the early diagnosis of pear black spot disease; at the same time, the time of the entire detection process can be shortened to less than 25 minutes, effectively reducing the time cost.

[0028] (6) The detection scheme of the present invention is applicable to both pear leaf detection and pear fruit detection, and the detection objects cover 6 different species that cause pear black spot disease in major pear producing areas in China. At the same time, it can realize rapid field detection under the premise of accuracy and reliability. It can be seen that the scheme of the present invention has broad application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1The results of PCR and basicMIRA detection of 6 species of pear black spot pathogens using different MIRA primer combinations in Example 1 of the present invention;

[0030] Figure 2 The MIRA-LFD kit provided in Example 3 of the present invention;

[0031] Figure 3 This is a schematic diagram of the operation flow for realizing rapid field detection of pear black spot pathogen in Example 5 of the present invention;

[0032] Figure 4 This is a graph showing the change in brightness of the test strip under different reaction times of MIRA-LFD in Example 6 of the present invention;

[0033] Figure 5 Figure 6 is a sensitivity test result diagram of the MIRA-LFD method in Example 6 of the present invention; A is the PCR sensitivity test result under the condition of HB104 recombinant plasmid, and B is the MIRA-LFD sensitivity test result under the condition of HB104 recombinant plasmid;

[0034] Figure 6 This is a graph showing the specificity detection results of the MIRA-LFD method in Example 6 of the present invention;

[0035] Figure 7 The figures are the symptoms of pear fruit and leaves after inoculation with strain HB104 in Example 7 of the present invention and the corresponding PCR and MIRA-LFD test results; wherein A is the disease symptoms of fruit, B is the PCR test result of the crude extract of fruit diseased tissue, C is the MIRA-LFD test result of the crude extract of fruit diseased tissue, D is the disease symptoms of leaves, E is the PCR test of the crude extract of leaf diseased tissue, and F is the MIRA-LFD test of the crude extract of leaf diseased tissue;

[0036] Figure 8The figure is a diagram of the symptoms of field pear samples and the MIRA-LFD detection results in Example 8 of the present invention; wherein, samples 1-20, 23, 24, and 25 are pear leaf and fruit samples collected from the fruit tree teaching practice base of Huazhong Agricultural University from May to July 2024, and samples 1-20 are suspected of being infected with pear black spot (1-3, 7, and 10 varieties are "Yandang", 4 is "Zhongli No. 1", 5 and 6 are "Baozhu", 8 is "Mingyue", 9, 11-13, 17-20 are "Boduoqing", 14 is "Gold", 15 and 16 are "Crown"), 24 , 25 (variety "Gold") are healthy pear leaves and fruits, 23 fruit sample (variety "Boduoqing") is infected with pear black spot and pear anthracnose (the pear black spot disease site was selected during sampling), samples 21 and 22 (variety Jade) are other diseases collected from Jianning County, Fujian Province in July 2024, A is the disease symptoms of samples 1-20, B is the MIRA-LFD test results of samples 1-20, C is the disease symptoms of samples 21-25, and D is the MIRA-LFD test results of samples 21-25;

[0037] Fig. 9 It is a diagram showing the symptoms of pear samples directly taken in the field and the MIRA-LFD test results in Example 9 of the present invention; among them, samples 33-39 (33 and 35 are "Jinhua Zao", 34 is "Weining Dahuang", 36 is "Yandang", 37 is "Huangjin", 38 and 39 are "Boduoqing") are pear leaf and fruit samples collected from the fruit tree teaching practice base of Huazhong Agricultural University in early July 2024, A is the disease symptoms of samples 33-39, and B is the MIRA-LFD test results of samples 33-39 directly carried out in the field. DETAILED DESCRIPTION

[0038] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art to which the present invention belongs. The term "comprises" and any variation thereof in the specification and claims of the present invention are intended to cover non-exclusive inclusions.

