Application of lactobacillus plantarum metagen in preparation of product for relieving animal neuroinflammation

Abstract

The invention belongs to the technical field of microorganisms, and particularly relates to application of lactobacillus plantarum metabolite in preparation of a product for relieving animal neuroinflammation, the lactobacillus plantarum metabolite is a fermentation metabolite of lactobacillus plantarum HJZW08, the preservation number of the lactobacillus plantarum HJZW08 is CGMCC No. 23777, and the preservation number of the lactobacillus plantarum HJZW08 is CGMCC No. 23777. The invention provides an application of the lactobacillus plantarum metagen in preparation of a product for relieving animal neuroinflammation, and discloses that the lactobacillus plantarum metagen relieves piglet neuroinflammation through'microorganism-intestine-brain axis'.

Description

Technical Field

[0001] The invention relates to the technical field of microorganisms, and in particular to application of Lactobacillus plantarum postbiotics in preparing products for alleviating animal neuroinflammation. Background Art

[0002] Acute and chronic inflammation is an important factor leading to poor production performance, diseases and meat quality in livestock and poultry. Pathogenic lipopolysaccharide (LPS) is a key molecule that activates inflammation. It is reported that LPS can pass through the blood-brain barrier and cause neuroinflammation. The central nervous system controls various physiological activities. The damage to brain function caused by neuroinflammation will lead to systemic dysfunction in animals, such as decreased feed intake, abnormal behavior, anxiety, and metabolic and endocrine disorders, which will ultimately affect the growth performance and health of animals.

[0003] At present, antibiotic treatment is the main strategy for pathogens. However, it is difficult to eliminate pathogens in the brain with antibiotic treatment, and LPS is still released in large quantities after bacterial lysis. It is difficult to diagnose neuroinflammation clinically and the effect of antibiotic treatment is poor. Probiotics have been widely used in livestock and poultry production as an alternative to antibiotics, and their antibacterial and anti-inflammatory effects have been confirmed. In recent years, studies have found that probiotics can improve brain function and behavior by regulating intestinal flora, which is also called "psychobiotics". At present, there have been studies on the regulation of the "microorganism-gut-brain axis" by probiotics in the biomedical field, but no research has been reported in the livestock and poultry direction. Postbiotics refer to the inactivated bacteria or metabolites of probiotics. Studies have found that they have similar effects to probiotics, and have the advantages of being independent of cell activity, having a longer shelf life, and being easier to store and transport. However, there are no reports in the prior art on the use of postbiotics to alleviate animal neuroinflammation. Summary of the invention

[0004] In order to solve the above technical problems, the present invention provides the use of Lactobacillus plantarum postbiotics in the preparation of products for alleviating animal neuroinflammation.

[0005] Application of Lactobacillus plantarum postbiotics in the preparation of products for alleviating animal neuroinflammation, wherein the Lactobacillus plantarum postbiotics are fermentation metabolites of Lactobacillus plantarum HJZW08, and the preservation number of the Lactobacillus plantarum HJZW08 is CGMCC No.23777.

[0006] Preferably, the product is the Lactobacillus plantarum postbiotic;

[0007] The preparation method of the plant lactobacillus postbiotic comprises the following steps:

[0008] Inoculating the Lactobacillus plantarum HJZW08 into a broth medium to obtain a first bacterial liquid;

[0009] The first bacterial liquid is inoculated into a new broth medium to obtain a second bacterial liquid;

[0010] The cell-free fermentation supernatant of the second bacterial liquid is collected and filtered to obtain the Lactobacillus plantarum culture supernatant, i.e., the Lactobacillus plantarum postbiotics.

[0011] Preferably, the solid concentration in the Lactobacillus plantarum postbiotic is 30-40 mg / mL.

[0012] Preferably, the concentration of solids in the Lactobacillus plantarum postbiotic is 40 mg / mL.

[0013] Preferably, the concentration of solids in the Lactobacillus plantarum postbiotic is 30 mg / mL.

[0014] Preferably, the usage amount of the Lactobacillus plantarum postbiotic is 4-12 mL of the Lactobacillus plantarum postbiotic per 1 kg of basic diet.

[0015] Preferably, 8 mL of the Lactobacillus plantarum postbiotic is added to 1 kg of the basic diet.

[0016] Preferably, 6 mL of the Lactobacillus plantarum postbiotic is added to 1 kg of the basic diet.

