Exosome targeted drug delivery system for in-vivo production and targeted delivery of siRNA

Abstract

The invention belongs to the field of naked plasmid gene therapy drugs, and particularly relates to an exosome targeted drug delivery system for in-vivo production and targeted delivery of siRNA. A myocardial cell specific peptide (CMP) gene is added to an original plasmid, so that exosome membrane protein (Lamp2b) is fused with CMP, the surface of an exosome membrane produced by the liver carries the myocardial cell specific peptide, exosomes reaching the heart are increased, and the siRNA presentation efficiency is also improved. The system comprises a plasmid, wherein the plasmid is obtained by adding a cardiac muscle cell specific peptide (CMP) gene in front of an exosome membrane protein Lamp2b gene sequence of the CMV-GFP-siRNA, so that the CMP-GFP-siRNA is obtained. Transporting the exosome to myocardial cells in a targeted manner; the siRNA in the myocardial cells is improved.

Description

Technical Field

[0001] The present application belongs to the field of naked plasmid gene therapy drugs, and specifically relates to an exosome targeted drug delivery system for producing and targetedly delivering siRNA in vivo. Background Art

[0002] RNA interference (RNAi) can specifically target mRNA and regulate its protein expression before its biogenesis, and is considered a promising therapeutic tool to manipulate the expression of disease-related genes. RNAi therapy has encountered many problems and has fallen far short of expectations in clinical translation. The development of RNAi therapy has gone through two major stages. In the first stage, small interfering RNAs (siRNAs) or chemically modified stable siRNAs were synthesized and directly injected for systemic delivery; however, these siRNAs could not effectively pass biological barriers to reach target genes. In the second stage, various delivery vehicles (e.g., lipid nanoparticles, cationic polymers, and viruses) or coupled ligands (e.g., triantennary acetylgalactosamine) were invented to improve the delivery efficiency of siRNA in vivo. In previous studies (Fu Z, Zhang X, Zhou X, et al. In vivo self-assembled small RNAs as a new generation of RNAi therapeutics. Cell Res. 2021; 31(6): 631-648. doi: 10.1038 / s41422-021-00491-z), combinatorial and programmable plasmids were designed to use the liver as a tissue chassis to guide the self-assembly of exogenous siRNAs into secretory exosomes and promote the systemic delivery of self-assembled siRNAs in vivo. However, before the modification, the exosomes produced by the liver were systematically delivered in the systemic circulation and could not be targeted to cardiomyocytes. Summary of the invention

[0003] After the original plasmid was injected into the mouse, the siRNA it expressed was not expressed at a high level in organs other than the liver, and the desired therapeutic concentration could not be achieved. By adding the cardiomyocyte-specific peptide (CMP) gene to the original plasmid, the exosome membrane protein (Lamp2b) was fused to CMP, so that the exosome membrane surface produced by the liver carried cardiomyocyte-specific peptides, the number of exosomes reaching the heart increased, and the efficiency of siRNA presentation also increased.

[0004] The technical solution of the present invention is as follows:

[0005] An exosome targeted drug delivery system for producing and targeted delivery of siRNA in vivo, the system comprising a plasmid, wherein the plasmid is obtained by adding a cardiomyocyte-specific peptide CMP gene in front of the exosome membrane protein Lamp2b gene of CMV-GFP-siRNA to obtain CMP-GFP-siRNA;

[0006]

[0007] The base sequence of the CMP gene is shown in SEQ ID No. 2, specifically 5'-TGGCTGAGCGAAGCGGGCCCGGTGGTGACCGTGCGCGCGCTGCGCGGCAC CGGCAGCTGG-3'.

[0008] Preferably, the plasmid CMP-GFP-siRNA can produce exosomes in the liver, the exosome membrane protein Lamp2b on the membrane surface of which is fused with the cardiac targeting polypeptide CMP, and then targeted into the cardiomyocytes when flowing through the heart through the blood circulation.

[0009] Preferably, the plasmid is cultured as follows:

[0010] (1) Transform the plasmid into Stbl3 competent cells and spread them on a solid culture dish containing spectinomycin;

[0011] (2) Pick a single clone colony and incubate it in a shake tube. Inoculate the bacterial solution into a shake bottle containing LB medium and incubate it. Perform plasmid extraction on the bacterial solution to obtain high-concentration and high-quality target plasmid.

[0012] Another object of the present invention is to protect the application of the above-mentioned exosome targeted drug delivery system in increasing the siRNA in cardiomyocytes.

[0013] Furthermore, the injection dose of the plasmid was 5 mg / kg per mouse, once every 2 days, for more than 7 injections.

[0014] The expression product of this plasmid in exosomes is EGFP-siRNA, which can complementarily pair with EGFP-mRNA in the cells of green fluorescent (GFP) transgenic mice, rendering EGFP-mRNA ineffective.

