Molecular breeding method for intermuscular spine passivating and thickening fish

Abstract

The invention provides a molecular breeding method for intermuscular spine passivating and thickening fishes, and belongs to the technical field of gene editing and aquatic organism breeding. The bmp8a gene of the fish is mutated by utilizing a CRISPR / Cas9 gene editing technology, so that the intermuscular spine passivated and thickened fish is obtained. The method disclosed by the invention is simple and easy to implement, a large number of mutant zebrafish capable of stably inheriting can be obtained through a gene knockout method, an important reference is also provided for accurate design and breeding of other cultured fishes, and the method can become an efficient technical means for obtaining new germplasm of fish with passivated and thickened intermuscular spines and has a wide application prospect. The method has important scientific research value and industrial application value.

Description

Technical Field

[0001] The invention belongs to the technical field of gene editing and aquatic biological breeding, and in particular relates to a molecular breeding method for fish with blunted and thickened intermuscular spines. Background Art

[0002] Intermuscular bones (IBs) are thin linear bones embedded in muscles formed by intramembranous ossification of tendons. They are also called intermuscular bones and intermuscular ossicles. They only exist in lower bony fish. However, the small size of intermuscular bones makes it difficult for humans to find them during consumption, so there is a risk of throat puncture or other digestive tract injuries caused by accidentally swallowing intermuscular bones. Summary of the invention

[0003] The purpose of the present invention is to provide a molecular breeding method for fish with blunted and thickened intermuscular spines. The molecular breeding method of the present invention can obtain fish with blunted and thickened intermuscular spines.

[0004] The present invention provides a gRNA, wherein the nucleotide sequence of the target site of the gRNA is shown as SEQ ID NO.1.

[0005] Preferably, the nucleotide sequence of the gRNA is as shown in SEQ ID NO.2.

[0006] The present invention also provides a nucleic acid encoding the gRNA described in the above scheme or a precursor encoding the gRNA.

[0007] The present invention also provides a CRISPR system for targeted editing of the bmp8a gene, comprising the gRNA or the nucleic acid described in the above scheme.

[0008] The present invention also provides a composition for targeted editing of the bmp8a gene, comprising: the CRISPR system and the Cas enzyme system described in the above scheme; the Cas enzyme system is selected from: a Cas enzyme or a nucleic acid encoding a Cas enzyme.

[0009] The present invention also provides a mutant of the bmp8a gene, which is based on the bmp8a gene and lacks the nucleotide sequence shown in SEQ ID NO.3.

[0010] The present invention also provides a reagent or kit for negatively regulating a bmp8a gene fragment, a bmp8a gene, the gRNA described in the above scheme, the nucleic acid, the CRISPR system, the composition or the mutant of the bmp8a gene for use in fish with blunted and thickened intermuscular spines or breeding of fish with blunted and thickened intermuscular spines; the nucleotide sequence of the bmp8a gene fragment is shown in SEQ ID NO.1.

[0011] The present invention also provides a molecular breeding method for fish with blunted and thickened intermuscular spines, comprising the following steps: microinjecting the composition described in the above scheme into fertilized eggs of fish for incubation.

[0012] Preferably, after the incubation, the fish obtained by the incubation are taken as the F0 generation; individuals with mutations are selected from the F0 generation, cultivated to sexual maturity, and mated with wild-type fish to obtain the F1 generation; individuals with mutations are selected from the F1 generation, cultivated to sexual maturity, and mated to obtain the F2 generation; homozygous mutant individuals are selected from the F2 generation to obtain fish with blunted and thickened intermuscular spines.

[0013] Preferably, the fish includes zebrafish or economic fish among bony fish.

[0014] The present invention provides a gRNA, characterized in that the nucleotide sequence of the target site of the gRNA is shown in SEQ ID NO.1. The target site of the present invention is located in the first exon of the zebrafish bmp8a gene, which is the optimal target site of the bmp8a gene. The gRNA of the present invention is used for gene editing technology to direct the editing of the zebrafish bmp8a gene, and a new germplasm of zebrafish with normal growth and development but blunt and thickened intermuscular spines can be obtained. The zebrafish with blunt and thickened intermuscular spines can be bred normally to expand the population, and the blunt and thickened intermuscular spines trait can be stably inherited, which can solve the problem of throat puncture or other digestive tract injuries caused by accidentally swallowing fish bones due to the small intermuscular spines that are difficult to find.