[0017] Preferably, 10 mL of the Lactobacillus plantarum postbiotic is added to 1 kg of the basic diet.

[0018] Preferably, the product is an animal feces suspension produced after using the Lactobacillus plantarum postbiotic.

[0019] Preferably, the method for obtaining the animal feces suspension is:

[0020] Adding 4-12 mL of the Lactobacillus plantarum postbiotic to the basic diet of the animal, and feeding the animal to produce feces;

[0021] Take fresh feces, add PBS, mix well, and centrifuge to obtain bacterial suspension;

[0022] Take the bacterial suspension, add glycerol with a volume fraction of 20%, mix well, and obtain the animal feces suspension.

[0023] Preferably, the first bacterial liquid is obtained by static anaerobic culture for 12-24 hours.

[0024] Preferably, the volume ratio of the first bacterial liquid to the new broth culture medium is 1:50-100.

[0025] Preferably, the second bacterial liquid is obtained by static anaerobic culture for 12-24 hours.

[0026] Preferably, the animal is a piglet.

[0027] Compared with the prior art, the present invention has the following beneficial effects:

[0028] The present invention focuses on the effect of Lactobacillus plantarum postbiotics in alleviating neuroinflammation, and explores its molecular mechanism by improving intestinal flora and then regulating neurotransmitter metabolism, revealing that Lactobacillus plantarum postbiotics alleviate piglet neuroinflammation through the "microbe-gut-brain axis". It is a new field for explaining how probiotics promote animal health, and has distinct theoretical research characteristics and application value. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1 Show the effects of Lactobacillus plantarum postbiotics on brain morphology and brain barrier in LPS-challenged piglets; Figure 1 A in the middle is a H&E staining structure diagram of the cerebral cortex, where (1) is the control group (Control), (2) is the challenge group (LPS), (3) is the Lactobacillus plantarum postbiotic group (CFS), and (4) is the Lactobacillus plantarum postbiotic + challenge group (CFS + LPS); Figure 1 Middle B is the gene expression diagram of tight junction proteins in the brain barrier structure, where (1) is the relative expression level diagram of Claudin-1 gene, (2) is the relative expression level diagram of Occludin gene, and (3) is the relative expression level diagram of ZO-1 gene;

[0030] Figure 2 Show the effect of Lactobacillus plantarum postbiotics on inflammatory factors and inflammasomes in the “gut-brain axis” of LPS-challenged piglets; Figure 2 A in the middle is the concentration of inflammatory factors in the colon mucosa, serum and cerebral cortex of piglets, among which (1) is the concentration of IL-1β in the three tissues, (2) is the concentration of IL-6 in the three tissues, (3) is the concentration of TNF-α in the three tissues, and (4) is the concentration of IL-10 in the three tissues; Figure 2 Middle B is the gene expression diagram of inflammasome-related proteins in the cerebral cortex of piglets, among which (1) is the relative gene expression diagram of NLRP3, (2) is the relative gene expression diagram of ASC, (3) is the relative gene expression diagram of Caspase-1, (4) is the relative gene expression diagram of IL-1β, (5) is the relative gene expression diagram of IL-18, and (6) is the relative gene expression diagram of GSDMD;

[0031] Figure 3The figure shows the effect of Lactobacillus plantarum postbiotics on the short-chain fatty acids in the cecum of piglets challenged with LPS, wherein Figure (1) shows the content of acetic acid, Figure (2) shows the content of propionic acid, Figure (3) shows the content of butyric acid, Figure (4) shows the content of isobutyric acid, Figure (5) shows the content of valeric acid, and Figure (6) shows the content of isovaleric acid;

[0032] Figure 4 The effect of Lactobacillus plantarum postbiotics on the α-diversity of intestinal flora in piglets challenged with LPS is shown, where Figure (1) is the ACE index, Figure (2) is the Chao index, Figure (3) is the Shannon index, and Figure (4) is the Simpson index;

[0033] Figure 5 The effects of Lactobacillus plantarum postbiotics on the differences in the intestinal flora structure of piglets challenged with LPS are shown, including (1) the differences in species level between the control group (CON) and the LPS challenge group (LPS), (2) the differences in species level between the control group (CON) and the Lactobacillus plantarum postbiotic group (CFS), and (3) the differences in species level between the LPS challenge group (LPS) and the Lactobacillus plantarum postbiotics + LPS challenge group (CFS + LPS);