[0039] In view of the problems of the existing technology of pear black spot pathogen detection scheme being complicated to operate, unable to be detected in the field, having low detection efficiency and limited detection range, the present invention has developed a MIRA-LFD kit and method for visually rapid detection of pear black spot pathogen based on multi-enzyme constant temperature rapid amplification technology. Specifically, the kit at least includes:

[0040] Colloidal gold test strips;

[0041] DNA extraction reagent, preferably 0.5 M NaOH solution;

[0042] MIRA-Alt-1F: ACTACGTCTGGAAGATTTCCGAGTTCTACG;

[0043] MIRA-Alt-1R: Biotin-TAGTATATCTGAATCTGCGAAGTAATCGAAGG;

[0044] MIRA-Alt-1P: FAMAACACTCGACTTCACCTGCTCTCACTCAGCCTHFACAAGCTTG AGGACCAC-C3-spacer.

[0045] In the kit of the present invention, the 5' end of the primer MIRA-Alt-1R is labeled with a Biotin modification group; the 5' end of the probe MIRA-Alt-1P is modified with a FAM antigen label, and a dSpacer (tetrahydrofuran, THF) is labeled in the middle position between the 5' end and the 3' end as the nfo recognition site, and the 3' end is labeled with a C3-spacer modification group.

[0046] Based on the kit of the present invention, the MIRA-LFD method provided by the present invention comprises the following steps:

[0047] (1) Extracting DNA from the sample to be tested;

[0048] (2) Using the extracted DNA as a template, construct a MIRA reaction system and perform a constant temperature amplification reaction;

[0049] (3) Using colloidal gold test strips to perform colorimetric detection on the product obtained in step (2); if the result shows both the quality control line and the test line, it is a positive result; if the result shows only one quality control line, it is a negative result.

[0050] In the above detection scheme, the template used can be a crude extraction product of NaOH at room temperature, and the constant temperature amplification reaction can be achieved at the palm temperature, thereby ensuring the realization of rapid field detection of pear black spot disease.

[0051] The technical solution of the present invention will be described clearly and completely below in conjunction with specific embodiments. It should be understood that the embodiments described herein are only used to illustrate and explain the present invention and are not used to limit the present invention.

[0052] The following examples involve a total of 6 strains of pear black spot pathogens and 3 other common pathogens on pear leaves and pear fruits (i.e., pear anthracnose pathogen strain PAFQ30, pear rot pathogen strain F-XJ-28, and pear ring spot pathogen strain LW-P), as shown in Table 1. The genomic DNA of the strains shown in Table 1 was extracted by scraping and collecting hyphae after culturing the strains for 7 days, grinding and pulverizing with liquid nitrogen, and the remaining steps were performed according to the instructions of the High-Efficiency Plant Genomic DNA Extraction Kit (Qingke Biology, Beijing), and the obtained DNA template was stored at -20°C for future use.

[0053] Table 1. Strains used in the detection of the examples

[0054]

[0055] Pear scab (Venturia nashicola) is also a common pathogen on pear leaves and pear fruits. Since the pear scab pathogen is a strain that is difficult to isolate and culture, the DNA of the pear scab pathogen used in the following examples is specifically obtained by directly grinding and extracting positive fruit samples that have been clearly infected with pear scab.

[0056] If no specific techniques or conditions are specified in the following examples, all of them are carried out according to the techniques or conditions described in the literature in the field or according to the product instructions; if the manufacturer of the reagents or instruments is not specified, they are all conventional products that can be obtained commercially.

[0057] Example 1

[0058] This example provides a MIRA-LFD detection system for the detection of pear black spot pathogen, which includes at least MIRA primers and probes, wherein the MIRA primers target the Alt a1 gene sequence of pear black spot pathogen, and the probe is located between the upstream and downstream primers and is complementary to the target fragment. Through the MIRA reaction of the MIRA primers, probes and the DNA of the sample to be tested, combined with the colloidal gold test strip, six pear black spot pathogens (i.e., A. gaisen, A. alternata, A. tenuissima, A. arborescens, A. gossypin and A. longipes) can be effectively and visually detected.