[0015] The present invention also provides a molecular breeding method for fish with blunt and thickened intermuscular spines, which uses CRISPR / Cas9 gene editing technology to mutate the bmp8a gene of fish, thereby obtaining fish with blunt and thickened intermuscular spines. The method of the present invention is simple and easy to implement. It has been verified that the present invention can obtain a large number of mutant zebrafish that can be stably inherited through the gene knockout method, and also provides an important reference for the precise design and breeding of other farmed fish. It can become an efficient technical means to obtain new germplasm of fish with blunt and thickened intermuscular spines, and has important scientific research value and industrial application value. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative labor.

[0017] Figure 1 This is a schematic diagram of local alizarin red bone staining of wild-type zebrafish (90 days after hatching), and the red arrow indicates the intermuscular spines;

[0018] Figure 2 This is a schematic diagram of local Alizarin red bone staining of mutant zebrafish (90 days after hatching). The red arrow indicates the intermuscular spines. DETAILED DESCRIPTION

[0019] The present invention provides a gRNA, wherein the nucleotide sequence of the target site of the gRNA is shown in SEQ ID NO.1, specifically: 5′-CGGGCGGCCTAGGCCTCA-3′.

[0020] The target site of the present invention is located in the first exon of the zebrafish bmp8a gene and is the optimal target site of the bmp8a gene.

[0021] In the present invention, the nucleotide sequence of the gRNA is shown in SEQ ID NO. 2, specifically: AATTAATACGACTCACTATAGGTGAGGCCTAGGCCGCCCGGTTTTAGAGCTAGAA ATAGC. The present invention has no particular limitation on the preparation method of the gRNA, and conventional methods in the art can be used.

[0022] The present invention also provides a nucleic acid encoding the gRNA described in the above scheme or a precursor encoding the gRNA.

[0023] In the present invention, the nucleotide sequence of the nucleic acid is shown in SEQ ID NO. 2. The present invention has no particular limitation on the method for preparing the nucleic acid, and conventional methods in the art may be used.

[0024] The present invention also provides a CRISPR system for targeted editing of the bmp8a gene, comprising the gRNA or the nucleic acid described in the above scheme.

[0025] The present invention also provides a composition for targeted editing of the bmp8a gene, comprising the CRISPR system and the Cas enzyme system described in the above scheme; the Cas enzyme system is selected from: a Cas enzyme or a nucleic acid encoding a Cas enzyme.

[0026] In the specific implementation of the present invention, the nucleic acid encoding the Cas enzyme includes zCas9 mRNA.

[0027] In the specific implementation of the present invention, the composition comprises gRNA and zCas9 mRNA; the concentration of the gRNA is 200 ng / μl; the concentration of the zCas9 mRNA is 500 ng / μL.

[0028] The present invention also provides a mutant of the bmp8a gene, which is based on the bmp8a gene and lacks the nucleotide sequence shown in SEQ ID NO.3, specifically: CCCCGGGCGGCCTAGGCCTC.

[0029] In the present invention, the nucleotide sequence shown in SEQ ID NO.3 is located in the first exon of the zebrafish bmp8a gene. In the present invention, the mutant is preferably based on the bmp8a gene, and the nucleotide sequence shown in SEQ ID NO.4 is mutated to the nucleotide sequence shown in SEQ ID NO.5.

[0030] In the present invention, the nucleotide sequence shown in SEQ ID NO.4 is specifically:

[0031] In the present invention, the nucleotide sequence shown in SEQ ID NO.5 is specifically:

[0032] The present invention also provides a reagent or kit for negatively regulating a bmp8a gene fragment, a bmp8a gene, the gRNA described in the above scheme, the nucleic acid, the CRISPR system, the composition or the mutant of the bmp8a gene for use in fish with blunted and thickened intermuscular spines or breeding of fish with blunted and thickened intermuscular spines; the nucleotide sequence of the bmp8a gene fragment is shown in SEQ ID NO.1.

[0033] In the present invention, the accession number of the bmp8a gene is: Gene ID: 561963, for details, see: bmp8a gene morphogenetic protein 8a [Danio rerio (zebrafish)].

[0034] In the present invention, the negative regulation of the bmp8a gene fragment includes knocking out the bmp8a gene fragment; the reagent or kit for knocking out the bmp8a gene fragment includes a CRISPR / Cas9 gene editing reagent. In the specific implementation of the present invention, the CRISPR / Cas9 gene editing reagent includes: the gRNA and Cas enzyme described in the above scheme; or, the gRNA and the nucleic acid encoding the Cas enzyme described in the above scheme.

[0035] The present invention also provides a molecular breeding method for fish with blunted and thickened intermuscular spines, comprising the following steps: microinjecting the composition described in the above scheme into fertilized eggs of fish for incubation.