[0034] Figure 6 The fecal microbiota transplantation in mice verified that Lactobacillus plantarum postbiotics alleviate brain morphological damage by regulating the "microbe-gut-brain axis"; Figure 6 A in the middle is a H&E staining structure of the mouse cerebral cortex, where (1) is the control group (Control), (2) is the Salmonella challenge group (ST), (3) is the Lactobacillus plantarum postbiotic + Salmonella challenge group (CFS+ST), (4) is the fecal microbiota transplantation control group + Salmonella challenge group (FMT-Con+ST), and (5) is the fecal microbiota transplantation CFS group + Salmonella challenge group (FMT-CFS+ST); Figure 6 Middle B is the gene expression diagram of tight junction proteins in the mouse brain barrier structure, where (1) is the relative expression level diagram of Claudin-1 gene, (2) is the relative expression level diagram of Occludin gene, and (3) is the relative expression level diagram of ZO-1 gene;

[0035] Figure 7 Show that fecal microbiota transplantation in mice verifies that Lactobacillus plantarum postbiotics alleviate neuroinflammation by regulating the "microbe-gut-brain axis"; Figure 7A in the figure shows the concentrations of inflammatory factors in the colon mucosa, serum and cerebral cortex of mice, among which (1) is the concentration of IL-1β in the three tissues, (2) is the concentration of IL-6 in the three tissues, (3) is the concentration of TNF-α in the three tissues, and (4) is the concentration of IL-10 in the three tissues; Figure 7 Middle B is the gene expression diagram of inflammasome-related proteins in the cerebral cortex of piglets, among which (1) is the relative gene expression diagram of NLRP3, (2) is the relative gene expression diagram of ASC, (3) is the relative gene expression diagram of Caspase-1, (4) is the relative gene expression diagram of IL-1β, (5) is the relative gene expression diagram of IL-18, and (6) is the relative gene expression diagram of GSDMD. DETAILED DESCRIPTION

[0036] The specific embodiments of the present invention are described in detail below, but it should be understood that the protection scope of the present invention is not limited by the specific embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work belong to the protection scope of the present invention. The experimental methods described in the embodiments of the present invention are conventional methods unless otherwise specified.

[0037] The material information used in this invention is as follows:

[0038] Lactobacillus plantarum (L. plantarum) HJZW08 was screened by Zhejiang Huijia Biotechnology Co., Ltd. and preserved in the China General Microbiological Culture Collection Center, with the collection number CGMCC No. 23777), and the collection date was November 10, 2021.

[0039] Lipopolysaccharide LPS, derived from Salmonella enterica serotype Enteritidis (Sigma-Aldrich, USA). Salmonella Enterica Typhimurium (ST), number CMCC50115.

[0040] The design of test one of the present invention is as follows:

[0041] A total of 60 healthy 28-day-old weaned piglets of the "Du×Chang×Da" strain with similar body weight were selected and randomly divided into 4 groups, with 15 replicates in each group. The groups were as follows: control group (Control), LPS group, Lactobacillus plantarum culture supernatant group (CFS), and Lactobacillus plantarum culture supernatant + LPS group (CFS+LPS).

[0042] Control and LPS groups, 0.8% MRS medium (as a control for CFS) was added to the basal diet;

[0043] In the CFS and CFS+LPS groups, 0.8% CFS was added to the basal diet, i.e. 8 mL CFS was added to 1 kg basal diet, and the feeding was continued for 28 days. On the 29th day, LPS was intraperitoneally injected at 30 μg / kg body weight in the LPS and CFS+LPS groups, and the same volume of saline was intraperitoneally injected in the Control and CFS groups.

[0044] This feeding experiment was conducted in a pig farm in Zhejiang Province from November to December 2022. Each treatment group was fed with fine pellets three times a day in the morning, afternoon and evening. Each pen had a drinking trough, and the piglets could drink water freely. During the experiment, the piglets were vaccinated according to the immunization program established by the pig farm. The pig houses of each group were cleaned and disinfected every morning and evening. The basic diet of piglets did not contain antibiotics and was formulated according to the NRC (2012) piglet nutritional requirements standard.

[0045] The sample collection and pretreatment of the present invention are carried out according to the following steps:

[0046] Four hours after LPS challenge on day 29, six piglets of similar weight were selected from each group, and blood was collected from the anterior vena cava. After standing at room temperature for 30 minutes, serum was collected by centrifugation (3000×g, 10 minutes) and stored in a -80°C refrigerator. Approximately 1 cm of brain and colon tissue was fixed in 10% formalin solution for H&E staining. The colon, brain tissue and cecal contents of the piglets were collected and placed in a -80°C refrigerator.