[0059] Specifically, the sequences of the MIRA-LFD primers and probes in this example are as follows:

[0060] MIRA-Alt-1F: 5'-ACTACGTCTGGAAGATTTCCGAGTTCTACG-3' (SEQ ID NO. 1);

[0061] MIRA-Alt-1R: 5'-Biotin-TAGTATATCTGAATCTGCGAAGTAATCGAAGG-3' (SEQ IDNO.2);

[0062] MIRA-Alt-1P:

[0063] FAMAACACTCGACTTCACCTGCTCTCACTCAGCCTHFACAAGCTTGAGGACCAC-C3-sp acer (SEQ ID NO. 3).

[0064] Compared with other MIRA primers that also target the Alt a1 gene, the MIRA primers used in this case have a more significant detection effect, such as the following two primers as controls:

[0065] Alt-2F: 5'-GAGAACAGCTTCATGGACTTCTCTTTCGAC-3' (SEQ ID NO. 4);

[0066] Alt-2R: 5'-GATGCTGGAAACATGTTAGTATATCTGAATC-3' (SEQ ID NO. 5).

[0067] There are a total of 4 combinations at this time, namely Alt-1F / Alt-1R (product size is 283bp), Alt-1F / Alt-2R (product size is 314bp), Alt-2F / Alt-1R (product size is 108bp), and Alt-2F / Alt-2R (product size is 138bp).

[0068] The gDNA of the six strains of pear black spot and the other three pathogenic strains PAFQ30, F-XJ-28 and LW-P, as well as the gDNA of the pear black spot positive fruit samples, were used to perform PCR reaction and basic MIRA reaction respectively using the above four primer combinations. It can be understood that Alt-1F in the above four primer combinations is completely consistent with MIRA-Alt-1F, and the only difference between Alt-1R and MIRA-Alt-1R is that the 5' end is not biotin labeled.

[0069] The PCR reaction system included: 12.5 μL 2×Taq Master Mix, 0.5 μL each of upstream and downstream primers, 1 μL template DNA, and ddH2O to 25 μL. The PCR amplification program was: 95°C pre-denaturation for 5 min; 95°C denaturation for 30 s, 60°C annealing for 30 s, 72°C extension for 15 s, 35 cycles; 72°C extension for 10 min. The obtained PCR products were detected by electrophoresis on 1.2% agarose gel, stained with 0.5 μg / mL ethidium bromide (EB), and observed in a gel imaging system.

[0070] The basic MIRA reaction is as follows: prepare the reaction system according to Table 2 (A buffer and B buffer are from the DNA Constant Temperature Rapid Amplification Kit (Basic Type) of Anpu Future Biotechnology Co., Ltd.), mix thoroughly and then centrifuge, place the reaction tube in a PCR instrument at 37°C for 30 minutes, dilute the reaction product 1-fold with 10μL ddH2O, add 20μL of extraction solution (chloroform: isopropanol = 1:1) in a fume hood for extraction, and centrifuge for about 5 minutes until stratification; take 3μL of the supernatant and mix with 10× Loading buffer, then spot the sample and perform electrophoresis at 120V.

[0071] Table 2 Basic MIRA reaction system (12.5 μL)

[0072]

[0073] The results are as follows Figure 1 As shown in the figure, in the common PCR reaction, the four primer combinations of Alt1-F / Alt1-R, Alt2-F / Alt1-R and Alt1-F / Alt2-R can simultaneously detect six species of pear black spot pathogen, while the detection efficiency of Alt2-F / Alt2-R is low and inconsistent. When the bsicMIRA reaction is performed with the primer combinations of Alt1-F / Alt1-R, Alt2-F / Alt1-R and Alt1-F / Alt2-R, the electrophoresis results show that the Alt1-F / Alt1-R combination has a significantly better detection effect on the six species of pear black spot pathogen.

[0074] Example 2

[0075] Based on the MIRA-LFD detection system in Example 1, this example provides a MIRA-LFD kit, which at least includes the following components:

[0076] ① The detection system containing MIRA-Alt-1F, MIRA-Alt-1R and MIRA-Alt-1P is shown in Table 3 (Abuffer and B buffer were purchased from Anpu Future Biotechnology Co., Ltd.):

[0077] Table 3 MIRA-LFD detection system

[0078]

[0079] ② Colloidal gold test strips (HybriDetect, purchased from Anpu Future Biotechnology Co., Ltd.).