[0036] In the specific implementation process of the present invention, DEPC water is used as a solvent to prepare a microinjection system; the microinjection system contains gRNA and zCas9 mRNA; the final concentration of the gRNA is 200ng / μl; the final concentration of the zCas9 mRNA is 500ng / μL. Further, the microinjection system also includes an indicator; the indicator includes phenol red; the final volume concentration of the phenol red is 0.2%; 1000 to 2000 fertilized eggs can be injected per 5μL of the microinjection system.

[0037] In the present invention, the fish fertilized eggs preferably include zebrafish fertilized eggs. In the specific implementation of the present invention, the zebrafish fertilized eggs are in the I-cell stage and are flatly laid in a culture dish.

[0038] In the present invention, the microinjection time is ≤40 min.

[0039] In the present invention, the incubation is preferably carried out in oxygenated water; the water temperature of the oxygenated water is preferably 23-28° C. The present invention has no special requirements on the oxygen content in the oxygenated water.

[0040] The present invention utilizes CRISPR / Cas9 gene editing technology to mutate the bmp8a gene of fish, thereby obtaining fish with blunted and thickened intermuscular spines.

[0041] After the incubation, the present invention uses the fish obtained by the incubation as the F0 generation; selects individuals with mutations from the F0 generation, cultivates them to sexual maturity, and then mates with wild-type fish to obtain the F1 generation; selects individuals with mutations from the F1 generation, cultivates them to sexual maturity, and then mates to obtain the F2 generation; selects homozygous mutant individuals from the F2 generation to obtain fish with blunted and thickened intermuscular spines.

[0042] In the present invention, the fish includes zebrafish or economic fish among bony fish.

[0043] In the present invention, the zebrafish with blunted and thickened intermuscular spines has a nucleotide sequence shown in SEQ ID NO.3.

[0044] In the present invention, when the fish is zebrafish, the method for screening individuals with mutations comprises the following steps: extracting zebrafish individual genomic DNA; using zebrafish individual genomic DNA and target detection primers to perform PCR amplification to obtain PCR amplification products; subjecting the PCR amplification products to 2.5% agarose gel electrophoresis, or subjecting the PCR amplification products to sequencing, screening individuals whose electrophoresis bands are non-single bands or sequencing results are non-single peaks, i.e., individuals with mutations.

[0045] In the present invention, the target detection primer includes a nucleotide sequence such as F1 shown in SEQ ID NO.6 and R1 shown in SEQ ID NO.7; the PCR amplification product includes a target site and a gene sequence near the target site; the nucleotide sequence of the PCR amplification product is shown in SEQ ID NO.8, specifically:

[0046]

[0047]

[0048] The italic and bold sequences are target site sequences, and the single underlined sequences are deletion sequences. In the present invention, the PCR amplification reaction system is 20 μL and consists of the following components: 10 μL of PCRMasterMix (Yisheng, Shanghai), 0.5 μL of upstream and downstream primers, 2 μL of genomic DNA template and 7 μL of sterile water; the reaction conditions of the PCR amplification were: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 30 s, annealing at 54°C for 30 s, extension at 72°C for 30 s, 35 cycles; and extension at 72°C for another 5 min.

[0049] In order to further illustrate the present invention, a molecular breeding method for fish with blunted and thickened intermuscular spines provided by the present invention is described in detail below in conjunction with the accompanying drawings and examples, but they should not be understood as limiting the scope of protection of the present invention.

[0050] Example 1

[0051] A molecular breeding method for zebrafish with blunted and thickened intermuscular spines, comprising the following steps:

[0052] (1) Design of gRNA target sites

[0053] The optimal target site of the bmp8a gene was designed and screened. The target site gRNA sequence in this example was located in the first exon of the zebrafish bmp8a gene; the nucleotides of the gRNA target site were shown in SEQ ID NO.1.

[0054] (2) In vitro synthesis of gRNA

[0055] Overlap PCR was performed using the conservative downstream primer Scaffold (5′-GATCCGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTT TAACTTGCTATTTCTAGCTCTAAAAC-3′, SEQ ID NO.9) and the upstream primer (5′-AATTAATACGACTCACTATAGGTGAGGCCTAGGCCGCCCGGTTTTAGAGCTAGAA ATAGC-3′, SEQ ID NO.10) containing the target site gRNA sequence with a T7 promoter. The PCR system was 25 μL and consisted of the following components: Primer starMix 10.5 μL, Scaffold 5 μL, gRNA 5 μL and ddH2O4.5 μL. The PCR reaction conditions were: 98°C pre-denaturation for 30 s; 98°C denaturation for 10 s, 64°C annealing for 10 s, 72°C extension for 15 s, 45 cycles; 72°C extension for 5 min. 5 μL of PCR product was subjected to 1.5% agarose gel electrophoresis. After the band size was verified to be correct, the PCR product was purified and recovered, and the concentration of the recovered product was measured using Nanodrop 2000 (Thermo Scientific, USA).