[0047] The experimental operation involved in the present invention is carried out in the following manner:

[0048] H&E staining to analyze tissue morphology

[0049] The liver and ileum were fixed with 4% paraformaldehyde solution, and then dehydrated with ethanol and embedded in paraffin after 24 hours. 5 μm thin slices were cut, and the excess paraffin on the surface of the slices was removed by xylene, followed by alcohol rinsing, distilled water rinsing, and hematoxylin-eosin staining (HE) to stain the nucleus and cytoplasm respectively. The tissue morphology of the liver and ileum of each group was observed under an optical microscope, and the field of view was randomly selected for photography.

[0050] ELISA to measure the levels of inflammatory factors

[0051] After blood centrifugation, the upper serum was collected, and the colon mucosa and brain tissue were homogenized and centrifuged to obtain the supernatant. ELISA kits were used to determine the related indicators of inflammatory factors, including IL-1β, TNF-α, IL-4, IL-6, and IL-10.

[0052] Analysis of inflammasome gene expression and related signaling pathways by fluorescence quantitative PCR

[0053] Total RNA was extracted using the TRIzol kit (Abclonal), and then reverse transcribed into cDNA according to the instructions and stored at -80°C for future use. PCR reaction system: 2×Universal SYBR Green Fast qPCR Mix 5μL, forward and reverse primers (10μmol / L) 0.2μL each, DEPC water 3.6μL, cDNA (50ng / μL) 1μL. PCR reaction conditions: 95℃3min; 95℃5s, 60℃30s, 40 cycles, melting curve automatically set by the instrument. β-actin was used as the internal reference gene to quantitatively analyze the genes of NLRP3 inflammasome and TLR4 / MyD88 / NF-κB signaling pathway, and 2 -ΔΔCt The relative expression of the desired gene was calculated by the method. The primers were synthesized by Hangzhou Qingke Biotechnology Co., Ltd. The sequences of the forward and reverse primers are shown in Table 1:

[0054] Table 1 Forward and reverse primer sequences

[0055]

[0056]

[0057] Targeted metabolomics analysis of neurotransmitters and their signaling pathways in serum

[0058] The piglet blood was centrifuged to collect the upper serum for later use. Take 5 μL of the original supernatant, add 245 μL of water, vortex for 30 seconds, take 50 μL of the diluted sample, add 50 μL of 1000 ng / mL isotope internal standard, vortex for 30 seconds, centrifuge at 4°C, 14000×g for 2 minutes, and take the supernatant into a sample vial for the detection of 48 neurotransmitters. Before using the machine, prepare the neurotransmitter standard solution, namely: accurately weigh appropriate amounts of 48 neurotransmitter standards, prepare single-standard stock solutions with methanol or water, measure appropriate amounts of each stock solution to make a mixed standard, dilute with water to the appropriate concentration, and make a working standard solution; weigh appropriate amounts of isotope standards (Trp-D5, Glu-13C5), prepare single-standard stock solutions with methanol, measure appropriate amounts of each stock solution of the isotope standards to make a mixed isotope standard, and use water to prepare an isotope internal standard mixed standard solution with a concentration of 5000ng / mL and 1000ng / mL. LC-ESI-MS / MS (UHPLC-Qtrap) was used to qualitatively and quantitatively detect the target substances in the samples. The specific parameters were: ExionLCAD system, Waters HSS T3 (2.1x100 mm, 1.8μm) liquid chromatography column, column temperature 35°C, injection volume 1μL, mobile phase A (0.1% formic acid in water), mobile phase B (0.1% formic acid in acetonitrile). The default parameters were used in the AB Sciex quantitative software OS to automatically identify and integrate each ion fragment, and a linear regression standard curve was drawn with the ratio of the mass spectrum peak area of ​​the analyte to the internal standard peak area as the ordinate and the concentration of the analyte as the abscissa. Sample concentration calculation: Substitute the ratio of the mass spectrum peak area of ​​the sample analyte to the internal standard peak area into the linear equation to calculate the concentration result.