[0015] The injection dose of the plasmid of the present invention is 5 mg / kg per mouse, once every 2 days, for a total of 7 injections. In previous studies, the siRNA concentration in the liver was the highest 9 hours after the plasmid was injected; 9 hours after the 7th injection, the mice were perfused with 1xPBS and 4% PFA in the heart, and the heart and liver tissues were taken respectively to extract RNA from the tissues. The qPCR technology was used to analyze the GFP-siRNA level in the heart and liver of the mice 9 hours after the plasmid injection, and the GFP-mRNA level in the heart of the mice after 7 injections of the plasmid.

[0016] Beneficial Effects

[0017] Compared with the prior art, the present invention has the following beneficial effects: (1) The present invention can target exosomes for delivery to cardiomyocytes. (2) The present invention can increase siRNA in cardiomyocytes. (3) The present invention has no side effects on the heart. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 This is the plasmid map in Experiment 1;

[0019] Figure 2 is the expression level of liver GFP-siRNA in Experiment 2, reflecting the ability of the plasmid to produce siRNA;

[0020] Figure 3 is the expression level of cardiac GFP-siRNA in Experiment 2, reflecting the ability of exosomes to target the heart;

[0021] Figure 4 It is the expression level of cardiac GFP-mRNA in Experiment 2, reflecting the gene silencing effect of GFP-siRNA in the heart. DETAILED DESCRIPTION

[0022] Example 1: Plasmid preparation

[0023] (1) After receiving the molecular cloned plasmid from the entrusted company ( Figure 1 ), transformed into Stbl3 competent cells, and plated on a solid culture dish containing spectinomycin;

[0024] (2) Pick a single clone colony and place it in a 12 mL shaking tube and shake it at 37°C and 220 rpm for 16 h. Inoculate the small shaken bacterial solution into a 2 L shaking flask containing 1 L LB medium and shake it at 37°C and 220 rpm for 20 h. The obtained bacterial solution is used for plasmid extraction to obtain high-concentration and high-quality target plasmids.

[0025] Example 2: In vivo validation in mice

[0026] (1) Green fluorescent transgenic (GFP) mice were divided into three groups (3x3x3). One group was injected with CMV-ScrR negative control plasmid, and the other two groups were injected with CMV-GFP-siRNA plasmid before and after the transformation, respectively. The injection frequency was 48h / time, for a total of 7 injections, and the plasmid mass of each injection was 5 mg / kg.

[0027] (2) 9 hours after the seventh plasmid injection, the mice were perfused with 1xPBS and 4% PFA, and the heart and liver tissues were taken to extract RNA. The GFP-siRNA level in the heart and liver of the mice 9 hours after the plasmid injection and the GFP-mRNA level in the heart of the mice after the seventh plasmid injection were analyzed by qPCR. Figure 2 and Figure 3 It can be found that after the original plasmid (CMV-GFP-siRNA) and the modified plasmid (CMP-GFP-siRNA) were injected into mice, they could produce exosomes expressing siRNA in the liver. The ability of the CMP-GFP-siRNA group to transport GFP-siRNA to the heart was 4 times that of CMV-GFP-siRNA, and the targeted transport effect was obvious. Figure 4 It can be seen that the GFP-siRNA produced in the liver can exert normal effects. The CMP-GFP-siRNA group has the strongest ability to silence GFP-mRNA in cardiomyocytes, followed by the CMV-GFP-siRNA group.

Claims

1. An exosome targeted drug delivery system for producing and targeted delivery of siRNA in vivo, characterized in that: The system includes a plasmid, wherein the plasmid is obtained by adding a cardiomyocyte-specific peptide CMP gene in front of the exosome membrane protein Lamp2b gene of CMV-GFP-siRNA to obtain CMP-GFP-siRNA; The base sequence of the Lamp2b gene is shown in SEQ ID No. 1; The base sequence of the CMP gene is shown in SEQ ID No.

2.

2. The exosome targeted drug delivery system according to claim 1, characterized in that: The plasmid CMP-GFP-siRNA can produce exosomes in the liver, the exosome membrane protein Lamp2b on the membrane surface of which is fused with the cardiac targeting polypeptide CMP, and then targeted into the myocardial cells when flowing through the heart through the blood circulation.

3. The exosome targeted drug delivery system according to claim 1, characterized in that: The culture process of the plasmid is: (1) Transform the plasmid into Stbl3 competent cells and spread them on a solid culture dish containing spectinomycin; (2) Pick a single clone colony and incubate it in a shake tube. Inoculate the bacterial solution into a shake bottle containing LB medium and incubate it. Perform plasmid extraction on the bacterial solution to obtain high-concentration and high-quality target plasmid.

4. Use of the exosome targeted drug delivery system according to any one of claims 1 to 3 in increasing siRNA in cardiomyocytes.

5. The use according to claim 4, characterized in that: The injection dose of the plasmid was 5 mg / kg per mouse, once every 2 days, for more than 7 injections.

Images