[0056] According to the instructions of the Transcriptaid T7 highyield transcription kit (Thermo Scientific, USA), gRNA was transcribed in vitro and purified and recovered using the lithium chloride precipitation method. The specific steps of the lithium chloride precipitation method are as follows: add 1 μL DNase I to the gRNA in vitro transcription system and incubate for 15 min to remove residual DNA, add 2 μL 0.2M EDTA to terminate the reaction, then add 2.5 μL 4M lithium chloride and 75 μL pre-cooled anhydrous ethanol, and precipitate at -20°C for 16 h; collect the precipitate by centrifugation, add 50 μL 70% pre-cooled ethanol to wash the precipitate, centrifuge to remove the ethanol, and add 25 μL DEPC water to dissolve the precipitate. Take 1 μL to detect the RNA concentration, and after detecting the gRNA quality by 1.5% agarose gel electrophoresis, store it in a -80°C refrigerator for use.

[0057] (3) In vitro transcription of zCas9 mRNA

[0058] The pT3TS-nCas9n plasmid was linearized using the restriction endonuclease XbaI (NEB, USA), and after confirmation of complete linearization by 1% agarose gel electrophoresis, it was recovered using the Gel Extraction Kit (Omega, USA) liquid purification kit. According to the instructions of T3mMESSAGE mMACHINE (Invitrogen, USA), zCas9 mRNA was transcribed in vitro, purified and recovered using the lithium chloride precipitation method, dissolved in enzyme-free water, and the concentration was detected using Nanodrop2000 (Thermo Scientific, USA). The quality of mRNA was detected by 1.5% agarose gel electrophoresis, and the qualified ones were stored in -80°C for use.

[0059] (4) Microinjection

[0060] Microinjection of wild-type zebrafish fertilized eggs. The injection system was prepared by mixing gRNA and zCas9 mRNA, in which the final concentration of gRNA was 200ng / μl, the final concentration of zCas9 mRNA was 500ng / μl, and phenol red was added as an indicator at a final concentration of 0.2%. The experimental samples were injected into zebrafish fertilized eggs at the I-cell stage and spread in a culture dish using a Picoliter Microinjector (Warner, PL-100A, USA). The injection is best completed within 40 minutes after the egg is fertilized. 1000 to 2000 fertilized eggs can be injected with each 5μl mixed reagent. After the injection is completed, the fertilized eggs are incubated in oxygenated water at a temperature of 23 to 28°C.

[0061] (5) Screening of mutant individuals in the F0 generation of zebrafish

[0062] Extract genomic DNA from the surviving zebrafish individuals in (4) and use target detection primers:

[0063] F1:5′-ACGAACCCGACTTTTCCCTC-3′, SEQ ID NO.6;

[0064] R1: 5′-GCGTCCCCCTGTCAGATAAG-3′, SEQ ID NO.7.

[0065] Amplify the target site and its nearby gene sequence; wherein the PCR reaction system is: 10 μL of PCR MasterMix (Yisheng, Shanghai), 0.5 μL of upstream and downstream primers, 2 μL of genomic DNA template, and 7 μL of sterile water. The PCR reaction conditions were: 94°C pre-denaturation for 5 min; 94°C denaturation for 30 s, 54°C annealing for 30 s, 72°C extension for 30 s, 35 cycles; 72°C extension for another 5 min. After amplification, 10 μL of PCR product was taken for 2.5% agarose gel electrophoresis, and individuals with non-single bands in the electrophoresis bands or non-single peaks in the sequencing results were detected and screened, which were zebrafish F0 generation individuals with mutations.

[0066] (6) Screening of mutant individuals in the F1 generation of zebrafish

[0067] After the F0 generation mutant zebrafish reached sexual maturity, they were mated with sexually mature wild-type zebrafish. After extracting the offspring genomic DNA, the target detection primers F1 and R1 were used to amplify the PCR products, and the mutant individuals were screened out by 2.5% agarose gel electrophoresis and sequencing (Qingke Biotechnology Co., Ltd., Wuhan) to form the F1 generation mutant population. The bmp8a gene sequence of the F1 generation mutant individuals was compared with the bmp8a gene sequence of the wild-type zebrafish to clarify the genotype of the F1 generation mutant individuals.