[0059] Volatile fatty acid determination

[0060] Prepare mixed standards and process samples. Sample processing: Take 0.5g of cecal contents and place them in a 2mL centrifuge tube. Add pre-cooled ddH2O at a mass volume ratio of 1:3. Record the sampling volume and the ratio of water added. Place the centrifuge tube on a vortex oscillator. After thawing, mix the contents in the tube. Centrifuge at 4°C, 12000×g for 10min and then aspirate the supernatant. Add 25% metaphosphoric acid at a ratio of 5:1 (volume ratio) of supernatant: 25% metaphosphoric acid. Mix well. Ice bath for 30min. Centrifuge at 12000×g at 4°C for 10min. Take the supernatant with a 1mL syringe, filter it through an inorganic phase filter head, and transfer it to an Agilent-compatible injection bottle for testing. After testing on the machine, the SCFA content of each sample can be read directly on the machine.

[0061] 16S rRNA determination of intestinal flora

[0062] Take about 1g of the piglet cecum contents, according to Total DNA was extracted according to the instructions of the soil kit (Omega Bio-tek, Norcross, GA, US). The DNA concentration and purity were detected by NanoDrop2000, and the quality of DNA extraction was detected by 1% agarose gel electrophoresis. The ITS2 variable region was PCR amplified using primers 338F: ACTCCTACGGGAGGCAGCAG, recorded as SEQ ID NO.41; 806R: GGACTACHVGG GTWTCTAAT, recorded as SEQ ID NO.42. The PCR product was recovered using 2% agarose gel, purified using AxyPrep DNAGel Extraction Kit (Axygen Biosciences, Union City, CA, USA), eluted with Tris-HCl, and detected by 2% agarose electrophoresis. QuantiFluor TM -ST (Promega, USA) was used for detection and quantification. The purified amplified fragments were used to construct a PE 2*300 library according to the standard operating procedures of the Illumina MiSeq platform (Illumina, San Diego, USA). The original sequencing sequence was quality controlled using Trimmomatic software, and the UPARSE software (version 7.1 http: / / drive5.com / uparse / ) used for splicing using FLASH software was used to cluster the sequences into OTUs based on 97% similarity, and single sequences and chimeras were removed during the clustering process. The RDP classifier (http: / / rdp.cme.msu.edu / ) was used to annotate each sequence for species classification, compare the database, and set the comparison threshold to 70%. Diversity and microbial flora structure analysis were performed on the Meiji Cloud platform.

[0063] Fecal microbiota transplantation in mice validates the role of the microbiome-gut-brain axis in alleviating neuroinflammation

[0064] The design of Experiment 2 is as follows:

[0065] Sixty healthy male C57BL / 6 mice were selected and divided into 5 groups: blank control group (Control), Salmonella group (ST), Lactobacillus plantarum culture supernatant + Salmonella group (CFS+ST), piglet control group fecal suspension + Salmonella group (FMT-Con+ST) and piglet Lactobacillus plantarum postbiotic group + Salmonella group (FMT-CFS+ST).

[0066] Preparation of fecal suspension: Take 4g of fresh feces from the piglet control group and the Lactobacillus plantarum culture supernatant group in Experiment 1 into 50mL centrifuge tubes, add 40mL pre-cooled PBS, and mix thoroughly by vortex oscillator until there is no obvious block of feces. Then centrifuge (900×g, 4°C) for 3min, take the bacterial suspension into a new 50mL centrifuge tube, record the volume of the bacterial suspension, add glycerol at a ratio of 20%, mix upside down, and then divide into 2mL centrifuge tubes to obtain the fecal bacterial suspension of the piglet control group (FMT-Con) and the fecal bacterial suspension of the piglet Lactobacillus plantarum culture supernatant group (FMT-CFS), and put them into a -80°C refrigerator for standby use.

[0067] The mice were gavaged with antibiotics daily for 7 consecutive days, including 6.25 mg / mL vancomycin, 12.5 mg / mL neomycin sulfate, metronidazole, and ampicillin, and the bacterial content in the mouse intestine was measured by plating. Starting from the 8th day, the mice in the Control and ST groups were gavaged with 100 μL PBS; the CFS+ST group was gavaged with 100 μL CFS; the FMT-Con+ST group was gavaged with 100 μL of the control group fecal suspension; the FMT-CFS+ST group was gavaged with 100 μL of the Lactobacillus plantarum postbiotic group fecal suspension for 14 days. On the 22nd day, the mice in the Control group were gavaged with 100 μL PBS, and the other groups were gavaged with 100 μL of 3×10 9 CFU / mL of Salmonella, and the mice were anesthetized with ether and sampled 3 days later. The structural morphology of the mouse brain and the indicators related to brain barrier and neuroinflammation were measured.