[0080] ③Extraction reagent, i.e. 0.5M NaOH solution.

[0081] ④Other consumables, such as ddH2O, sampling pipette, etc.

[0082] Example 3

[0083] Based on the MIRA-LFD kit provided in Example 2, the inventors found that after the MIRA-LFD reaction system was prepared into freeze-dried microspheres, it could still be stably stored under ambient conditions. Therefore, this example further provides a freeze-dried detection kit that is more convenient for storage and carrying. Figure 3 As shown, the kit includes:

[0084] ① Freeze-dried microspheres, which contain MIRA-Alt-1F, MIRA-Alt-1R and MIRA-Alt-1P, and the molar ratio of MIRA-Alt-1F, MIRA-Alt-1R and MIRA-Alt-1P is 1:1:0.3; specifically, in addition to the MIRA primers and probes of the present invention, the freeze-dried microspheres in this example also include the complex enzyme powder of Anpu Future Biotechnology Co., Ltd. (including recombinase, single-stranded DNA binding protein, DNA polymerase, auxiliary protein and nuclease), and the freeze-dried microspheres are commissioned to Anpu Future Biotechnology Co., Ltd. to prepare.

[0085] ② Colloidal gold test strips (HybriDetect, purchased from Anpu Future Biotechnology Co., Ltd.).

[0086] ③Extraction reagent, i.e. 0.5M NaOH solution.

[0087] ④Other consumables, such as ddH2O, sampling pipette, etc.

[0088] Example 4

[0089] Based on Examples 1-3, this example provides a MIRA-LFD method for rapid detection of pear black spot pathogen, comprising the following steps:

[0090] S1, extracting DNA from the sample to be tested;

[0091] S2. Using the DNA sample obtained in step S1 as a template, a reaction system containing MIRA-Alt-1F, MIRA-Alt-1R and MIRA-Alt-1P was constructed (as shown in Table 4), and the reaction was carried out at 37°C for 15 min, and then the reaction tube was placed on ice for 2 min to terminate the reaction;

[0092] S3. Take 5 μL of MIRA reaction product, dilute it 20 times with 95 μL of ddH2O, take 50 μL of the diluted product and apply it to the sample well of the test strip, let it stand for 2 minutes to allow the test strip to fully develop color; if both the quality control line and the test line are displayed at the same time, it is a positive result, and if only one quality control line is displayed, it is a negative result.

[0093] Table 4 MIRA-LFD reaction system (12.5 μL)

[0094]

[0095] Example 5

[0096] In order to facilitate field testing, Figure 3 As shown, this example optimizes the MIRA-LFD method in Example 4, as follows:

[0097] Step S1: The sample to be tested is surface disinfected with 75% alcohol, 1-2 pieces of tissue slices of about 0.5 cm × 0.5 cm in size from the lesions of the affected pear leaves or fruits are taken into a 1.5 mL Eppendorf tube, 100 μL of NaOH solution (0.5 M) is added, the mixture is fully crushed with a blue gun tip and allowed to stand for 2 min, 5 μL of the supernatant is taken, and it is diluted 20 times with 95 μL of ddH2O and used as a template for the amplification reaction;

[0098] Step S2: After the reaction system is constructed according to Table 4 (when the kit in Example 3 is used, 10.5 μL of ddH2O is added with a rubber-tipped dropper to dissolve the freeze-dried microspheres, and 2 μL of the crude template is added and mixed), the isothermal reaction is achieved by wearing latex gloves and holding the reaction tube in the palm of the hand for 15 minutes;

[0099] Step S3: Take the MIRA reaction product, dilute it with ddH2O or directly apply it to the sample well of the test strip, and let it stand for 2 minutes to allow the test strip to fully develop color. The result interpretation is the same as in Example 4.

[0100] Example 6

[0101] Based on the MIRA-LFD method in Example 4, this example verifies its reaction time, specificity and sensitivity, including the following:

[0102] (1) Effect of MIRA-LFD reaction time.