[0068] (7) Obtaining mutant zebrafish F2 individuals

[0069] After the F1 generation mutant individuals reach sexual maturity, male and female individuals with the same genotype are selected for mating to obtain mutant zebrafish F2 generation individuals.

[0070] (8) Genotype and phenotype analysis of mutant zebrafish F2 individuals

[0071] After extracting the progeny genomic DNA, the PCR product was amplified using the target detection primers, and the homozygous individuals with bmp8a mutation were screened by 2.5% agarose gel electrophoresis and sequencing (Qingke Biotechnology Co., Ltd., Wuhan). The target site gene sequence comparison between the wild-type zebrafish and the F2 generation homozygous mutant zebrafish showed that the wild-type target site sequence was shown in SEQ ID NO.2, and mutated to the nucleotide sequence shown in SEQ ID NO.3.

[0072] In order to observe the intermuscular spine phenotype of zebrafish F2 mutants, the zebrafish skeletal phenotype was observed by alizarin red whole skeleton staining method. The specific steps were as follows: zebrafish 3 months after hatching were fixed in 4% paraformaldehyde for 48 hours, and then rinsed in ddH2O water overnight; then bleached in a mixed solution of 3% H2O2 and 1% KOH with equal volumes for 4 hours; rinsed in ddH2O for 30 minutes; treated in 30% saturated borax solution for 12 hours; rinsed in ddH2O for 30 minutes; stained in a mixed solution of 1% alizarin red (Sigma) and 1% KOH for 12 hours; washed the excess alizarin red dye in 1% KOH solution; rinsed in a mixed solution of 1% trypsin (Solarbio) and 2% saturated borax for 3-5 days to remove impurities; gradient transparent in 50% and 100% glycerol and stored. The results showed that the skeleton of wild-type zebrafish developed normally, and its overall and local intermuscular spine phenotypes were Figure 1 As shown; the intermuscular spines of homozygous bmp8a mutant zebrafish are blunted and thickened, and their intermuscular spine phenotype is as follows Figure 2 shown.

[0073] Based on the results of genotype and phenotypic analysis of F2 individuals, it was found that all F2 individuals with blunted and thickened intermuscular spines had a genotype with frameshift mutation, revealing that the bmp8a gene is necessary for the development of intermuscular spines in zebrafish. At the same time, the destruction of the bmp8a allele can lead to blunted and thickened intermuscular spines in zebrafish.

[0074] Although the above embodiment describes the present invention in detail, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A gRNA, characterized in that The nucleotide sequence of the target site of the gRNA is shown in SEQ ID NO.

1.

2. The gRNA according to claim 1, characterized in that The nucleotide sequence of the gRNA is shown in SEQ ID NO.

2.

3. A nucleic acid, characterized in that Encoding the gRNA according to claim 1 or 2 or a precursor encoding the gRNA according to claim 1.

4. A CRISPR system for targeted editing of the bmp8a gene, characterized in that: Comprising the gRNA of claim 1 or 2 or the nucleic acid of claim 3.

5. A composition for targeted editing of the bmp8a gene, characterized in that: include: The CRISPR system and Cas enzyme system of claim 4; the Cas enzyme system is selected from: a Cas enzyme or a nucleic acid encoding a Cas enzyme.

6. A mutant of the bmp8a gene, characterized in that: Based on the bmp8a gene, the nucleotide sequence shown in SEQ ID NO.3 is deleted.

7. Use of a reagent or kit for negatively regulating a bmp8a gene fragment, a bmp8a gene, the gRNA according to claim 1 or 2, the nucleic acid according to claim 3, the CRISPR system according to claim 4, the composition according to claim 5 or the mutant of the bmp8a gene according to claim 6 in the breeding of fish with blunted and thickened intermuscular spines or fish with blunted and thickened intermuscular spines; the nucleotide sequence of the bmp8a gene fragment is shown in SEQ ID NO.

1.

8. A molecular breeding method for fish with blunted and thickened intermuscular spines, characterized in that: The following steps are involved: The composition of claim 5 is microinjected into fish fertilized eggs and incubated.

9. The molecular breeding method according to claim 8, characterized in that After the incubation, the fish obtained by the incubation are used as the F0 generation; Selecting individuals with mutations from the F0 generation, cultivating them to sexual maturity, and mating them with wild-type fish to obtain the F1 generation; Selecting the mutant individuals from the F1 generation, cultivating them to sexual maturity, and then mating them to obtain the F2 generation; Homozygous mutant individuals are screened from the F2 generation to obtain fish with blunted and thickened intermuscular spines.

10. The molecular breeding method according to claim 8 or 9, characterized in that: The fish include zebrafish or economic fish among bony fish.

Images