[0068] The 0.22 μm filter was purchased from Millipore Corporation, USA; the LGJ-18s in-situ vacuum freeze dryer was purchased from Shanghai Hefan Instrument Co., Ltd.

[0069] The composition of MRS broth medium is: 5 g beef extract, 10 g peptone, 5 g yeast extract, 20 g glucose, 5 g K2HPO4, 2 g triammonium citrate, 5 g anhydrous ammonium acetate, 0.5 g MgSO4.7H2O, 0.15 g MnSO4.H2O, 1 g Tween-80, 20 g agar, and 1000 mL distilled water.

[0070] Example 1

[0071] Preparation method of Lactobacillus plantarum postbiotics

[0072] Use an inoculation loop to pick a small amount of L. plantarum frozen at -80℃ and inoculate it into 250mL MRS broth medium. Incubate at 37℃ for 12h, then expand the inoculation volume to a new conical flask containing 1.5LMRS medium for 24h. Use 6 conical flasks containing 1.5LMRS medium for expansion. Centrifuge the cultured bacterial solution at 5000×g and 4℃ for 15min, collect the supernatant, and filter it through a 0.22μm filter to obtain the plant lactobacillus culture supernatant (Cell-free supernatant, CFS), i.e. plant lactobacillus postbiotics.

[0073] After all CFS were collected, there was about 8 L, which was mixed evenly and dispensed into sterilized sample bottles and placed in a 4°C refrigerator for use.

[0074] The method for determining the CFS concentration is as follows: take 50 mL of the prepared CFS and dry it in an LGJ-18s in-situ vacuum freeze dryer. Under the conditions of a freezing temperature of -45 to 30°C and a vacuum degree of 10 Pa, freeze-dry for 30 hours to obtain CFS freeze-dried powder. Weigh its weight and calculate the CFS concentration to be 40 mg / mL.

[0075] Example 2

[0076] Lactobacillus plantarum postbiotics alleviate LPS-induced brain damage in piglets

[0077] H&E staining results Figure 1 As shown in A(1)-(4), after LPS challenge, inflammatory cells infiltrated the cerebral cortex of piglets, and obvious structural damage was observed. However, pre-feeding with CFS significantly alleviated this damage and maintained the structural integrity of the cerebral cortex. Figure 1 B(1)-(3) show the gene expression levels of tight junction proteins (Claudin-1, Occludin, ZO-1) of the brain barrier. Compared with the Control group, the expression levels of Claudin-1 and Occludin in the LPS group were significantly decreased (P<0.05), while CFS significantly increased the Occludin level (P<0.01). Compared with the LPS group, the Claudin-1 in the CFS+LPS group was significantly increased (P<0.05).

[0078] Example 3

[0079] Lactobacillus plantarum postbiotics significantly inhibit the release of inflammatory factors and activation of inflammasomes in the gut-brain axis of piglets

[0080] Figure 2A(1)-(4) show the levels of inflammatory factors IL-1β, IL-6, TNF-α and IL-10 in the colon, serum and brain of piglets in the "gut-brain axis". Specifically, compared with the Control group, LPS challenge significantly increased the levels of proinflammatory factors IL-1β, IL-6 and TNF-α in the colon, serum and brain (P<0.001, P<0.01); compared with the LPS group, CFS pretreatment, i.e. CFS+LPS, reversed this trend and significantly reduced IL-1β (P<0.05, P<0.05, P<0.01), IL-6 (P<0.001, P<0.01, P<0.01) and TNF-α (P<0.05, P<0.05, P<0.01) in the colon, serum and brain. LPS challenge significantly reduced the content of anti-inflammatory factor IL-10 in colon, serum and brain (P<0.001, P<0.05, P<0.001), while CFS pretreatment significantly increased the level of IL-10 in colon (P<0.05). Figure 2 B(1)-(6), further exploration of the NLRP3 inflammasome marker molecules revealed that LPS challenge significantly increased the expression levels of NLRP3 (P<0.01), IL-1β (P<0.01), IL-18 (P<0.05), and GSDMD (P<0.05) in the brain, while CFS pretreatment significantly reduced NLRP3 (P<0.01) and IL-1β (P<0.05).

[0081] The above results prove that CFS pre-feeding piglets can significantly alleviate the level of neuroinflammation in piglets caused by LPS challenge.