[0103] At a reaction temperature of 37°C, the recombinant plasmid of HB104 (the target fragment of strain HB104 was amplified by Alt-1F / Alt-1R primers, and the purified PCR product was recovered and connected to the pMD18-T vector to obtain the recombinant plasmid. The preparation process can refer to the prior art and is not described here) was diluted to 10 ng / μL and used as the reaction template of MIRA-LFD. A total of 5 reaction time gradients of 3 min, 6 min, 9 min, 12 min and 15 min were set, and a negative control NTC (template was ddH2O) was set.

[0104] The results are as follows Figure 4 As shown, the detection band of the test strip becomes brighter as the reaction time increases. No detection band is shown on the test strip after 3 minutes of reaction, but a detection band is produced after 6 minutes of reaction. The brightness of the band after 15 minutes of reaction is significantly stronger than that after 9 minutes and 12 minutes of reaction, indicating that the brightness of the detection band is proportional to the reaction time and can be detected from 6 to 15 minutes.

[0105] (2) Sensitivity detection of MIRA-LFD reaction.

[0106] The recombinant plasmid of HB104 was diluted 10 times in series and then subjected to conventional PCR and MIRA-LFD reactions respectively.

[0107] The results are as follows Figure 5 As shown in Figure 2, the minimum concentration of recombinant plasmids that can be detected by conventional PCR is 1×10 -4 ng / μL, under the condition of MIRA-LFD reaction at 37℃ for 15min, the minimum concentration limit of the recombinant plasmid that can be effectively detected and the corresponding band can be clearly observed by taking pictures is 1×10 -7 ng / μL, the detection sensitivity is 1×10 higher than that of ordinary PCR 3 times.

[0108] (3) Specificity detection of MIRA-LFD primers.

[0109] DNAs of 10 pathogens (ie, the 9 pathogens shown in Table 1 + pear scab pathogen) were used as templates for MIRA-LFD reaction.

[0110] The results are as follows Figure 6 As shown, the test strips of 6 pear black spot pathogens were positive, while the pear anthracnose pathogen PAFQ30, pear black spot positive sample DNA, pear ring spot pathogen LW-P, pear rot pathogen F-XJ-28 and water control were negative, which was consistent with the PCR and basicMIRA reaction results in Example 1, proving that the detection system has good specificity.

[0111] Example 7

[0112] Based on the field detection method in Example 5, this example conducts real-time monitoring of the pathogen content in the process of artificially inoculating black spot pathogens in in vitro pear leaves and fruits during the disease process. The specific operation is as follows:

[0113] The pear black spot pathogen HB104, which had been cultured for 4 days, was artificially inoculated into detached Pyrus betulae leaves and Pyrus huangguanensis fruits by stabbing. Diseased tissues were obtained at 1 and 3 days after onset, and DNA was crudely extracted using NaOH solution (0.5 M). PCR and MIRA-LFD tests were performed (the reaction tube was held in the palm of the hand for reaction).

[0114] The results are as follows Figure 7 As shown, the PCR results showed that when the pathogen was infected for 3 days, the detection band of the diseased sample was significantly brighter than the detection band of the sample with low pathogen concentration after 1 day of infection; the MIRA-LFD results showed that the brightness of the detection bands after 1 day and 3 days of pathogen infection was equivalent, which could efficiently detect low-content pathogens.

[0115] From the above test results, it can be seen that the field on-site detection method provided by the present invention can realize the rapid detection of pear black spot pathogen, and the detection results are stable, and can also be used for early disease process detection.

[0116] Example 8

[0117] Based on the field detection method in Example 5, this example diagnosed suspected pear black spot disease samples in the field, and the specific operations were as follows:

[0118] A total of 25 field samples were collected, and DNA was crudely extracted using NaOH solution (0.5 M) and then subjected to MIRA-LFD detection (holding the reaction tube in the palm of the hand for reaction).