[0082] Example 4

[0083] Lactobacillus plantarum postbiotics can significantly regulate the levels of neurotransmitters in piglets, especially affecting the tryptophan metabolic pathway

[0084] The results of the analysis of 48 neurotransmitters and key molecules of their metabolic pathways by LC-MS / MS are shown in Table 2. Table 2 shows that the differential neurotransmitters and key molecules in piglet serum are mainly tryptophan metabolism: 5-hydroxytryptamine, kynurenic acid and indole-pyruvic acid pathways. Serotonin pathway: LPS challenge significantly reduced the content of L-Tryptophan and 5-Hydroxyindolacetic acid, while CFS pretreatment could reduce their content (P<0.05). Kynurenine pathway: Kynurenine and 3-Hydroxy-DL-kynurenine in the LPS group increased significantly, while CFS pretreatment could reverse this trend (P<0.05). Indole pyruvate pathway: LPS challenge reduced 3-Indolepropionic acid, while CFS pretreatment had a tendency to inhibit its reduction; LPS significantly increased Indolelactic acid (P<0.05), while CFS pretreatment significantly reduced it (P<0.05).

[0085] The above results indicate that CFS pre-feeding can regulate the neurotransmitter metabolism level of piglets and improve the tryptophan metabolism changes caused by LPS challenge.

[0086] Table 2 Effects of Lactobacillus plantarum postbiotics on neurotransmitters and related metabolic pathways in LPS-challenged piglets

[0087]

[0088] Example 5

[0089] Lactobacillus plantarum postbiotics can increase the content of volatile fatty acids in the cecum and improve the level of microbial metabolism. Effects of Lactobacillus plantarum postbiotics on volatile fatty acids in the cecum of LPS-challenged piglets Figure 3 As shown in (1)-(6), compared with the Control group, the intestinal acetic acid level in the CFS group was significantly increased (P<0.01), and the propionic acid and butyric acid contents were extremely significantly increased (P<0.001). Compared with the LPS group, the acetic acid and butyric acid levels in the CFS+LPS group were significantly increased (P<0.01).

[0090] Example 6

[0091] Lactobacillus plantarum postbiotics can improve intestinal flora and increase the abundance of lactic acid bacteria

[0092] Figure 4(1)-(4) indicated that there was no significant difference in the α-diversity of intestinal flora (ACE, Chao, Shannon and Simpson index) among the groups (P>0.05).

[0093] Figure 5 (1)-(3) indicate the differences in microbial composition between groups at the species level. Figure 5 As shown in (1), compared with the Control, LPS treatment significantly reduced the abundance of unclassified_g__Streptococcus, unclassified_f_Lachnospiraceae, uncultured_bacterium_9__noran k_f_p-251-o5, Lactobacillus_johnsonii, and uncultured_bacterium_g__Erysipelotrich aceae_UCG-003 (P<0.05), and significantly increased the abundance of unclassified_g_norank_f_noran k_O_RF39, Clostridium_bornimense, unclassified_g_uncultured_f_Oscillospiraceae, uncultured_organism_9_Family_XIIL_AD3011_group, and uncultured_organism_9__Coprococcus (P<0.05). Figure 5 As shown in (2), CFS significantly increased the abundance of Lactobacillus_amylovorus, Lactobacillus_reuteri, Clostridiaceae_bacterium_DJF_VR76, and uncultured_bacterium_g__norank_f_norank_o__Clostridia_UCG-014 (P<0.05); Figure 5 (3) indicates the difference between the LPS and CFS+LPS groups. CFS can significantly reverse the changes in intestinal flora caused by LPS and significantly increase the abundance of beneficial bacteria Lactobacillus_amylovorus (P<0.05). As shown above, CFS pretreatment can significantly improve the dysbiosis caused by LPS challenge, mainly by increasing the content of Lactobacillus_amylovorus and Lactobacillus_reuteri.

[0094] Example 7

[0095] Fecal microbiota transplantation verifies that Lactobacillus plantarum postbiotics alleviate brain morphological damage by regulating the "microbe-gut-brain axis"

[0096] The fecal microbiota of piglets treated with CON and CFS was transplanted into the intestines of mice, and then ST was challenged to verify the effect of intestinal flora in alleviating Salmonella-induced neuroinflammation. Figure 6 As shown in A(1)-(5), after ST challenge, the infiltration of inflammatory cells in brain tissue increased, while FMT-CFS pretreatment could significantly alleviate this trend. Figure 6 B(1)-(3) The results showed that ST infection could significantly reduce the gene expression level of Occludin (P<0.01), while the FMT-CFS pretreatment group could significantly reverse the decrease in Occludin expression level (P<0.05).

[0097] Example 8

[0098] Fecal microbiota transplantation verifies that Lactobacillus plantarum postbiotics alleviate neuroinflammation by regulating the "microbe-gut-brain axis"

[0099] like Figure 7 As shown in A(1)-(4), ST challenge significantly increased the levels of pro-inflammatory factors (IL-1β, IL-6 and TNF-α) in the colon, serum and brain (P<0.001). Compared with the ST group, the FMT-CFS+ST group significantly reduced IL-1β in the colon, serum and brain (P<0.001), IL-6 in the colon and serum (P<0.001), and significantly reduced TNF-α in the colon, serum and brain (P<0.001, P<0.01, P<0.01). ST challenge significantly reduced the level of the anti-inflammatory factor IL-10 in the colon, serum and brain (P<0.001), while FMT-CFS pretreatment significantly reversed this trend (P<0.001, P<0.01, P<0.01). Figure 7 As shown in B(1)-(6), ST challenge significantly increased the gene expression of NLRP3 and IL-1β in the brain (P<0.01), while the FMT-CFS+ST group significantly inhibited their expression (P<0.05).

[0100] It should be noted that when the claims of the present invention involve numerical ranges, it should be understood that the two endpoints of each numerical range and any numerical value between the two endpoints can be selected. In order to avoid redundancy, the present invention describes a preferred embodiment.

[0101] Although the preferred embodiments of the present invention have been described, those skilled in the art may make other changes and modifications to these embodiments once they have learned the basic creative concept. Therefore, the appended claims are intended to be interpreted as including the preferred embodiments and all changes and modifications that fall within the scope of the present invention.

[0102] Obviously, those skilled in the art can make various changes and modifications to the present invention without departing from the spirit and scope of the present invention. Thus, if these modifications and variations of the present invention fall within the scope of the claims of the present invention and their equivalents, the present invention is also intended to include these modifications and variations.

Claims

1. Application of Lactobacillus plantarum postbiotics in the preparation of products for alleviating animal neuroinflammation, characterized in that: The Lactobacillus plantarum postbiotics are fermentation metabolites of Lactobacillus plantarum HJZW08, and the preservation number of the Lactobacillus plantarum HJZW08 is CGMCC No.23777.

2. The use according to claim 1, characterized in that: The product is the Lactobacillus plantarum postbiotic; The preparation method of the plant lactobacillus postbiotic comprises the following steps: Inoculating the Lactobacillus plantarum HJZW08 into a broth medium to obtain a first bacterial liquid; The first bacterial liquid is inoculated into a new broth medium to obtain a second bacterial liquid; The cell-free fermentation supernatant of the second bacterial liquid is collected and filtered to obtain the Lactobacillus plantarum culture supernatant, i.e., the Lactobacillus plantarum postbiotics.

3. The use according to claim 2, characterized in that: The concentration of solids in the Lactobacillus plantarum postbiotic is 30-40 mg / mL.

4. The use according to claim 2, characterized in that: The usage amount of the Lactobacillus plantarum postbiotic is 4-12 mL of the Lactobacillus plantarum postbiotic added to 1 kg of the basic diet.

5. The use according to claim 2, characterized in that: The product is an animal feces suspension produced after using the Lactobacillus plantarum postbiotic.

6. The use according to claim 5, characterized in that: The method for obtaining the animal feces suspension is: Adding 4-12 mL of the Lactobacillus plantarum postbiotic to the basic diet of the animal, and feeding the animal to produce feces; Take fresh feces, add PBS, mix well, and centrifuge to obtain bacterial suspension; Take the bacterial suspension, add glycerol with a volume fraction of 20%, mix well, and obtain the animal feces suspension.

7. The use according to claim 2, characterized in that: The first bacterial liquid is obtained by static anaerobic culture for 12-24 hours.

8. The use according to claim 2, characterized in that: The volume ratio of the first bacterial liquid to the new broth culture medium is 1:50-100.

9. The use according to claim 2, characterized in that: The second bacterial liquid is obtained by static anaerobic culture for 12-24 hours.

10. The use according to claim 1, characterized in that: The animals are piglets.

Images