[0119] Test results such as Figure 8 As shown, samples 1-20 were all positive, and the strength of the detection lines of different samples varied, indicating that the samples were infected with black spot disease, indicating that the detection system established in this study was highly sensitive and valuable for field application. Samples 21-25 infected with other diseases and healthy samples were all negative, proving that the detection system had a high degree of detection specificity in the detection of field samples.

[0120] Example 9

[0121] Based on the test kit in Example 3 and the field detection method in Example 5, this example directly tested 4 pear leaf samples suspected of being infected with pear black spot disease, 2 pear fruits, and 1 healthy pear leaf sample in the field.

[0122] The results are as follows Fig. 9As shown, 6 diseased samples were tested positive, and healthy leaves were tested negative, indicating that the freeze-dried kit provided by the present invention also has good stability and can be applied to the detection of pear black spot pathogen in the field.

[0123] In summary, the MIRA-LFD kit and method provided by the present invention can accurately detect pear black spot pathogen, and have the advantages of simple operation method, high detection sensitivity, independence from laboratory instruments and equipment, easy storage and convenient carrying, etc., which can realize field detection of pear black spot disease and is conducive to promotion and use at the grassroots level.

[0124] It should be noted that the above embodiments are only part of the embodiments of the present invention rather than all the embodiments, and are only used to illustrate the technical solution of the present invention rather than to limit it. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative work are within the scope of protection of the present invention.

Claims

1. A MIRA-LFD kit for rapid detection of pear black spot pathogen, characterized in that: Include at least the following MIRA assay primers and probes: MIRA-Alt-1F: 5'-ACTACGTCTGGAAGATTTCCGAGTTCTACG-3', MIRA-Alt-1R: 5'-Biotin-TAGTATATCTGAATCTGCGAAGTAATCGAAGG-3'; Probe MIRA-Alt-1P: FAM-AACACTCGACTTCACCTGCTCTCACTCAGCCTHFACAAGCTTGAGGACCAC-C3-spacer.

2. The MIRA-LFD kit according to claim 1, characterized in that The MIRA detection primers and probes are in the form of freeze-dried microspheres.

3. The MIRA-LFD kit according to claim 2, characterized in that In the freeze-dried microspheres, the molar ratio of MIRA-Alt-1F, MIRA-Alt-1R and MIRA-Alt-1P was 1:1:0.

3.

4. The MIRA-LFD kit according to claim 1, characterized in that Also included is a DNA extraction reagent, preferably a 0.5 M NaOH solution.

5. A MIRA-LFD method for rapid detection of pear black spot pathogen, characterized in that: The following steps are involved: S1, extracting DNA from the sample to be tested; S2, using the DNA obtained in step S1 as a template, and performing a MIRA reaction using MIRA-Alt-1F, MIRA-Alt-1R and MIRA-Alt-1P described in claim 1; S3. Using a colloidal gold test strip to color the reaction product obtained in step S2, and judging whether the sample to be tested contains pear black spot pathogens according to the color development result, wherein the pear black spot pathogens include A. gaisen, A. alternata, A. tenuissima, A. arborescens, A. gossypin and A. longipes.

6. The MIRA-LFD method according to claim 5, characterized in that: The samples to be tested include plant leaves and fruits.

7. The MIRA-LFD method according to claim 6, characterized in that: Step S1 specifically includes: sampling from the lesions on leaves or fruits, extracting with 0.5M NaOH solution, and taking the supernatant for step S2.

8. The MIRA-LFD method according to claim 5, characterized in that: The MIRA reaction conditions are: constant temperature reaction at 35-37° C. for 6-15 min.

9. The MIRA-LFD method according to claim 5, characterized in that: The conditions of the MIRA reaction are as follows: holding the reaction tube containing the MIRA reaction system in the palm of a person wearing latex gloves and reacting for 12 to 15 minutes.

10. The MIRA-LFD method according to claim 5, characterized in that: In step S3, colloidal gold test paper When the colloidal gold test strip shows both the quality control line and the test line, the sample to be tested contains pear black spot pathogen; when the colloidal gold test strip shows only the quality control line, The sample to be tested does not contain pear black spot pathogen or the content of pear black spot pathogen is below the detection limit.

Images